From b6542a65b8d213d1547ca897eee0072ab0b733a6 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 17 Apr 2025 12:23:51 +0200 Subject: [PATCH 01/38] nf-core modules update -f -a --- modules.json | 206 +++-- modules/nf-core/ascat/environment.yml | 11 +- modules/nf-core/ascat/main.nf | 117 +-- modules/nf-core/ascat/tests/main.nf.test | 131 ++++ modules/nf-core/ascat/tests/main.nf.test.snap | 373 +++++++++ modules/nf-core/ascat/tests/nextflow.config | 12 + .../nf-core/bcftools/annotate/environment.yml | 4 +- modules/nf-core/bcftools/annotate/main.nf | 13 +- modules/nf-core/bcftools/annotate/meta.yml | 3 + .../bcftools/annotate/tests/main.nf.test | 67 +- .../bcftools/annotate/tests/main.nf.test.snap | 309 ++++---- .../nf-core/bcftools/annotate/tests/tags.yml | 2 - .../nf-core/bcftools/concat/environment.yml | 4 +- modules/nf-core/bcftools/concat/main.nf | 40 +- modules/nf-core/bcftools/concat/meta.yml | 11 +- .../bcftools/concat/tests/main.nf.test.snap | 272 +++---- .../nf-core/bcftools/concat/tests/tags.yml | 2 - .../nf-core/bcftools/mpileup/environment.yml | 4 +- modules/nf-core/bcftools/mpileup/main.nf | 8 +- .../bcftools/mpileup/tests/main.nf.test.snap | 48 +- .../nf-core/bcftools/mpileup/tests/tags.yml | 2 - modules/nf-core/bcftools/sort/environment.yml | 4 +- modules/nf-core/bcftools/sort/main.nf | 4 +- .../bcftools/sort/tests/main.nf.test.snap | 74 +- modules/nf-core/bcftools/sort/tests/tags.yml | 2 - .../nf-core/bcftools/stats/environment.yml | 6 +- modules/nf-core/bcftools/stats/main.nf | 4 +- .../bcftools/stats/tests/main.nf.test.snap | 90 +-- modules/nf-core/bcftools/stats/tests/tags.yml | 2 - modules/nf-core/bwa/index/environment.yml | 8 + modules/nf-core/bwa/index/main.nf | 12 +- modules/nf-core/bwa/index/meta.yml | 13 +- modules/nf-core/bwa/index/tests/tags.yml | 2 - modules/nf-core/bwa/mem/environment.yml | 11 +- modules/nf-core/bwa/mem/main.nf | 6 +- modules/nf-core/bwa/mem/meta.yml | 18 +- .../nf-core/bwa/mem/tests/main.nf.test.snap | 70 +- modules/nf-core/bwa/mem/tests/tags.yml | 3 - modules/nf-core/bwamem2/index/environment.yml | 10 +- modules/nf-core/bwamem2/index/main.nf | 8 +- modules/nf-core/bwamem2/index/meta.yml | 7 +- modules/nf-core/bwamem2/index/tests/tags.yml | 2 - modules/nf-core/bwamem2/mem/environment.yml | 9 +- modules/nf-core/bwamem2/mem/main.nf | 7 +- modules/nf-core/bwamem2/mem/meta.yml | 16 +- .../bwamem2/mem/tests/main.nf.test.snap | 50 +- modules/nf-core/bwamem2/mem/tests/tags.yml | 2 - modules/nf-core/cat/cat/environment.yml | 2 + modules/nf-core/cat/cat/tests/tags.yml | 2 - modules/nf-core/cat/fastq/environment.yml | 7 + modules/nf-core/cat/fastq/main.nf | 31 +- modules/nf-core/cat/fastq/tests/main.nf.test | 90 ++- .../nf-core/cat/fastq/tests/main.nf.test.snap | 176 +++-- modules/nf-core/cat/fastq/tests/tags.yml | 2 - .../nf-core/cnvkit/antitarget/environment.yml | 2 + .../nf-core/cnvkit/antitarget/tests/tags.yml | 2 - modules/nf-core/cnvkit/batch/environment.yml | 6 +- modules/nf-core/cnvkit/batch/tests/tags.yml | 2 - modules/nf-core/cnvkit/call/environment.yml | 2 + .../nf-core/cnvkit/call/tests/main.nf.test | 6 +- .../cnvkit/call/tests/main.nf.test.snap | 20 +- modules/nf-core/cnvkit/export/environment.yml | 2 + modules/nf-core/cnvkit/export/main.nf | 14 +- modules/nf-core/cnvkit/export/meta.yml | 5 +- .../nf-core/cnvkit/export/tests/main.nf.test | 191 +++++ .../cnvkit/export/tests/main.nf.test.snap | 247 ++++++ .../cnvkit/export/tests/nextflow.config | 5 + .../cnvkit/genemetrics/environment.yml | 2 + .../cnvkit/genemetrics/tests/main.nf.test | 6 +- .../genemetrics/tests/main.nf.test.snap | 20 +- .../nf-core/cnvkit/reference/environment.yml | 2 + .../nf-core/cnvkit/reference/tests/tags.yml | 2 - .../controlfreec-assesssignificance.diff | 5 +- .../assesssignificance/environment.yml | 2 + .../assesssignificance/tests/tags.yml | 2 - .../controlfreec/freec/environment.yml | 2 + .../nf-core/controlfreec/freec/tests/tags.yml | 2 - .../controlfreec/freec2bed/environment.yml | 2 + .../controlfreec/freec2bed/tests/tags.yml | 2 - .../controlfreec/freec2circos/environment.yml | 2 + .../controlfreec/freec2circos/tests/tags.yml | 2 - .../controlfreec/makegraph2/environment.yml | 2 + .../controlfreec/makegraph2/tests/tags.yml | 2 - .../deepvariant/rundeepvariant/main.nf | 27 +- .../rundeepvariant/tests/main.nf.test.snap | 104 +-- .../deepvariant/rundeepvariant/tests/tags.yml | 2 - modules/nf-core/dragmap/align/environment.yml | 10 +- modules/nf-core/dragmap/align/main.nf | 66 +- .../nf-core/dragmap/align/tests/main.nf.test | 34 +- .../dragmap/align/tests/main.nf.test.snap | 181 ++++- modules/nf-core/dragmap/align/tests/tags.yml | 2 - .../nf-core/dragmap/hashtable/environment.yml | 3 + modules/nf-core/dragmap/hashtable/main.nf | 20 +- .../dragmap/hashtable/tests/main.nf.test | 17 +- .../dragmap/hashtable/tests/main.nf.test.snap | 56 +- .../nf-core/dragmap/hashtable/tests/tags.yml | 2 - .../ensemblvep/download/environment.yml | 2 +- modules/nf-core/ensemblvep/download/main.nf | 4 +- .../ensemblvep/download/tests/tags.yml | 2 - .../nf-core/ensemblvep/vep/environment.yml | 2 +- modules/nf-core/ensemblvep/vep/main.nf | 4 +- modules/nf-core/ensemblvep/vep/tests/tags.yml | 2 - modules/nf-core/fastp/environment.yml | 4 +- modules/nf-core/fastp/main.nf | 4 +- modules/nf-core/fastp/meta.yml | 5 +- modules/nf-core/fastp/tests/main.nf.test.snap | 180 ++--- modules/nf-core/fastp/tests/tags.yml | 2 - modules/nf-core/fastqc/environment.yml | 2 + modules/nf-core/fastqc/main.nf | 22 +- modules/nf-core/fastqc/meta.yml | 1 + modules/nf-core/fastqc/tests/tags.yml | 2 - .../environment.yml | 4 +- .../fgbio/callmolecularconsensusreads/main.nf | 4 +- .../tests/main.nf.test.snap | 20 +- .../tests/tags.yml | 2 - .../nf-core/fgbio/fastqtobam/environment.yml | 4 +- modules/nf-core/fgbio/fastqtobam/main.nf | 4 +- .../fgbio/fastqtobam/tests/main.nf.test.snap | 56 +- .../nf-core/fgbio/fastqtobam/tests/tags.yml | 2 - .../fgbio/groupreadsbyumi/environment.yml | 4 +- modules/nf-core/fgbio/groupreadsbyumi/main.nf | 4 +- .../nf-core/fgbio/groupreadsbyumi/meta.yml | 2 +- .../groupreadsbyumi/tests/main.nf.test.snap | 20 +- .../fgbio/groupreadsbyumi/tests/tags.yml | 2 - modules/nf-core/freebayes/environment.yml | 2 + modules/nf-core/freebayes/main.nf | 10 +- modules/nf-core/freebayes/meta.yml | 10 +- modules/nf-core/freebayes/tests/tags.yml | 2 - .../nf-core/gatk4/applybqsr/environment.yml | 6 +- modules/nf-core/gatk4/applybqsr/main.nf | 4 +- .../gatk4/applybqsr/tests/main.nf.test.snap | 56 +- .../nf-core/gatk4/applybqsr/tests/tags.yml | 2 - .../nf-core/gatk4/applyvqsr/environment.yml | 6 +- modules/nf-core/gatk4/applyvqsr/main.nf | 4 +- .../gatk4/applyvqsr/tests/main.nf.test.snap | 26 +- .../nf-core/gatk4/applyvqsr/tests/tags.yml | 2 - .../gatk4/baserecalibrator/environment.yml | 6 +- .../nf-core/gatk4/baserecalibrator/main.nf | 14 +- .../nf-core/gatk4/baserecalibrator/meta.yml | 35 +- .../gatk4/baserecalibrator/tests/main.nf.test | 180 +++-- .../baserecalibrator/tests/main.nf.test.snap | 155 +++- .../gatk4/baserecalibrator/tests/tags.yml | 2 - .../calculatecontamination/environment.yml | 6 +- .../gatk4/calculatecontamination/main.nf | 4 +- .../tests/main.nf.test.snap | 34 +- .../calculatecontamination/tests/tags.yml | 2 - .../nf-core/gatk4/cnnscorevariants/README.md | 9 - .../gatk4/cnnscorevariants/environment.yml | 8 + .../nf-core/gatk4/cnnscorevariants/main.nf | 25 +- .../gatk4/cnnscorevariants/tests/main.nf.test | 77 ++ .../cnnscorevariants/tests/main.nf.test.snap | 65 ++ .../createsequencedictionary/environment.yml | 6 +- .../gatk4/createsequencedictionary/main.nf | 6 +- .../tests/main.nf.test.snap | 20 +- .../createsequencedictionary/tests/tags.yml | 2 - .../estimatelibrarycomplexity/environment.yml | 6 +- .../gatk4/estimatelibrarycomplexity/main.nf | 18 +- .../tests/main.nf.test | 2 +- .../tests/main.nf.test.snap | 26 +- .../estimatelibrarycomplexity/tests/tags.yml | 2 - .../gatk4/filtermutectcalls/environment.yml | 6 +- .../nf-core/gatk4/filtermutectcalls/main.nf | 4 +- .../filtermutectcalls/tests/main.nf.test.snap | 34 +- .../gatk4/filtermutectcalls/tests/tags.yml | 2 - .../filtervarianttranches/environment.yml | 6 +- .../gatk4/filtervarianttranches/main.nf | 21 +- .../filtervarianttranches/tests/main.nf.test | 78 ++ .../tests/main.nf.test.snap | 65 ++ .../tests/nextflow.config | 6 + .../gatk4/gatherbqsrreports/environment.yml | 6 +- .../nf-core/gatk4/gatherbqsrreports/main.nf | 6 +- .../gatherbqsrreports/tests/main.nf.test.snap | 20 +- .../gatherpileupsummaries/environment.yml | 6 +- .../gatk4/gatherpileupsummaries/main.nf | 4 +- .../tests/main.nf.test.snap | 20 +- .../gatk4/genomicsdbimport/environment.yml | 6 +- .../nf-core/gatk4/genomicsdbimport/main.nf | 6 +- .../nf-core/gatk4/genomicsdbimport/meta.yml | 2 +- .../genomicsdbimport/tests/main.nf.test.snap | 34 +- .../gatk4/genomicsdbimport/tests/tags.yml | 3 - .../gatk4/genotypegvcfs/environment.yml | 6 +- modules/nf-core/gatk4/genotypegvcfs/main.nf | 6 +- .../genotypegvcfs/tests/main.nf.test.snap | 50 +- .../gatk4/getpileupsummaries/environment.yml | 6 +- .../nf-core/gatk4/getpileupsummaries/main.nf | 4 +- .../tests/main.nf.test.snap | 38 +- .../gatk4/getpileupsummaries/tests/tags.yml | 2 - .../gatk4/haplotypecaller/environment.yml | 6 +- modules/nf-core/gatk4/haplotypecaller/main.nf | 6 +- .../haplotypecaller/tests/main.nf.test.snap | 32 +- .../gatk4/haplotypecaller/tests/tags.yml | 2 - .../gatk4/intervallisttobed/environment.yml | 6 +- .../gatk4-intervallisttobed.diff | 10 +- .../nf-core/gatk4/intervallisttobed/main.nf | 16 +- .../intervallisttobed/tests/main.nf.test | 58 ++ .../intervallisttobed/tests/main.nf.test.snap | 72 ++ .../learnreadorientationmodel/environment.yml | 6 +- .../gatk4/learnreadorientationmodel/main.nf | 4 +- .../tests/main.nf.test.snap | 8 +- .../gatk4/markduplicates/environment.yml | 6 +- modules/nf-core/gatk4/markduplicates/main.nf | 2 +- .../gatk4/markduplicates/tests/tags.yml | 2 - .../gatk4/mergemutectstats/environment.yml | 6 +- .../nf-core/gatk4/mergemutectstats/main.nf | 6 +- .../mergemutectstats/tests/main.nf.test.snap | 18 +- .../gatk4/mergemutectstats/tests/tags.yml | 2 - .../nf-core/gatk4/mergevcfs/environment.yml | 6 +- modules/nf-core/gatk4/mergevcfs/main.nf | 6 +- .../gatk4/mergevcfs/tests/main.nf.test | 3 + .../gatk4/mergevcfs/tests/main.nf.test.snap | 27 +- .../nf-core/gatk4/mergevcfs/tests/tags.yml | 2 - modules/nf-core/gatk4/mutect2/environment.yml | 6 +- modules/nf-core/gatk4/mutect2/main.nf | 10 +- .../nf-core/gatk4/mutect2/tests/f1r2.config | 3 - .../nf-core/gatk4/mutect2/tests/main.nf.test | 65 +- .../gatk4/mutect2/tests/main.nf.test.snap | 219 ++++-- .../nf-core/gatk4/mutect2/tests/mito.config | 3 - .../gatk4/mutect2/tests/nextflow.config | 5 + .../nf-core/gatk4/mutect2/tests/pair.config | 3 - modules/nf-core/gatk4/mutect2/tests/tags.yml | 2 - .../gatk4/variantrecalibrator/environment.yml | 6 +- .../nf-core/gatk4/variantrecalibrator/main.nf | 4 +- .../gatk4/variantrecalibrator/tests/AS.config | 7 + .../variantrecalibrator/tests/main.nf.test | 167 ++++ .../tests/main.nf.test.snap | 133 ++++ .../variantrecalibrator/tests/noAS.config | 8 + .../gatk4spark/applybqsr/environment.yml | 4 +- modules/nf-core/gatk4spark/applybqsr/main.nf | 43 +- modules/nf-core/gatk4spark/applybqsr/meta.yml | 160 ++-- .../gatk4spark/applybqsr/tests/main.nf.test | 148 +++- .../applybqsr/tests/main.nf.test.snap | 168 +++- .../gatk4spark/applybqsr/tests/tags.yml | 2 - .../baserecalibrator/environment.yml | 4 +- .../gatk4spark/baserecalibrator/main.nf | 53 +- .../baserecalibrator/tests/main.nf.test | 268 +++++++ .../baserecalibrator/tests/main.nf.test.snap | 306 ++++++++ .../baserecalibrator/tests/nextflow.config | 2 + .../gatk4spark/markduplicates/environment.yml | 4 +- .../nf-core/gatk4spark/markduplicates/main.nf | 38 +- .../markduplicates/tests/main.nf.test | 199 +++-- .../markduplicates/tests/main.nf.test.snap | 326 ++++++-- .../gatk4spark/markduplicates/tests/tags.yml | 2 - modules/nf-core/gawk/environment.yml | 2 + modules/nf-core/gawk/main.nf | 29 +- modules/nf-core/gawk/meta.yml | 12 +- modules/nf-core/gawk/tests/main.nf.test | 114 ++- modules/nf-core/gawk/tests/main.nf.test.snap | 68 +- modules/nf-core/gawk/tests/nextflow.config | 4 +- .../tests/nextflow_with_program_file.config | 5 - modules/nf-core/gawk/tests/tags.yml | 2 - .../nf-core/goleft/indexcov/environment.yml | 2 + .../nf-core/goleft/indexcov/tests/tags.yml | 2 - .../lofreq/callparallel/environment.yml | 2 + .../lofreq/callparallel/tests/tags.yml | 2 - .../nf-core/manta/germline/environment.yml | 2 + modules/nf-core/manta/germline/tests/tags.yml | 2 - modules/nf-core/manta/somatic/environment.yml | 2 + modules/nf-core/manta/somatic/tests/tags.yml | 2 - .../nf-core/manta/tumoronly/environment.yml | 2 + .../nf-core/manta/tumoronly/tests/tags.yml | 2 - modules/nf-core/mosdepth/environment.yml | 4 +- modules/nf-core/mosdepth/main.nf | 4 +- .../nf-core/mosdepth/tests/main.nf.test.snap | 132 ++-- modules/nf-core/mosdepth/tests/tags.yml | 2 - .../msisensorpro/msisomatic/environment.yml | 2 + .../nf-core/msisensorpro/scan/environment.yml | 2 + modules/nf-core/multiqc/environment.yml | 4 +- modules/nf-core/multiqc/main.nf | 4 +- .../nf-core/multiqc/tests/main.nf.test.snap | 18 +- modules/nf-core/multiqc/tests/tags.yml | 2 - .../nf-core/ngscheckmate/ncm/environment.yml | 3 + modules/nf-core/ngscheckmate/ncm/main.nf | 4 +- .../ngscheckmate/ncm/tests/main.nf.test | 28 +- .../ngscheckmate/ncm/tests/main.nf.test.snap | 19 +- .../nf-core/ngscheckmate/ncm/tests/tags.yml | 2 - modules/nf-core/samblaster/environment.yml | 2 + modules/nf-core/samblaster/tests/tags.yml | 2 - .../nf-core/samtools/bam2fq/tests/tags.yml | 2 - .../samtools/collatefastq/tests/tags.yml | 2 - modules/nf-core/samtools/convert/main.nf | 2 +- .../samtools/convert/tests/main.nf.test.snap | 10 +- .../nf-core/samtools/convert/tests/tags.yml | 2 - modules/nf-core/samtools/faidx/main.nf | 13 +- modules/nf-core/samtools/faidx/meta.yml | 20 +- .../nf-core/samtools/faidx/tests/main.nf.test | 107 ++- .../samtools/faidx/tests/main.nf.test.snap | 336 +++++++- modules/nf-core/samtools/faidx/tests/tags.yml | 2 - modules/nf-core/samtools/index/tests/tags.yml | 2 - modules/nf-core/samtools/merge/tests/tags.yml | 2 - .../nf-core/samtools/mpileup/tests/tags.yml | 2 - modules/nf-core/samtools/stats/main.nf | 1 - modules/nf-core/samtools/stats/tests/tags.yml | 2 - modules/nf-core/samtools/view/environment.yml | 1 + modules/nf-core/samtools/view/main.nf | 36 +- modules/nf-core/samtools/view/meta.yml | 8 +- .../samtools/view/tests/cram_index.config | 3 + .../nf-core/samtools/view/tests/main.nf.test | 249 ++++++ .../samtools/view/tests/main.nf.test.snap | 724 ++++++++++++++---- modules/nf-core/samtools/view/tests/tags.yml | 2 - .../sentieon/applyvarcal/environment.yml | 2 + .../nf-core/sentieon/bwamem/environment.yml | 2 + .../nf-core/sentieon/bwamem/tests/tags.yml | 2 - .../nf-core/sentieon/dedup/environment.yml | 2 + .../sentieon/dnamodelapply/environment.yml | 2 + .../nf-core/sentieon/dnascope/environment.yml | 2 + .../sentieon/gvcftyper/environment.yml | 2 + .../sentieon/gvcftyper/tests/nextflow.config | 2 +- .../sentieon/haplotyper/environment.yml | 2 + .../sentieon/haplotyper/tests/tags.yml | 2 - .../nf-core/sentieon/varcal/environment.yml | 2 + modules/nf-core/snpeff/snpeff/tests/tags.yml | 2 - .../nf-core/spring/decompress/environment.yml | 2 + .../nf-core/spring/decompress/test/tags.yml | 3 - .../decompress/{test => tests}/main.nf.test | 3 +- .../{test => tests}/main.nf.test.snap | 0 .../{test => tests}/nextflow.config | 0 .../nf-core/strelka/germline/environment.yml | 2 + .../nf-core/strelka/somatic/environment.yml | 2 + .../nf-core/strelka/somatic/tests/tags.yml | 2 - modules/nf-core/svdb/merge/environment.yml | 2 + modules/nf-core/svdb/merge/main.nf | 21 +- modules/nf-core/svdb/merge/tests/tags.yml | 2 - .../nf-core/tabix/bgziptabix/environment.yml | 4 +- modules/nf-core/tabix/bgziptabix/main.nf | 4 +- .../tabix/bgziptabix/tests/main.nf.test | 2 +- .../tabix/bgziptabix/tests/main.nf.test.snap | 40 +- .../nf-core/tabix/bgziptabix/tests/tags.yml | 2 - modules/nf-core/tabix/tabix/environment.yml | 2 +- modules/nf-core/tabix/tabix/main.nf | 4 +- .../nf-core/tabix/tabix/tests/main.nf.test | 2 +- .../tabix/tabix/tests/main.nf.test.snap | 50 +- modules/nf-core/tabix/tabix/tests/tags.yml | 2 - modules/nf-core/tiddit/sv/environment.yml | 2 + modules/nf-core/tiddit/sv/tests/tags.yml | 2 - modules/nf-core/untar/environment.yml | 5 + modules/nf-core/untar/main.nf | 36 +- modules/nf-core/untar/meta.yml | 9 +- modules/nf-core/untar/tests/tags.yml | 2 - modules/nf-core/unzip/environment.yml | 2 + modules/nf-core/unzip/tests/tags.yml | 2 - modules/nf-core/vcftools/environment.yml | 2 + modules/nf-core/vcftools/main.nf | 2 +- modules/nf-core/vcftools/meta.yml | 2 +- modules/nf-core/vcftools/tests/tags.yml | 2 - subworkflows/nf-core/bam_ngscheckmate/main.nf | 9 +- .../bam_ngscheckmate/tests/main.nf.test | 147 ++++ .../bam_ngscheckmate/tests/main.nf.test.snap | 99 +++ .../bam_ngscheckmate/tests/nextflow.config | 9 + 348 files changed, 7775 insertions(+), 2557 deletions(-) create mode 100644 modules/nf-core/ascat/tests/main.nf.test create mode 100644 modules/nf-core/ascat/tests/main.nf.test.snap create mode 100644 modules/nf-core/ascat/tests/nextflow.config delete mode 100644 modules/nf-core/bcftools/annotate/tests/tags.yml delete mode 100644 modules/nf-core/bcftools/concat/tests/tags.yml delete mode 100644 modules/nf-core/bcftools/mpileup/tests/tags.yml delete mode 100644 modules/nf-core/bcftools/sort/tests/tags.yml delete mode 100644 modules/nf-core/bcftools/stats/tests/tags.yml delete mode 100644 modules/nf-core/bwa/index/tests/tags.yml delete mode 100644 modules/nf-core/bwa/mem/tests/tags.yml delete mode 100644 modules/nf-core/bwamem2/index/tests/tags.yml delete mode 100644 modules/nf-core/bwamem2/mem/tests/tags.yml delete mode 100644 modules/nf-core/cat/cat/tests/tags.yml delete mode 100644 modules/nf-core/cat/fastq/tests/tags.yml delete mode 100644 modules/nf-core/cnvkit/antitarget/tests/tags.yml delete mode 100644 modules/nf-core/cnvkit/batch/tests/tags.yml create mode 100644 modules/nf-core/cnvkit/export/tests/main.nf.test create mode 100644 modules/nf-core/cnvkit/export/tests/main.nf.test.snap create mode 100644 modules/nf-core/cnvkit/export/tests/nextflow.config delete mode 100644 modules/nf-core/cnvkit/reference/tests/tags.yml delete mode 100644 modules/nf-core/controlfreec/assesssignificance/tests/tags.yml delete mode 100644 modules/nf-core/controlfreec/freec/tests/tags.yml delete mode 100644 modules/nf-core/controlfreec/freec2bed/tests/tags.yml delete mode 100644 modules/nf-core/controlfreec/freec2circos/tests/tags.yml delete mode 100644 modules/nf-core/controlfreec/makegraph2/tests/tags.yml delete mode 100644 modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml delete mode 100644 modules/nf-core/dragmap/align/tests/tags.yml delete mode 100644 modules/nf-core/dragmap/hashtable/tests/tags.yml delete mode 100644 modules/nf-core/ensemblvep/download/tests/tags.yml delete mode 100644 modules/nf-core/ensemblvep/vep/tests/tags.yml delete mode 100644 modules/nf-core/fastp/tests/tags.yml delete mode 100644 modules/nf-core/fastqc/tests/tags.yml delete mode 100644 modules/nf-core/fgbio/callmolecularconsensusreads/tests/tags.yml delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/tags.yml delete mode 100644 modules/nf-core/fgbio/groupreadsbyumi/tests/tags.yml delete mode 100644 modules/nf-core/freebayes/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/applybqsr/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/applyvqsr/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/baserecalibrator/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/calculatecontamination/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/cnnscorevariants/README.md create mode 100644 modules/nf-core/gatk4/cnnscorevariants/environment.yml create mode 100644 modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test create mode 100644 modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/createsequencedictionary/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/estimatelibrarycomplexity/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/filtermutectcalls/tests/tags.yml create mode 100644 modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test create mode 100644 modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap create mode 100644 modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/genomicsdbimport/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/getpileupsummaries/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/haplotypecaller/tests/tags.yml create mode 100644 modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test create mode 100644 modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/markduplicates/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/mergemutectstats/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/mergevcfs/tests/tags.yml delete mode 100644 modules/nf-core/gatk4/mutect2/tests/f1r2.config delete mode 100644 modules/nf-core/gatk4/mutect2/tests/mito.config create mode 100644 modules/nf-core/gatk4/mutect2/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/mutect2/tests/pair.config delete mode 100644 modules/nf-core/gatk4/mutect2/tests/tags.yml create mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/AS.config create mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test create mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap create mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config delete mode 100644 modules/nf-core/gatk4spark/applybqsr/tests/tags.yml create mode 100644 modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test create mode 100644 modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap create mode 100644 modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/tags.yml delete mode 100644 modules/nf-core/gawk/tests/nextflow_with_program_file.config delete mode 100644 modules/nf-core/gawk/tests/tags.yml delete mode 100644 modules/nf-core/goleft/indexcov/tests/tags.yml delete mode 100644 modules/nf-core/lofreq/callparallel/tests/tags.yml delete mode 100644 modules/nf-core/manta/germline/tests/tags.yml delete mode 100644 modules/nf-core/manta/somatic/tests/tags.yml delete mode 100644 modules/nf-core/manta/tumoronly/tests/tags.yml delete mode 100644 modules/nf-core/mosdepth/tests/tags.yml delete mode 100644 modules/nf-core/multiqc/tests/tags.yml delete mode 100644 modules/nf-core/ngscheckmate/ncm/tests/tags.yml delete mode 100644 modules/nf-core/samblaster/tests/tags.yml delete mode 100644 modules/nf-core/samtools/bam2fq/tests/tags.yml delete mode 100644 modules/nf-core/samtools/collatefastq/tests/tags.yml delete mode 100644 modules/nf-core/samtools/convert/tests/tags.yml delete mode 100644 modules/nf-core/samtools/faidx/tests/tags.yml delete mode 100644 modules/nf-core/samtools/index/tests/tags.yml delete mode 100644 modules/nf-core/samtools/merge/tests/tags.yml delete mode 100644 modules/nf-core/samtools/mpileup/tests/tags.yml delete mode 100644 modules/nf-core/samtools/stats/tests/tags.yml create mode 100644 modules/nf-core/samtools/view/tests/cram_index.config delete mode 100644 modules/nf-core/samtools/view/tests/tags.yml delete mode 100644 modules/nf-core/sentieon/bwamem/tests/tags.yml delete mode 100644 modules/nf-core/sentieon/haplotyper/tests/tags.yml delete mode 100644 modules/nf-core/snpeff/snpeff/tests/tags.yml delete mode 100644 modules/nf-core/spring/decompress/test/tags.yml rename modules/nf-core/spring/decompress/{test => tests}/main.nf.test (99%) rename modules/nf-core/spring/decompress/{test => tests}/main.nf.test.snap (100%) rename modules/nf-core/spring/decompress/{test => tests}/nextflow.config (100%) delete mode 100644 modules/nf-core/strelka/somatic/tests/tags.yml delete mode 100644 modules/nf-core/svdb/merge/tests/tags.yml delete mode 100644 modules/nf-core/tabix/bgziptabix/tests/tags.yml delete mode 100644 modules/nf-core/tabix/tabix/tests/tags.yml delete mode 100644 modules/nf-core/tiddit/sv/tests/tags.yml delete mode 100644 modules/nf-core/untar/tests/tags.yml delete mode 100644 modules/nf-core/unzip/tests/tags.yml delete mode 100644 modules/nf-core/vcftools/tests/tags.yml create mode 100644 subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test create mode 100644 subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap create mode 100644 subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config diff --git a/modules.json b/modules.json index e81103e13f..0397515873 100644 --- a/modules.json +++ b/modules.json @@ -7,352 +7,350 @@ "nf-core": { "ascat": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "dadef82ff62fc78d06c7b77439a284c697f4c650", "installed_by": ["modules"] }, "bcftools/annotate": { "branch": "master", - "git_sha": "cb08035150685b11d890d90c9534d4f16869eaec", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["modules"], "patch": "modules/nf-core/bcftools/annotate/bcftools-annotate.diff" }, "bcftools/concat": { "branch": "master", - "git_sha": "d1e0ec7670fa77905a378627232566ce54c3c26d", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["modules"] }, "bcftools/mpileup": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["bam_ngscheckmate"] }, "bcftools/sort": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["modules"] }, "bcftools/stats": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["modules"] }, "bwa/index": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "a29f18660f5e3748d44d6f716241e70c942c065d", "installed_by": ["modules"] }, "bwa/mem": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "a29f18660f5e3748d44d6f716241e70c942c065d", "installed_by": ["modules"] }, "bwamem2/index": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "a29f18660f5e3748d44d6f716241e70c942c065d", "installed_by": ["modules"] }, "bwamem2/mem": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "a29f18660f5e3748d44d6f716241e70c942c065d", "installed_by": ["modules"] }, "cat/cat": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "cat/fastq": { "branch": "master", - "git_sha": "a1abf90966a2a4016d3c3e41e228bfcbd4811ccc", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "cnvkit/antitarget": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "cnvkit/batch": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "cnvkit/call": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "cnvkit/export": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "cnvkit/genemetrics": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "cnvkit/reference": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "controlfreec/assesssignificance": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"], "patch": "modules/nf-core/controlfreec/assesssignificance/controlfreec-assesssignificance.diff" }, "controlfreec/freec": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "controlfreec/freec2bed": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "controlfreec/freec2circos": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "controlfreec/makegraph2": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "deepvariant/rundeepvariant": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "dragmap/align": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], - "patch": "modules/nf-core/dragmap/align/dragmap-align.diff" + "git_sha": "8b06d86f6a82b6203f239ad409f606fdf71ec697", + "installed_by": ["modules"] }, "dragmap/hashtable": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], - "patch": "modules/nf-core/dragmap/hashtable/dragmap-hashtable.diff" + "git_sha": "8b06d86f6a82b6203f239ad409f606fdf71ec697", + "installed_by": ["modules"] }, "ensemblvep/download": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "7452092e1a296442f2989bff9801797f28c28aaf", "installed_by": ["modules"] }, "ensemblvep/vep": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "7452092e1a296442f2989bff9801797f28c28aaf", "installed_by": ["modules", "vcf_annotate_ensemblvep"] }, "fastp": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "d082103d7976a2804f21225446cc110cbd822f4c", "installed_by": ["modules"] }, "fastqc": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "b1966f36ec9de31927b2603d8f499960b2a4c294", "installed_by": ["modules"] }, "fgbio/callmolecularconsensusreads": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "fgbio/fastqtobam": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "fgbio/groupreadsbyumi": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "freebayes": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/applybqsr": { "branch": "master", - "git_sha": "6b3bf38285d94cc1ea3cd9fa93310d54b04c3819", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/applyvqsr": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/baserecalibrator": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/calculatecontamination": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/cnnscorevariants": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "1999eff2c530b2b185a25cc42117a1686f09b685", "installed_by": ["modules"] }, "gatk4/createsequencedictionary": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/estimatelibrarycomplexity": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/filtermutectcalls": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/filtervarianttranches": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "gatk4/gatherbqsrreports": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "gatk4/gatherpileupsummaries": { "branch": "master", - "git_sha": "679f45cae4f603f12d7c38c042afee11150574a0", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "gatk4/genomicsdbimport": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/genotypegvcfs": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "gatk4/getpileupsummaries": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/haplotypecaller": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/intervallisttobed": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"], "patch": "modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff" }, "gatk4/learnreadorientationmodel": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "gatk4/markduplicates": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/mergemutectstats": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/mergevcfs": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "gatk4/mutect2": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "a97cba262e9367734e435dc07d2e3b7d6121ef3e", "installed_by": ["modules"] }, "gatk4/variantrecalibrator": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "gatk4spark/applybqsr": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "fa55ebb81654fe1736975fa28d1af5a079bf6a08", "installed_by": ["modules"] }, "gatk4spark/baserecalibrator": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "fa55ebb81654fe1736975fa28d1af5a079bf6a08", "installed_by": ["modules"] }, "gatk4spark/markduplicates": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "fa55ebb81654fe1736975fa28d1af5a079bf6a08", "installed_by": ["modules"] }, "gawk": { "branch": "master", - "git_sha": "97321eded31a12598837a476d3615300af413bb7", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "goleft/indexcov": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "lofreq/callparallel": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "manta/germline": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "manta/somatic": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "manta/tumoronly": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "mosdepth": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "msisensorpro/msisomatic": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "msisensorpro/scan": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", + "git_sha": "7b50cb7be890e4b28cffb82e438cc6a8d7805d3f", "installed_by": ["modules"] }, "muse/call": { @@ -367,97 +365,97 @@ }, "ngscheckmate/ncm": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["bam_ngscheckmate"] }, "samblaster": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/bam2fq": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/collatefastq": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/convert": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/faidx": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/index": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/merge": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/mpileup": { "branch": "master", - "git_sha": "13e7d1046922381df90cd8fe9bee8c3e57ae8457", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/stats": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "samtools/view": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "sentieon/applyvarcal": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "sentieon/bwamem": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "sentieon/dedup": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "sentieon/dnamodelapply": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "sentieon/dnascope": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "sentieon/gvcftyper": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "sentieon/haplotyper": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "sentieon/varcal": { "branch": "master", - "git_sha": "eb7b70119bfb1877334c996d13e520c61b21067d", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "snpeff/download": { @@ -467,57 +465,57 @@ }, "snpeff/snpeff": { "branch": "master", - "git_sha": "22f895866a1ad01556db175f9c0925ca90615d10", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules", "vcf_annotate_snpeff"] }, "spring/decompress": { "branch": "master", - "git_sha": "d7462e71f9129083ce10c3fe953ed401781e0ebd", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "strelka/germline": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", "installed_by": ["modules"] }, "strelka/somatic": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "svdb/merge": { "branch": "master", - "git_sha": "eb2c3f7ee2c938ab1a49764bdb1319adaa35492c", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "tabix/bgziptabix": { "branch": "master", - "git_sha": "f448e846bdadd80fc8be31fbbc78d9f5b5131a45", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules", "vcf_annotate_snpeff"] }, "tabix/tabix": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules", "vcf_annotate_ensemblvep"] }, "tiddit/sv": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "untar": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "unzip": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] }, "vcftools": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", "installed_by": ["modules"] } } @@ -526,7 +524,7 @@ "nf-core": { "bam_ngscheckmate": { "branch": "master", - "git_sha": "c60c14b285b89bdd0607e371417dadb80385ad6e", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["subworkflows"] }, "utils_nextflow_pipeline": { diff --git a/modules/nf-core/ascat/environment.yml b/modules/nf-core/ascat/environment.yml index 63d87708d6..f4bf979ff4 100644 --- a/modules/nf-core/ascat/environment.yml +++ b/modules/nf-core/ascat/environment.yml @@ -1,6 +1,13 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::ascat=3.1.1 - - bioconda::cancerit-allelecount=4.3.0 + - bioconda::ascat=3.1.1=r42hdfd78af_0 + - bioconda::cancerit-allelecount=4.3.0=heecbde5_4 + - bioconda::htslib=1.17 + - conda-forge::r-base=4.2.2 + - bioconda::bioconductor-biocgenerics=0.44.0 + - r-r.devices=2.17.1 + - conda-forge::cairo=1.16.0=ha61ee94_1014 diff --git a/modules/nf-core/ascat/main.nf b/modules/nf-core/ascat/main.nf index 8aeb9847b5..433f5655b3 100644 --- a/modules/nf-core/ascat/main.nf +++ b/modules/nf-core/ascat/main.nf @@ -40,14 +40,14 @@ process ASCAT { def gc_input = gc_file ? "$gc_file" : "NULL" def rt_input = rt_file ? "$rt_file" : "NULL" - def minCounts_arg = args.minCounts ? ",minCounts = $args.minCounts" : "" - def bed_file_arg = bed_file ? ",BED_file = '$bed_file'": "" - def chrom_names_arg = args.chrom_names ? ",chrom_names = $args.chrom_names" : "" - def min_base_qual_arg = args.min_base_qual ? ",min_base_qual = $args.min_base_qual" : "" - def min_map_qual_arg = args.min_map_qual ? ",min_map_qual = $args.min_map_qual" : "" - def fasta_arg = fasta ? ",ref.fasta = '$fasta'" : "" - def skip_allele_counting_tumour_arg = args.skip_allele_counting_tumour ? ",skip_allele_counting_tumour = $args.skip_allele_counting_tumour" : "" - def skip_allele_counting_normal_arg = args.skip_allele_counting_normal ? ",skip_allele_counting_normal = $args.skip_allele_counting_normal" : "" + def minCounts_arg = args.minCounts ? ", minCounts = $args.minCounts" : "" + def bed_file_arg = bed_file ? ", BED_file = '$bed_file'": "" + def chrom_names_arg = args.chrom_names ? ", chrom_names = $args.chrom_names" : "" + def min_base_qual_arg = args.min_base_qual ? ", min_base_qual = $args.min_base_qual" : "" + def min_map_qual_arg = args.min_map_qual ? ", min_map_qual = $args.min_map_qual" : "" + def fasta_arg = fasta ? ", ref.fasta = '$fasta'" : "" + def skip_allele_counting_tumour_arg = args.skip_allele_counting_tumour ? ", skip_allele_counting_tumour = $args.skip_allele_counting_tumour" : "" + def skip_allele_counting_normal_arg = args.skip_allele_counting_normal ? ", skip_allele_counting_normal = $args.skip_allele_counting_normal" : "" """ #!/usr/bin/env Rscript @@ -55,14 +55,14 @@ process ASCAT { library(ASCAT) options(bitmapType='cairo') - #build prefixes: - allele_path = normalizePath("$allele_files") - allele_prefix = paste0(allele_path, "/", "$allele_files", "_chr") + # Build prefixes: + allele_path = basename(normalizePath("$allele_files")) + allele_prefix = sub('_chr[0-9]+\\\\.txt\$', "_chr", allele_path) - loci_path = normalizePath("$loci_files") - loci_prefix = paste0(loci_path, "/", "$loci_files", "_chr") + loci_path = basename(normalizePath("$loci_files")) + loci_prefix = sub('_chr[0-9]+\\\\.txt\$', "_chr", loci_path) - #prepare from BAM files + # Prepare from BAM files ascat.prepareHTS( tumourseqfile = "$input_tumor", normalseqfile = "$input_normal", @@ -81,12 +81,12 @@ process ASCAT { $min_map_qual_arg $fasta_arg $skip_allele_counting_tumour_arg - $skip_allele_counting_normal_arg, - seed = 42 + $skip_allele_counting_normal_arg + , seed = 42 ) - #Load the data + # Load the data ascat.bc = ascat.loadData( Tumor_LogR_file = paste0("$prefix", ".tumour_tumourLogR.txt"), Tumor_BAF_file = paste0("$prefix", ".tumour_tumourBAF.txt"), @@ -96,34 +96,35 @@ process ASCAT { gender = "$gender" ) - #Plot the raw data + # Plot the raw data ascat.plotRawData(ascat.bc, img.prefix = paste0("$prefix", ".before_correction.")) - # optional LogRCorrection + # Optional LogRCorrection if("$gc_input" != "NULL") { - gc_input = paste0(normalizePath("$gc_input"), "/", "$gc_input", ".txt") + gc_input = normalizePath("$gc_input") if("$rt_input" != "NULL"){ - rt_input = paste0(normalizePath("$rt_input"), "/", "$rt_input", ".txt") + rt_input = normalizePath("$rt_input") ascat.bc = ascat.correctLogR(ascat.bc, GCcontentfile = gc_input, replictimingfile = rt_input) - #Plot raw data after correction + # Plot raw data after correction ascat.plotRawData(ascat.bc, img.prefix = paste0("$prefix", ".after_correction_gc_rt.")) } else { ascat.bc = ascat.correctLogR(ascat.bc, GCcontentfile = gc_input, replictimingfile = $rt_input) - #Plot raw data after correction + # Plot raw data after correction ascat.plotRawData(ascat.bc, img.prefix = paste0("$prefix", ".after_correction_gc.")) } } - #Segment the data + # Segment the data ascat.bc = ascat.aspcf(ascat.bc, seed=42) - #Plot the segmented data + # Plot the segmented data ascat.plotSegmentedData(ascat.bc) - #Run ASCAT to fit every tumor to a model, inferring ploidy, normal cell contamination, and discrete copy numbers - #If psi and rho are manually set: + # Run ASCAT to fit every tumor to a model, inferring ploidy, normal cell contamination, + # and discrete copy numbers + # If psi and rho are manually set: if (!is.null($purity) && !is.null($ploidy)){ ascat.output <- ascat.runAscat(ascat.bc, gamma=1, rho_manual=$purity, psi_manual=$ploidy) } else if(!is.null($purity) && is.null($ploidy)){ @@ -134,17 +135,17 @@ process ASCAT { ascat.output <- ascat.runAscat(ascat.bc, gamma=1) } - #Extract metrics from ASCAT profiles + # Extract metrics from ASCAT profiles QC = ascat.metrics(ascat.bc,ascat.output) - #Write out segmented regions (including regions with one copy of each allele) + # Write out segmented regions (including regions with one copy of each allele) write.table(ascat.output[["segments"]], file=paste0("$prefix", ".segments.txt"), sep="\t", quote=F, row.names=F) - #Write out CNVs in bed format + # Write out CNVs in bed format cnvs=ascat.output[["segments"]][2:6] write.table(cnvs, file=paste0("$prefix",".cnvs.txt"), sep="\t", quote=F, row.names=F, col.names=T) - #Write out purity and ploidy info + # Write out purity and ploidy info summary <- tryCatch({ matrix(c(ascat.output[["aberrantcellfraction"]], ascat.output[["ploidy"]]), ncol=2, byrow=TRUE)}, error = function(err) { # error handler picks up where error was generated @@ -157,43 +158,43 @@ process ASCAT { write.table(QC, file=paste0("$prefix", ".metrics.txt"), sep="\t", quote=F, row.names=F) - # version export + # Version export f <- file("versions.yml","w") alleleCounter_version = system(paste("alleleCounter --version"), intern = T) - ascat_version = sessionInfo()\$otherPkgs\$ASCAT\$Version + ascat_version = as.character(packageVersion('ASCAT')) writeLines(paste0('"', "$task.process", '"', ":"), f) - writeLines(paste(" alleleCounter:", alleleCounter_version), f) writeLines(paste(" ascat:", ascat_version), f) + writeLines(paste(" alleleCounter:", alleleCounter_version), f) close(f) - """ stub: def prefix = task.ext.prefix ?: "${meta.id}" """ - echo stub > ${prefix}.after_correction.gc_rt.test.tumour.germline.png - echo stub > ${prefix}.after_correction.gc_rt.test.tumour.tumour.png - echo stub > ${prefix}.before_correction.test.tumour.germline.png - echo stub > ${prefix}.before_correction.test.tumour.tumour.png - echo stub > ${prefix}.cnvs.txt - echo stub > ${prefix}.metrics.txt - echo stub > ${prefix}.normal_alleleFrequencies_chr21.txt - echo stub > ${prefix}.normal_alleleFrequencies_chr22.txt - echo stub > ${prefix}.purityploidy.txt - echo stub > ${prefix}.segments.txt - echo stub > ${prefix}.tumour.ASPCF.png - echo stub > ${prefix}.tumour.sunrise.png - echo stub > ${prefix}.tumour_alleleFrequencies_chr21.txt - echo stub > ${prefix}.tumour_alleleFrequencies_chr22.txt - echo stub > ${prefix}.tumour_normalBAF.txt - echo stub > ${prefix}.tumour_normalLogR.txt - echo stub > ${prefix}.tumour_tumourBAF.txt - echo stub > ${prefix}.tumour_tumourLogR.txt - - echo "${task.process}:" > versions.yml - echo ' alleleCounter: 4.3.0' >> versions.yml - echo ' ascat: 3.0.0' >> versions.yml - + touch ${prefix}.after_correction.gc_rt.test.tumour.germline.png + touch ${prefix}.after_correction.gc_rt.test.tumour.tumour.png + touch ${prefix}.before_correction.test.tumour.germline.png + touch ${prefix}.before_correction.test.tumour.tumour.png + touch ${prefix}.cnvs.txt + touch ${prefix}.metrics.txt + touch ${prefix}.normal_alleleFrequencies_chr21.txt + touch ${prefix}.normal_alleleFrequencies_chr22.txt + touch ${prefix}.purityploidy.txt + touch ${prefix}.segments.txt + touch ${prefix}.tumour.ASPCF.png + touch ${prefix}.tumour.sunrise.png + touch ${prefix}.tumour_alleleFrequencies_chr21.txt + touch ${prefix}.tumour_alleleFrequencies_chr22.txt + touch ${prefix}.tumour_normalBAF.txt + touch ${prefix}.tumour_normalLogR.txt + touch ${prefix}.tumour_tumourBAF.txt + touch ${prefix}.tumour_tumourLogR.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bioconductor-ascat: \$(Rscript -e "library(ASCAT); cat(as.character(packageVersion('ASCAT')))") + alleleCounter: \$(alleleCounter --version) + END_VERSIONS """ diff --git a/modules/nf-core/ascat/tests/main.nf.test b/modules/nf-core/ascat/tests/main.nf.test new file mode 100644 index 0000000000..bba4608623 --- /dev/null +++ b/modules/nf-core/ascat/tests/main.nf.test @@ -0,0 +1,131 @@ +nextflow_process { + + name "Test Process ASCAT" + script "../main.nf" + process "ASCAT" + + tag "modules" + tag "modules_nfcore" + tag "ascat" + + test("human - bam - GC") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = [ + [ id: 'test', single_end:false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.markduplicates.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.markduplicates.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.markduplicates.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.markduplicates.sorted.bam.bai', checkIfExists: true) + ] + input[1] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_alleles_hg38_chr21.txt', checkIfExists: true)] + input[2] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_loci_hg38_chr21.txt', checkIfExists: true)] + input[3] = [] + input[4] = [] + input[5] = [] + input[6] = [] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.allelefreqs, + process.out.bafs, + process.out.cnvs, + // Logrs Tumour has a float margin discrepancy in conda due to + // log and mean transformation + process.out.logrs.collect{it[1].collect{file(it).name}}, + process.out.metrics, + // This discrepancy affect the png generated + process.out.png.collect{it[1].collect{file(it).name}}, + process.out.purityploidy, + process.out.segments, + process.out.versions + ).match() } + ) + } + } + + test("human - cram - GC - RT") { + config "./nextflow.config" + + when { + process { + """ + input[0] = [ + [ id: 'test', single_end:false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.markduplicates.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.markduplicates.sorted.cram.crai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.markduplicates.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.markduplicates.sorted.cram.crai', checkIfExists: true) + ] + input[1] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_alleles_hg38_chr21.txt', checkIfExists: true)] + input[2] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_loci_hg38_chr21.txt', checkIfExists: true)] + input[3] = [] + input[4] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)] + input[5] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/GC_G1000_hg38_21.txt', checkIfExists: true)] + input[6] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/RT_G1000_hg38_21.txt', checkIfExists: true)] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.allelefreqs, + process.out.bafs, + process.out.cnvs, + // Logrs Tumour has a float margin discrepancy in conda due to + // log and mean transformation + process.out.logrs.collect{it[1].collect{file(it).name}}, + process.out.metrics, + // This discrepancy affect the png generated + process.out.png.collect{it[1].collect{file(it).name}}, + process.out.purityploidy, + process.out.segments, + process.out.versions + ).match() } + ) + } + } + + test("human - bam - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id: 'test', single_end:false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam.bai', checkIfExists: true) + ] + input[1] = [] + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + input[6] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/ascat/tests/main.nf.test.snap b/modules/nf-core/ascat/tests/main.nf.test.snap new file mode 100644 index 0000000000..3f9406d8e5 --- /dev/null +++ b/modules/nf-core/ascat/tests/main.nf.test.snap @@ -0,0 +1,373 @@ +{ + "human - bam - GC": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.normal_alleleFrequencies_chr21.txt:md5,627382ea8ab013d2fb3307a4f9abb058", + "test.tumour_alleleFrequencies_chr21.txt:md5,79000d7e2f57c3492204a19649d327b1" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.tumour_normalBAF.txt:md5,bee93180f7346edc1ead76f2ac150290", + "test.tumour_tumourBAF.txt:md5,33bab5381edd65675458e72a492c4ef1" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.cnvs.txt:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + [ + [ + "test.tumour_normalLogR.txt", + "test.tumour_tumourLogR.txt" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.metrics.txt:md5,6e473be3fb2226d493e48a73df2f4501" + ] + ], + [ + [ + "test.before_correction.test.tumour.germline.png", + "test.before_correction.test.tumour.tumour.png", + "test.tumour.ASPCF.png", + "test.tumour.sunrise.png" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.purityploidy.txt:md5,f1484c2b120834d3db8774ad02a038b9" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.segments.txt:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + [ + "versions.yml:md5,686336a6e5781e5e76ce026a4d868593" + ] + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.4" + }, + "timestamp": "2025-03-05T18:38:00.684889439" + }, + "human - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.normal_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.normal_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.tumour_normalBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_tumourBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cnvs.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.tumour_normalLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_tumourLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.after_correction.gc_rt.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.after_correction.gc_rt.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.before_correction.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.before_correction.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour.ASPCF.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour.sunrise.png:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.purityploidy.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.segments.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + "versions.yml:md5,77b5e99ea58d2555e05b761bac9fc0cb" + ], + "allelefreqs": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.normal_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.normal_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bafs": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.tumour_normalBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_tumourBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "cnvs": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cnvs.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "logrs": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.tumour_normalLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour_tumourLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "png": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.after_correction.gc_rt.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.after_correction.gc_rt.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.before_correction.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.before_correction.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour.ASPCF.png:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tumour.sunrise.png:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "purityploidy": [ + [ + { + "id": "test", + "single_end": false + }, + "test.purityploidy.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "segments": [ + [ + { + "id": "test", + "single_end": false + }, + "test.segments.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,77b5e99ea58d2555e05b761bac9fc0cb" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.4" + }, + "timestamp": "2025-03-05T18:15:58.006828602" + }, + "human - cram - GC - RT": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.normal_alleleFrequencies_chr21.txt:md5,627382ea8ab013d2fb3307a4f9abb058", + "test.tumour_alleleFrequencies_chr21.txt:md5,79000d7e2f57c3492204a19649d327b1" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.tumour_normalBAF.txt:md5,bee93180f7346edc1ead76f2ac150290", + "test.tumour_tumourBAF.txt:md5,33bab5381edd65675458e72a492c4ef1" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.cnvs.txt:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + [ + [ + "test.tumour_normalLogR.txt", + "test.tumour_tumourLogR.txt" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.metrics.txt:md5,3502b78584e5251db0fcbd71ed134480" + ] + ], + [ + [ + "test.after_correction_gc_rt.test.tumour.germline.png", + "test.after_correction_gc_rt.test.tumour.tumour.png", + "test.before_correction.test.tumour.germline.png", + "test.before_correction.test.tumour.tumour.png", + "test.tumour.ASPCF.png", + "test.tumour.sunrise.png" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.purityploidy.txt:md5,f1484c2b120834d3db8774ad02a038b9" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.segments.txt:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + [ + "versions.yml:md5,686336a6e5781e5e76ce026a4d868593" + ] + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.4" + }, + "timestamp": "2025-03-05T22:15:35.851834147" + } +} \ No newline at end of file diff --git a/modules/nf-core/ascat/tests/nextflow.config b/modules/nf-core/ascat/tests/nextflow.config new file mode 100644 index 0000000000..3ce7124280 --- /dev/null +++ b/modules/nf-core/ascat/tests/nextflow.config @@ -0,0 +1,12 @@ +process { + withName: ASCAT { + ext.args = [ + gender : 'XY', + genomeVersion : 'hg19', + minCounts : '1', + min_base_qual : '1', + min_map_qual : '1', + chrom_names : 'c("21")' + ] + } +} diff --git a/modules/nf-core/bcftools/annotate/environment.yml b/modules/nf-core/bcftools/annotate/environment.yml index 5c00b116ad..557488607c 100644 --- a/modules/nf-core/bcftools/annotate/environment.yml +++ b/modules/nf-core/bcftools/annotate/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::bcftools=1.20 + - bioconda::bcftools=1.21 diff --git a/modules/nf-core/bcftools/annotate/main.nf b/modules/nf-core/bcftools/annotate/main.nf index 1b3a371ecf..8ab067d80b 100644 --- a/modules/nf-core/bcftools/annotate/main.nf +++ b/modules/nf-core/bcftools/annotate/main.nf @@ -4,14 +4,13 @@ process BCFTOOLS_ANNOTATE { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.20--h8b25389_0': - 'biocontainers/bcftools:1.20--h8b25389_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/5a/5acacb55c52bec97c61fd34ffa8721fce82ce823005793592e2a80bf71632cd0/data': + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: - tuple val(meta), path(input), path(index) - path annotations - path annotations_index - path header_lines + tuple val(meta), path(input), path(index), path(annotations), path(annotations_index) + path(header_lines) + path(rename_chrs) output: tuple val(meta), path("*.{vcf,vcf.gz,bcf,bcf.gz}"), emit: vcf @@ -27,6 +26,7 @@ process BCFTOOLS_ANNOTATE { def prefix = task.ext.prefix ?: "${meta.id}" def header_file = header_lines ? "--header-lines ${header_lines}" : '' def annotations_file = annotations ? "--annotations ${annotations}" : '' + def rename_chrs_file = rename_chrs ? "--rename-chrs ${rename_chrs}" : '' def extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" : args.contains("--output-type u") || args.contains("-Ou") ? "bcf" : args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : @@ -42,6 +42,7 @@ process BCFTOOLS_ANNOTATE { annotate \\ $args \\ $annotations_file \\ + $rename_chrs_file \\ $header_file \\ --output ${prefix}.${extension} \\ --threads $task.cpus \\ diff --git a/modules/nf-core/bcftools/annotate/meta.yml b/modules/nf-core/bcftools/annotate/meta.yml index 5bfccd2bd8..fd2c91c706 100644 --- a/modules/nf-core/bcftools/annotate/meta.yml +++ b/modules/nf-core/bcftools/annotate/meta.yml @@ -35,6 +35,9 @@ input: - - header_lines: type: file description: Contains lines to append to the output VCF header + - - rename_chrs: + type: file + description: Rename annotations according to this file containing "old_name new_name\n" pairs separated by whitespaces, each on a separate line. output: - vcf: - meta: diff --git a/modules/nf-core/bcftools/annotate/tests/main.nf.test b/modules/nf-core/bcftools/annotate/tests/main.nf.test index 3a5c493314..fd6d2cd37f 100644 --- a/modules/nf-core/bcftools/annotate/tests/main.nf.test +++ b/modules/nf-core/bcftools/annotate/tests/main.nf.test @@ -9,7 +9,7 @@ nextflow_process { tag "bcftools" tag "bcftools/annotate" - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_output") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_output") { config "./vcf.config" @@ -24,6 +24,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -40,7 +41,7 @@ nextflow_process { } - test("sarscov2 - [vcf, [], annotation, annotation_tbi], [] - vcf_output") { + test("sarscov2 - [vcf, [], annotation, annotation_tbi], [], [] - vcf_output") { config "./vcf.config" @@ -55,6 +56,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -70,7 +72,7 @@ nextflow_process { } } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index") { config "./vcf_gz_index.config" @@ -85,6 +87,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -104,7 +107,7 @@ nextflow_process { } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_csi") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi") { config "./vcf_gz_index_csi.config" @@ -119,6 +122,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -138,7 +142,7 @@ nextflow_process { } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_tbi") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi") { config "./vcf_gz_index_tbi.config" @@ -153,6 +157,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -171,7 +176,8 @@ nextflow_process { } } - test("sarscov2 - [vcf, [], annotation, annotation_tbi], header - bcf_output") { + + test("sarscov2 - [vcf, [], annotation, annotation_tbi], header, [] - bcf_output") { config "./bcf.config" @@ -189,6 +195,7 @@ nextflow_process { '##INFO=', '##INFO=' ).collectFile(name:"headers.vcf", newLine:true) + input[2] = [] """ } } @@ -205,7 +212,43 @@ nextflow_process { } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - stub") { + test("sarscov2 - [vcf, [], annotation, annotation_tbi], header, rename_chrs - vcf_gz_index") { + + config "./vcf_gz_index.config" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) + ] + input[1] = Channel.of( + '##INFO=', + '##INFO=' + ).collectFile(name:"headers.vcf", newLine:true) + input[2] = Channel.of('MT192765.1 renamed').collectFile(name:"rename.txt", newLine:true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.vcf.get(0).get(1)).LinesGzip.contains("##contig=")}, + { assert snapshot( + process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name }}, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - stub") { config "./vcf.config" options "-stub" @@ -221,6 +264,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -234,7 +278,7 @@ nextflow_process { } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index - stub") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index - stub") { config "./vcf_gz_index.config" options "-stub" @@ -250,6 +294,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -264,7 +309,7 @@ nextflow_process { } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_csi - stub") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi - stub") { config "./vcf_gz_index_csi.config" options "-stub" @@ -280,6 +325,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } @@ -294,7 +340,7 @@ nextflow_process { } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_tbi - stub") { + test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi - stub") { config "./vcf_gz_index_tbi.config" options "-stub" @@ -310,6 +356,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) ] input[1] = [] + input[2] = [] """ } } diff --git a/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap b/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap index bac2224a3b..63e0d9d5a4 100644 --- a/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap +++ b/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "bcf": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi": { "content": [ [ [ @@ -7,20 +7,79 @@ "id": "test", "single_end": false }, - "test_ann.bcf" + "test_vcf.vcf.gz" ] ], [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz.tbi" + ] + ], + [ + + ], + [ + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-12T16:39:33.331888" + "timestamp": "2025-04-01T12:55:30.265471036" }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" + ], + "csi": [ + + ], + "tbi": [ + + ], + "vcf": [ + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T12:55:48.340271359" + }, + "bcf": { "content": [ [ [ @@ -28,32 +87,41 @@ "id": "test", "single_end": false }, - "test_vcf.vcf.gz" + "test_ann.bcf" ] ], [ - - ], + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T12:55:37.270860052" + }, + "sarscov2 - [vcf, [], annotation, annotation_tbi], [], [] - vcf_output": { + "content": [ [ [ { "id": "test", "single_end": false }, - "test_vcf.vcf.gz.csi" + "test_vcf.vcf.gz" ] ], [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:07:59.658031137" + "timestamp": "2025-04-01T12:55:12.451788461" }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_csi - stub": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index - stub": { "content": [ { "0": [ @@ -78,7 +146,7 @@ ] ], "3": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ], "csi": [ [ @@ -102,50 +170,17 @@ ] ], "versions": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:09:05.096883418" + "timestamp": "2025-04-01T12:55:52.305248991" }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_csi": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi" - ] - ], - [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-08-15T10:08:10.581301219" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - stub": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi - stub": { "content": [ { "0": [ @@ -161,13 +196,25 @@ ], "2": [ - + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ], "3": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ], "csi": [ - + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ], "tbi": [ @@ -182,17 +229,17 @@ ] ], "versions": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:08:43.975017625" + "timestamp": "2025-04-01T12:55:59.210314307" }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_tbi": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index": { "content": [ [ [ @@ -202,6 +249,9 @@ }, "test_vcf.vcf.gz" ] + ], + [ + ], [ [ @@ -209,23 +259,41 @@ "id": "test", "single_end": false }, - "test_vcf.vcf.gz.tbi" + "test_vcf.vcf.gz.csi" ] ], [ - + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T12:55:19.532491092" + }, + "sarscov2 - [vcf, [], annotation, annotation_tbi], header, rename_chrs - vcf_gz_index": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz" + ] ], [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:08:21.354059092" + "timestamp": "2025-04-01T12:55:44.331095545" }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_output": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_output": { "content": [ [ [ @@ -237,16 +305,16 @@ ] ], [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:07:37.788393317" + "timestamp": "2025-04-01T12:55:08.604415962" }, - "sarscov2 - [vcf, [], annotation, annotation_tbi], [] - vcf_output": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi": { "content": [ [ [ @@ -258,16 +326,28 @@ ] ], [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test_vcf.vcf.gz.csi" + ] + ], + [ + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:07:48.500746325" + "timestamp": "2025-04-01T12:55:23.309288135" }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index_tbi - stub": { + "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi - stub": { "content": [ { "0": [ @@ -292,7 +372,7 @@ ], "3": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ], "csi": [ @@ -316,73 +396,14 @@ ] ], "versions": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-08-15T10:09:16.094918834" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [] - vcf_gz_index - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" - ], - "csi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ea53f98610d42597cf384ff1fa3eb204" + "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-15T10:08:54.366358502" + "timestamp": "2025-04-01T12:56:06.054536287" } } \ No newline at end of file diff --git a/modules/nf-core/bcftools/annotate/tests/tags.yml b/modules/nf-core/bcftools/annotate/tests/tags.yml deleted file mode 100644 index f97a1afc85..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bcftools/annotate: - - "modules/nf-core/bcftools/annotate/**" diff --git a/modules/nf-core/bcftools/concat/environment.yml b/modules/nf-core/bcftools/concat/environment.yml index 5c00b116ad..557488607c 100644 --- a/modules/nf-core/bcftools/concat/environment.yml +++ b/modules/nf-core/bcftools/concat/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::bcftools=1.20 + - bioconda::bcftools=1.21 diff --git a/modules/nf-core/bcftools/concat/main.nf b/modules/nf-core/bcftools/concat/main.nf index a94b28d86d..fc756e11d8 100644 --- a/modules/nf-core/bcftools/concat/main.nf +++ b/modules/nf-core/bcftools/concat/main.nf @@ -4,17 +4,17 @@ process BCFTOOLS_CONCAT { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.20--h8b25389_0': - 'biocontainers/bcftools:1.20--h8b25389_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/5a/5acacb55c52bec97c61fd34ffa8721fce82ce823005793592e2a80bf71632cd0/data': + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: tuple val(meta), path(vcfs), path(tbi) output: - tuple val(meta), path("${prefix}.vcf.gz") , emit: vcf - tuple val(meta), path("${prefix}.vcf.gz.tbi"), emit: tbi, optional: true - tuple val(meta), path("${prefix}.vcf.gz.csi"), emit: csi, optional: true - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}.${extension}") , emit: vcf + tuple val(meta), path("${prefix}.${extension}.tbi"), emit: tbi, optional: true + tuple val(meta), path("${prefix}.${extension}.csi"), emit: csi, optional: true + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -23,12 +23,17 @@ process BCFTOOLS_CONCAT { def args = task.ext.args ?: '' prefix = task.ext.prefix ?: "${meta.id}" def tbi_names = tbi.findAll { file -> !(file instanceof List) }.collect { file -> file.name } - def create_input_index = vcfs.collect { vcf -> tbi_names.contains(vcf.name + ".tbi") ? "" : "tabix ${vcf}" }.join("\n ") + def create_input_index = vcfs.collect { vcf -> tbi_names.contains(vcf.name + ".tbi") || tbi_names.contains(vcf.name + ".csi") ? "" : "tabix ${vcf}" }.join("\n ") + extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" : + args.contains("--output-type u") || args.contains("-Ou") ? "bcf" : + args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : + args.contains("--output-type v") || args.contains("-Ov") ? "vcf" : + "vcf" """ ${create_input_index} bcftools concat \\ - --output ${prefix}.vcf.gz \\ + --output ${prefix}.${extension} \\ $args \\ --threads $task.cpus \\ ${vcfs} @@ -42,13 +47,20 @@ process BCFTOOLS_CONCAT { stub: def args = task.ext.args ?: '' prefix = task.ext.prefix ?: "${meta.id}" - def index = args.contains("--write-index=tbi") || args.contains("-W=tbi") ? "tbi" : - args.contains("--write-index=csi") || args.contains("-W=csi") ? "csi" : - args.contains("--write-index") || args.contains("-W") ? "csi" : - "" - def create_index = index.matches("csi|tbi") ? "touch ${prefix}.vcf.gz.${index}" : "" + extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" : + args.contains("--output-type u") || args.contains("-Ou") ? "bcf" : + args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : + args.contains("--output-type v") || args.contains("-Ov") ? "vcf" : + "vcf" + def index_extension = args.contains("--write-index=tbi") || args.contains("-W=tbi") ? "tbi" : + args.contains("--write-index=csi") || args.contains("-W=csi") ? "csi" : + args.contains("--write-index") || args.contains("-W") ? "csi" : + "" + def create_cmd = extension.endsWith(".gz") ? "echo '' | gzip >" : "touch" + def create_index = extension.endsWith(".gz") && index_extension.matches("csi|tbi") ? "touch ${prefix}.${extension}.${index_extension}" : "" + """ - echo "" | gzip > ${prefix}.vcf.gz + ${create_cmd} ${prefix}.${extension} ${create_index} cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/bcftools/concat/meta.yml b/modules/nf-core/bcftools/concat/meta.yml index d2565b289f..3d12673a29 100644 --- a/modules/nf-core/bcftools/concat/meta.yml +++ b/modules/nf-core/bcftools/concat/meta.yml @@ -37,21 +37,19 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - pattern: "*.{vcf.gz}" - - ${prefix}.vcf.gz: + - ${prefix}.${extension}: type: map description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - pattern: "*.{vcf.gz}" + pattern: "*.{vcf,vcf.gz,bcf,bcf.gz}" - tbi: - meta: type: map description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - pattern: "*.tbi" - - ${prefix}.vcf.gz.tbi: + - ${prefix}.${extension}.tbi: type: map description: | Groovy Map containing sample information @@ -63,8 +61,7 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - pattern: "*.csi" - - ${prefix}.vcf.gz.csi: + - ${prefix}.${extension}.csi: type: map description: | Groovy Map containing sample information diff --git a/modules/nf-core/bcftools/concat/tests/main.nf.test.snap b/modules/nf-core/bcftools/concat/tests/main.nf.test.snap index 09e87cd3e5..fc3630e1d1 100644 --- a/modules/nf-core/bcftools/concat/tests/main.nf.test.snap +++ b/modules/nf-core/bcftools/concat/tests/main.nf.test.snap @@ -1,5 +1,36 @@ { - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index - stub": { + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi": { + "content": [ + [ + [ + { + "id": "test3" + }, + "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" + ] + ], + [ + [ + { + "id": "test3" + }, + "test3_vcf.vcf.gz.csi" + ] + ], + [ + + ], + [ + "versions.yml:md5,6640b543bdeba692970e302474aaee22" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T13:07:59.602632725" + }, + "homo_sapiens - [[vcf1, vcf2], []]": { "content": [ { "0": [ @@ -7,30 +38,20 @@ { "id": "test3" }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" ] ], "1": [ ], "2": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] + ], "3": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ], "csi": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] + ], "tbi": [ @@ -40,21 +61,21 @@ { "id": "test3" }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" ] ], "versions": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:04:11.178539482" + "timestamp": "2025-04-01T13:08:10.612937747" }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]]": { + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - stub": { "content": [ { "0": [ @@ -62,7 +83,7 @@ { "id": "test3" }, - "test3.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" + "test3.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "1": [ @@ -72,7 +93,7 @@ ], "3": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ], "csi": [ @@ -85,52 +106,21 @@ { "id": "test3" }, - "test3.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" + "test3.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "versions": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-26T11:03:08.765639958" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index": { - "content": [ - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi" - ] - ], - [ - - ], - [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:03:21.607274757" + "timestamp": "2025-04-01T13:08:14.560167356" }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi - stub": { + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index - stub": { "content": [ { "0": [ @@ -142,29 +132,29 @@ ] ], "1": [ + + ], + "2": [ [ { "id": "test3" }, - "test3_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ], - "2": [ - ], "3": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ], "csi": [ - - ], - "tbi": [ [ { "id": "test3" }, - "test3_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" ] + ], + "tbi": [ + ], "vcf": [ [ @@ -175,17 +165,17 @@ ] ], "versions": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:04:27.332133878" + "timestamp": "2025-04-01T13:08:21.582631265" }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi": { + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi": { "content": [ [ [ @@ -194,29 +184,29 @@ }, "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" ] + ], + [ + ], [ [ { "id": "test3" }, - "test3_vcf.vcf.gz.csi" + "test3_vcf.vcf.gz.tbi" ] ], [ - - ], - [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:03:36.575719606" + "timestamp": "2025-04-01T13:08:06.771571575" }, - "homo_sapiens - [[vcf1, vcf2], []]": { + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]]": { "content": [ { "0": [ @@ -224,7 +214,7 @@ { "id": "test3" }, - "test3.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" + "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" ] ], "1": [ @@ -234,7 +224,7 @@ ], "3": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ], "csi": [ @@ -247,21 +237,52 @@ { "id": "test3" }, - "test3.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" + "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" ] ], "versions": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:03:54.069826178" + "timestamp": "2025-04-01T13:07:47.748357665" }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - stub": { + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index": { + "content": [ + [ + [ + { + "id": "test3" + }, + "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" + ] + ], + [ + [ + { + "id": "test3" + }, + "test3_vcf.vcf.gz.csi" + ] + ], + [ + + ], + [ + "versions.yml:md5,6640b543bdeba692970e302474aaee22" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T13:07:55.303850698" + }, + "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi - stub": { "content": [ { "0": [ @@ -269,73 +290,52 @@ { "id": "test3" }, - "test3.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "1": [ - + [ + { + "id": "test3" + }, + "test3_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ], "2": [ ], "3": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ], "csi": [ ], "tbi": [ - + [ + { + "id": "test3" + }, + "test3_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ], "vcf": [ [ { "id": "test3" }, - "test3.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "versions": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-26T11:04:02.45346063" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi": { - "content": [ - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - [ - - ], - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:03:44.618596639" + "timestamp": "2025-04-01T13:08:32.675839006" }, "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi - stub": { "content": [ @@ -360,7 +360,7 @@ ] ], "3": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ], "csi": [ [ @@ -382,14 +382,14 @@ ] ], "versions": [ - "versions.yml:md5,c6e19f105510a46af1c5da9064e2e659" + "versions.yml:md5,6640b543bdeba692970e302474aaee22" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-26T11:04:19.745768656" + "timestamp": "2025-04-01T13:08:25.698924757" } } \ No newline at end of file diff --git a/modules/nf-core/bcftools/concat/tests/tags.yml b/modules/nf-core/bcftools/concat/tests/tags.yml deleted file mode 100644 index 21710d4ebd..0000000000 --- a/modules/nf-core/bcftools/concat/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bcftools/concat: - - "modules/nf-core/bcftools/concat/**" diff --git a/modules/nf-core/bcftools/mpileup/environment.yml b/modules/nf-core/bcftools/mpileup/environment.yml index 5c00b116ad..557488607c 100644 --- a/modules/nf-core/bcftools/mpileup/environment.yml +++ b/modules/nf-core/bcftools/mpileup/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::bcftools=1.20 + - bioconda::bcftools=1.21 diff --git a/modules/nf-core/bcftools/mpileup/main.nf b/modules/nf-core/bcftools/mpileup/main.nf index 82e14df7a7..f712b5183e 100644 --- a/modules/nf-core/bcftools/mpileup/main.nf +++ b/modules/nf-core/bcftools/mpileup/main.nf @@ -4,8 +4,8 @@ process BCFTOOLS_MPILEUP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.20--h8b25389_0': - 'biocontainers/bcftools:1.20--h8b25389_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/5a/5acacb55c52bec97c61fd34ffa8721fce82ce823005793592e2a80bf71632cd0/data': + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: tuple val(meta), path(bam), path(intervals) @@ -29,7 +29,7 @@ process BCFTOOLS_MPILEUP { def prefix = task.ext.prefix ?: "${meta.id}" def mpileup = save_mpileup ? "| tee ${prefix}.mpileup" : "" def bgzip_mpileup = save_mpileup ? "bgzip ${prefix}.mpileup" : "" - def intervals = intervals ? "-T ${intervals}" : "" + def intervals_cmd = intervals ? "-T ${intervals}" : "" """ echo "${meta.id}" > sample_name.list @@ -38,7 +38,7 @@ process BCFTOOLS_MPILEUP { --fasta-ref $fasta \\ $args \\ $bam \\ - $intervals \\ + $intervals_cmd \\ $mpileup \\ | bcftools call --output-type v $args2 \\ | bcftools reheader --samples sample_name.list \\ diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap index a772689882..08c87e2f81 100644 --- a/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap +++ b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap @@ -72,14 +72,14 @@ "bam_fasta_false_versions": { "content": [ [ - "versions.yml:md5,6af9a67cd12c721ccc9702c17bc2f3a5" + "versions.yml:md5,489c9d000145be40205442e6c1be70a5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T15:14:23.424052671" + "timestamp": "2025-04-01T13:44:46.083414473" }, "bam_fasta_false_stub.bcftools_stats.txt": { "content": [ @@ -94,14 +94,14 @@ "bam_bed_fasta_false_versions": { "content": [ [ - "versions.yml:md5,6af9a67cd12c721ccc9702c17bc2f3a5" + "versions.yml:md5,489c9d000145be40205442e6c1be70a5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T15:14:44.101963218" + "timestamp": "2025-04-01T13:45:06.213311379" }, "bam_bed_fasta_false.vcf.gz": { "content": [ @@ -116,14 +116,14 @@ "bam_bed_fasta_true_versions": { "content": [ [ - "versions.yml:md5,6af9a67cd12c721ccc9702c17bc2f3a5" + "versions.yml:md5,489c9d000145be40205442e6c1be70a5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T15:14:38.630394619" + "timestamp": "2025-04-01T13:45:01.634976363" }, "bam_fasta_false.vcf.gz": { "content": [ @@ -208,14 +208,14 @@ "bam_fasta_false_stub_versions": { "content": [ [ - "versions.yml:md5,6af9a67cd12c721ccc9702c17bc2f3a5" + "versions.yml:md5,489c9d000145be40205442e6c1be70a5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T15:14:28.530439931" + "timestamp": "2025-04-01T13:44:50.214889195" }, "bam_bed_fasta_true.bcftools_stats.txt": { "content": [ @@ -240,14 +240,14 @@ "bam_bed_fasta_false_stub_versions": { "content": [ [ - "versions.yml:md5,6af9a67cd12c721ccc9702c17bc2f3a5" + "versions.yml:md5,489c9d000145be40205442e6c1be70a5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T15:14:49.139377519" + "timestamp": "2025-04-01T13:45:10.356826049" }, "bam_bed_fasta_true.mpileup.gz": { "content": [ @@ -262,13 +262,13 @@ "bam_bed_fasta_true_stub_versions": { "content": [ [ - "versions.yml:md5,6af9a67cd12c721ccc9702c17bc2f3a5" + "versions.yml:md5,489c9d000145be40205442e6c1be70a5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T15:14:33.646218607" + "timestamp": "2025-04-01T13:44:57.520283217" } } \ No newline at end of file diff --git a/modules/nf-core/bcftools/mpileup/tests/tags.yml b/modules/nf-core/bcftools/mpileup/tests/tags.yml deleted file mode 100644 index 07b91f982c..0000000000 --- a/modules/nf-core/bcftools/mpileup/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bcftools/mpileup: - - "modules/nf-core/bcftools/mpileup/**" diff --git a/modules/nf-core/bcftools/sort/environment.yml b/modules/nf-core/bcftools/sort/environment.yml index 5c00b116ad..557488607c 100644 --- a/modules/nf-core/bcftools/sort/environment.yml +++ b/modules/nf-core/bcftools/sort/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::bcftools=1.20 + - bioconda::bcftools=1.21 diff --git a/modules/nf-core/bcftools/sort/main.nf b/modules/nf-core/bcftools/sort/main.nf index 7d4c9b8e9d..6cbd09b593 100644 --- a/modules/nf-core/bcftools/sort/main.nf +++ b/modules/nf-core/bcftools/sort/main.nf @@ -4,8 +4,8 @@ process BCFTOOLS_SORT { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.20--h8b25389_0': - 'biocontainers/bcftools:1.20--h8b25389_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/5a/5acacb55c52bec97c61fd34ffa8721fce82ce823005793592e2a80bf71632cd0/data': + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: tuple val(meta), path(vcf) diff --git a/modules/nf-core/bcftools/sort/tests/main.nf.test.snap b/modules/nf-core/bcftools/sort/tests/main.nf.test.snap index f38272cb28..f092dbf591 100644 --- a/modules/nf-core/bcftools/sort/tests/main.nf.test.snap +++ b/modules/nf-core/bcftools/sort/tests/main.nf.test.snap @@ -22,7 +22,7 @@ ], "3": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ], "csi": [ @@ -44,15 +44,15 @@ ] ], "versions": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:06:05.201680777" + "timestamp": "2025-04-01T14:11:26.694501734" }, "vcf": { "content": [ @@ -72,7 +72,7 @@ ], "3": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ], "csi": [ @@ -89,15 +89,15 @@ ] ], "versions": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:04:43.889971134" + "timestamp": "2025-04-01T14:10:49.218451505" }, "sarscov2 - vcf_gz_index": { "content": [ @@ -121,14 +121,14 @@ ], [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:04:55.385964497" + "timestamp": "2025-04-01T14:10:56.259159613" }, "sarscov2 - vcf_gz_index_csi": { "content": [ @@ -152,14 +152,14 @@ ], [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:05:06.662818922" + "timestamp": "2025-04-01T14:11:00.358141543" }, "sarscov2 - vcf_gz_index - stub": { "content": [ @@ -184,7 +184,7 @@ ] ], "3": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ], "csi": [ [ @@ -206,15 +206,15 @@ ] ], "versions": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:05:40.012912381" + "timestamp": "2025-04-01T14:11:18.590986384" }, "sarscov2 - vcf_gz_index_csi - stub": { "content": [ @@ -239,7 +239,7 @@ ] ], "3": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ], "csi": [ [ @@ -261,15 +261,15 @@ ] ], "versions": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:05:52.405673587" + "timestamp": "2025-04-01T14:11:22.65765844" }, "sarscov2 - vcf - stub": { "content": [ @@ -289,7 +289,7 @@ ], "3": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ], "csi": [ @@ -306,15 +306,15 @@ ] ], "versions": [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:05:29.117946461" + "timestamp": "2025-04-01T14:11:11.501401617" }, "sarscov2 - vcf_gz_index_tbi": { "content": [ @@ -338,13 +338,13 @@ ] ], [ - "versions.yml:md5,2c9f26ca356ef71199c3a7d1742974cb" + "versions.yml:md5,54b077078de3c204fb81688af4aae489" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-05T12:05:17.217274984" + "timestamp": "2025-04-01T14:11:07.401740499" } } \ No newline at end of file diff --git a/modules/nf-core/bcftools/sort/tests/tags.yml b/modules/nf-core/bcftools/sort/tests/tags.yml deleted file mode 100644 index 6e9520dd38..0000000000 --- a/modules/nf-core/bcftools/sort/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bcftools/sort: - - "modules/nf-core/bcftools/sort/**" diff --git a/modules/nf-core/bcftools/stats/environment.yml b/modules/nf-core/bcftools/stats/environment.yml index 93357b41ea..7aa06d0f7a 100644 --- a/modules/nf-core/bcftools/stats/environment.yml +++ b/modules/nf-core/bcftools/stats/environment.yml @@ -1,6 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::bcftools=1.20 - - bioconda::htslib=1.20 + - bioconda::bcftools=1.21 + - bioconda::htslib=1.21 diff --git a/modules/nf-core/bcftools/stats/main.nf b/modules/nf-core/bcftools/stats/main.nf index 20e5da7713..fb556e0aa5 100644 --- a/modules/nf-core/bcftools/stats/main.nf +++ b/modules/nf-core/bcftools/stats/main.nf @@ -4,8 +4,8 @@ process BCFTOOLS_STATS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.20--h8b25389_0': - 'biocontainers/bcftools:1.20--h8b25389_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/5a/5acacb55c52bec97c61fd34ffa8721fce82ce823005793592e2a80bf71632cd0/data': + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: tuple val(meta), path(vcf), path(tbi) diff --git a/modules/nf-core/bcftools/stats/tests/main.nf.test.snap b/modules/nf-core/bcftools/stats/tests/main.nf.test.snap index cd8cff6d2b..c771a055b9 100644 --- a/modules/nf-core/bcftools/stats/tests/main.nf.test.snap +++ b/modules/nf-core/bcftools/stats/tests/main.nf.test.snap @@ -2,7 +2,7 @@ "sarscov2 - vcf_gz - reference": { "content": [ [ - "# This file was produced by bcftools stats (1.20+htslib-1.20) and can be plotted using plot-vcfstats.", + "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", "# The command line was:\tbcftools stats --fasta-ref genome.fasta test.vcf.gz", "#", "# Definition of sets:", @@ -11,15 +11,15 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:14:35.506777837" + "timestamp": "2025-04-01T14:12:00.636338532" }, "sarscov2 - vcf_gz - exons": { "content": [ [ - "# This file was produced by bcftools stats (1.20+htslib-1.20) and can be plotted using plot-vcfstats.", + "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", "# The command line was:\tbcftools stats --exons exons.tsv.gz test.vcf.gz", "#", "# Definition of sets:", @@ -28,27 +28,27 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:14:30.57486244" + "timestamp": "2025-04-01T14:11:56.472662944" }, "versions": { "content": [ [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:16:27.637515559" + "timestamp": "2025-04-01T14:11:38.17663878" }, "sarscov2 - vcf_gz - targets": { "content": [ [ - "# This file was produced by bcftools stats (1.20+htslib-1.20) and can be plotted using plot-vcfstats.", + "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", "# The command line was:\tbcftools stats --targets-file test2.targets.tsv.gz test.vcf.gz", "#", "# Definition of sets:", @@ -57,34 +57,34 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:14:25.732997442" + "timestamp": "2025-04-01T14:11:49.263021261" }, "regions_versions": { "content": [ [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:16:32.559884458" + "timestamp": "2025-04-01T14:11:45.263363932" }, "targets_versions": { "content": [ [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:16:37.512009805" + "timestamp": "2025-04-01T14:11:49.260150422" }, "sarscov2 - vcf_gz - stub": { "content": [ @@ -98,7 +98,7 @@ ] ], "1": [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ], "stats": [ [ @@ -109,44 +109,44 @@ ] ], "versions": [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-06-03T11:57:09.614976125" + "timestamp": "2025-04-01T14:12:07.469893476" }, "exon_versions": { "content": [ [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:16:42.347397266" + "timestamp": "2025-04-01T14:11:56.46980859" }, "ref_versions": { "content": [ [ - "versions.yml:md5,17cdf9d1ad31f6b1f5935dfcc9fe7b9a" + "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:16:47.26823622" + "timestamp": "2025-04-01T14:12:00.633746007" }, "sarscov2 - vcf_gz": { "content": [ [ - "# This file was produced by bcftools stats (1.20+htslib-1.20) and can be plotted using plot-vcfstats.", + "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", "# The command line was:\tbcftools stats test.vcf.gz", "#", "# Definition of sets:", @@ -155,15 +155,15 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:16:27.670416598" + "timestamp": "2025-04-01T14:11:38.184907984" }, "sarscov2 - vcf_gz - regions": { "content": [ [ - "# This file was produced by bcftools stats (1.20+htslib-1.20) and can be plotted using plot-vcfstats.", + "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", "# The command line was:\tbcftools stats --regions-file test3.vcf.gz test.vcf.gz", "#", "# Definition of sets:", @@ -172,9 +172,9 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-05-31T18:14:20.759094062" + "timestamp": "2025-04-01T14:11:45.266296334" } } \ No newline at end of file diff --git a/modules/nf-core/bcftools/stats/tests/tags.yml b/modules/nf-core/bcftools/stats/tests/tags.yml deleted file mode 100644 index 53c12d92a9..0000000000 --- a/modules/nf-core/bcftools/stats/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bcftools/stats: - - "modules/nf-core/bcftools/stats/**" diff --git a/modules/nf-core/bwa/index/environment.yml b/modules/nf-core/bwa/index/environment.yml index d8789a2092..ed5448a197 100644 --- a/modules/nf-core/bwa/index/environment.yml +++ b/modules/nf-core/bwa/index/environment.yml @@ -1,5 +1,13 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda + dependencies: + # renovate: datasource=conda depName=bioconda/bwa - bioconda::bwa=0.7.18 + # renovate: datasource=conda depName=bioconda/htslib + - bioconda::htslib=1.21 + # renovate: datasource=conda depName=bioconda/samtools + - bioconda::samtools=1.21 diff --git a/modules/nf-core/bwa/index/main.nf b/modules/nf-core/bwa/index/main.nf index 2e48b6caae..72e078aac2 100644 --- a/modules/nf-core/bwa/index/main.nf +++ b/modules/nf-core/bwa/index/main.nf @@ -1,18 +1,20 @@ process BWA_INDEX { tag "$fasta" - label 'process_single' + // NOTE requires 5.37N memory where N is the size of the database + // source: https://bio-bwa.sourceforge.net/bwa.shtml#8 + memory { 6.B * fasta.size() } conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bwa:0.7.18--he4a0461_0' : - 'biocontainers/bwa:0.7.18--he4a0461_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/bf/bf7890f8d4e38a7586581cb7fa13401b7af1582f21d94eef969df4cea852b6da/data' : + 'community.wave.seqera.io/library/bwa_htslib_samtools:56c9f8d5201889a4' }" input: tuple val(meta), path(fasta) output: - tuple val(meta), path(bwa) , emit: index - path "versions.yml" , emit: versions + tuple val(meta), path("bwa") , emit: index + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when diff --git a/modules/nf-core/bwa/index/meta.yml b/modules/nf-core/bwa/index/meta.yml index 4884bca2ab..77dbc7af02 100644 --- a/modules/nf-core/bwa/index/meta.yml +++ b/modules/nf-core/bwa/index/meta.yml @@ -14,7 +14,7 @@ tools: documentation: https://bio-bwa.sourceforge.net/bwa.shtml arxiv: arXiv:1303.3997 licence: ["GPL-3.0-or-later"] - identifier: "" + identifier: "biotools:bwa" input: - - meta: type: map @@ -24,6 +24,9 @@ input: - fasta: type: file description: Input genome fasta file + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1929" # FASTA output: - index: - meta: @@ -32,9 +35,13 @@ output: Groovy Map containing reference information. e.g. [ id:'test', single_end:false ] - bwa: - type: file - description: BWA genome index files + type: map + description: | + Groovy Map containing reference information. + e.g. [ id:'test', single_end:false ] pattern: "*.{amb,ann,bwt,pac,sa}" + ontologies: + - edam: "http://edamontology.org/data_3210" # Genome index - versions: - versions.yml: type: file diff --git a/modules/nf-core/bwa/index/tests/tags.yml b/modules/nf-core/bwa/index/tests/tags.yml deleted file mode 100644 index 28bb483c4e..0000000000 --- a/modules/nf-core/bwa/index/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bwa/index: - - modules/nf-core/bwa/index/** diff --git a/modules/nf-core/bwa/mem/environment.yml b/modules/nf-core/bwa/mem/environment.yml index ef7b966c0f..ed5448a197 100644 --- a/modules/nf-core/bwa/mem/environment.yml +++ b/modules/nf-core/bwa/mem/environment.yml @@ -1,8 +1,13 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bwa=0.7.18 - - htslib=1.20.0 - - samtools=1.20 + # renovate: datasource=conda depName=bioconda/bwa + - bioconda::bwa=0.7.18 + # renovate: datasource=conda depName=bioconda/htslib + - bioconda::htslib=1.21 + # renovate: datasource=conda depName=bioconda/samtools + - bioconda::samtools=1.21 diff --git a/modules/nf-core/bwa/mem/main.nf b/modules/nf-core/bwa/mem/main.nf index 9c815f0c8e..3c54417824 100644 --- a/modules/nf-core/bwa/mem/main.nf +++ b/modules/nf-core/bwa/mem/main.nf @@ -4,8 +4,8 @@ process BWA_MEM { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-fe8faa35dbf6dc65a0f7f5d4ea12e31a79f73e40:1bd8542a8a0b42e0981337910954371d0230828e-0' : - 'biocontainers/mulled-v2-fe8faa35dbf6dc65a0f7f5d4ea12e31a79f73e40:1bd8542a8a0b42e0981337910954371d0230828e-0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/bf/bf7890f8d4e38a7586581cb7fa13401b7af1582f21d94eef969df4cea852b6da/data' : + 'community.wave.seqera.io/library/bwa_htslib_samtools:56c9f8d5201889a4' }" input: tuple val(meta) , path(reads) @@ -53,10 +53,8 @@ process BWA_MEM { """ stub: - def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def samtools_command = sort_bam ? 'sort' : 'view' def extension = args2.contains("--output-fmt sam") ? "sam" : args2.contains("--output-fmt cram") ? "cram": sort_bam && args2.contains("-O cram")? "cram": diff --git a/modules/nf-core/bwa/mem/meta.yml b/modules/nf-core/bwa/mem/meta.yml index 37467d2912..b6f696c03b 100644 --- a/modules/nf-core/bwa/mem/meta.yml +++ b/modules/nf-core/bwa/mem/meta.yml @@ -17,7 +17,7 @@ tools: documentation: https://bio-bwa.sourceforge.net/bwa.shtml arxiv: arXiv:1303.3997 licence: ["GPL-3.0-or-later"] - identifier: "" + identifier: "biotools:bwa" input: - - meta: type: map @@ -29,6 +29,9 @@ input: description: | List of input FastQ files of size 1 and 2 for single-end and paired-end data, respectively. + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1930" # FASTQ - - meta2: type: map description: | @@ -38,6 +41,8 @@ input: type: file description: BWA genome index files pattern: "Directory containing BWA index *.{amb,ann,bwt,pac,sa}" + ontologies: + - edam: "http://edamontology.org/data_3210" # Genome index - - meta3: type: map description: | @@ -47,6 +52,9 @@ input: type: file description: Reference genome in FASTA format pattern: "*.{fasta,fa}" + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1929" # FASTA - - sort_bam: type: boolean description: use samtools sort (true) or samtools view (false) @@ -56,25 +64,26 @@ output: - meta: type: file description: Output BAM file containing read alignments - pattern: "*.{bam}" - "*.bam": type: file description: Output BAM file containing read alignments pattern: "*.{bam}" + ontologies: + - edam: "http://edamontology.org/format_2572" # BAM - cram: - meta: type: file description: Output CRAM file containing read alignments - pattern: "*.{cram}" - "*.cram": type: file description: Output CRAM file containing read alignments pattern: "*.{cram}" + ontologies: + - edam: "http://edamontology.org/format_3462" # CRAM - csi: - meta: type: file description: Optional index file for BAM file - pattern: "*.{csi}" - "*.csi": type: file description: Optional index file for BAM file @@ -83,7 +92,6 @@ output: - meta: type: file description: Optional index file for CRAM file - pattern: "*.{crai}" - "*.crai": type: file description: Optional index file for CRAM file diff --git a/modules/nf-core/bwa/mem/tests/main.nf.test.snap b/modules/nf-core/bwa/mem/tests/main.nf.test.snap index 2079ea2240..3aaefdda39 100644 --- a/modules/nf-core/bwa/mem/tests/main.nf.test.snap +++ b/modules/nf-core/bwa/mem/tests/main.nf.test.snap @@ -11,16 +11,16 @@ ], [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], - "b6d9cb250261a4c125413c5d867d87a7", + "53df0e7b72f1f85fb28af5fec435246", "798439cbd7fd81cbcc5078022dc5479d" ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:22:28.051598" + "timestamp": "2025-03-27T08:36:00.831642964" }, "Single-End Sort": { "content": [ @@ -34,16 +34,16 @@ ], [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], - "848434ae4b79cfdcb2281c60b33663ce", + "5eca502b75fefc26e8000908bf0bb3a3", "94fcf617f5b994584c4e8d4044e16b4f" ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:22:39.671154" + "timestamp": "2025-03-27T08:36:16.025706238" }, "Paired-End": { "content": [ @@ -57,16 +57,16 @@ ], [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], - "5b34d31be84478761f789e3e2e805e31", + "fec2aafbba4637767bc4e202c71aee58", "57aeef88ed701a8ebc8e2f0a381b2a6" ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:22:51.919479" + "timestamp": "2025-03-27T08:36:27.309924644" }, "Paired-End Sort": { "content": [ @@ -80,16 +80,16 @@ ], [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], - "69003376d9a8952622d8587b39c3eaae", + "d5ad8844218280969c1f9349bd62d057", "af8628d9df18b2d3d4f6fd47ef2bb872" ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:23:00.833562" + "timestamp": "2025-03-27T08:36:45.448624985" }, "Single-end - stub": { "content": [ @@ -125,7 +125,7 @@ ] ], "4": [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], "bam": [ [ @@ -158,15 +158,15 @@ ] ], "versions": [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:31:29.46282" + "timestamp": "2025-03-27T08:37:16.211123969" }, "Paired-End - no fasta": { "content": [ @@ -180,16 +180,16 @@ ], [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], - "5b34d31be84478761f789e3e2e805e31", + "fec2aafbba4637767bc4e202c71aee58", "57aeef88ed701a8ebc8e2f0a381b2a6" ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:23:09.942545" + "timestamp": "2025-03-27T08:36:56.592159657" }, "Paired-end - stub": { "content": [ @@ -225,7 +225,7 @@ ] ], "4": [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ], "bam": [ [ @@ -258,14 +258,14 @@ ] ], "versions": [ - "versions.yml:md5,478b816fbd37871f5e8c617833d51d80" + "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:31:37.757037" + "timestamp": "2025-03-27T08:37:32.177177506" } } \ No newline at end of file diff --git a/modules/nf-core/bwa/mem/tests/tags.yml b/modules/nf-core/bwa/mem/tests/tags.yml deleted file mode 100644 index 82992d1f0b..0000000000 --- a/modules/nf-core/bwa/mem/tests/tags.yml +++ /dev/null @@ -1,3 +0,0 @@ -bwa/mem: - - modules/nf-core/bwa/index/** - - modules/nf-core/bwa/mem/** diff --git a/modules/nf-core/bwamem2/index/environment.yml b/modules/nf-core/bwamem2/index/environment.yml index 15cee23876..c069e281ac 100644 --- a/modules/nf-core/bwamem2/index/environment.yml +++ b/modules/nf-core/bwamem2/index/environment.yml @@ -1,5 +1,13 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda + dependencies: - - bioconda::bwa-mem2=2.2.1 + # renovate: datasource=conda depName=bioconda/bwa-mem2 + - bwa-mem2=2.2.1 + # renovate: datasource=conda depName=bioconda/htslib + - htslib=1.21 + # renovate: datasource=conda depName=bioconda/samtools + - samtools=1.21 diff --git a/modules/nf-core/bwamem2/index/main.nf b/modules/nf-core/bwamem2/index/main.nf index b7688285d7..09826e6694 100644 --- a/modules/nf-core/bwamem2/index/main.nf +++ b/modules/nf-core/bwamem2/index/main.nf @@ -1,11 +1,13 @@ process BWAMEM2_INDEX { tag "$fasta" - label 'process_single' + // NOTE Requires 28N GB memory where N is the size of the reference sequence + // source: https://github.com/bwa-mem2/bwa-mem2/issues/9 + memory { 28.B * fasta.size() } conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bwa-mem2:2.2.1--he513fc3_0' : - 'biocontainers/bwa-mem2:2.2.1--he513fc3_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9a/9ac054213e67b3c9308e409b459080bbe438f8fd6c646c351bc42887f35a42e7/data' : + 'community.wave.seqera.io/library/bwa-mem2_htslib_samtools:e1f420694f8e42bd' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/bwamem2/index/meta.yml b/modules/nf-core/bwamem2/index/meta.yml index 74f54ef0d8..1437b20f10 100644 --- a/modules/nf-core/bwamem2/index/meta.yml +++ b/modules/nf-core/bwamem2/index/meta.yml @@ -13,7 +13,7 @@ tools: homepage: https://github.com/bwa-mem2/bwa-mem2 documentation: https://github.com/bwa-mem2/bwa-mem2#usage licence: ["MIT"] - identifier: "" + identifier: "biotools:bwa-mem2" input: - - meta: type: map @@ -23,6 +23,9 @@ input: - fasta: type: file description: Input genome fasta file + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1929" # FASTA output: - index: - meta: @@ -34,6 +37,8 @@ output: type: file description: BWA genome index files pattern: "*.{0123,amb,ann,bwt.2bit.64,pac}" + ontologies: + - edam: "http://edamontology.org/data_3210" # Genome index - versions: - versions.yml: type: file diff --git a/modules/nf-core/bwamem2/index/tests/tags.yml b/modules/nf-core/bwamem2/index/tests/tags.yml deleted file mode 100644 index 3953018eec..0000000000 --- a/modules/nf-core/bwamem2/index/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bwamem2/index: - - modules/nf-core/bwamem2/index/** diff --git a/modules/nf-core/bwamem2/mem/environment.yml b/modules/nf-core/bwamem2/mem/environment.yml index 7e0b5a3479..c069e281ac 100644 --- a/modules/nf-core/bwamem2/mem/environment.yml +++ b/modules/nf-core/bwamem2/mem/environment.yml @@ -1,8 +1,13 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: + # renovate: datasource=conda depName=bioconda/bwa-mem2 - bwa-mem2=2.2.1 - - htslib=1.19.1 - - samtools=1.19.2 + # renovate: datasource=conda depName=bioconda/htslib + - htslib=1.21 + # renovate: datasource=conda depName=bioconda/samtools + - samtools=1.21 diff --git a/modules/nf-core/bwamem2/mem/main.nf b/modules/nf-core/bwamem2/mem/main.nf index 729428c4e0..eab662a87a 100644 --- a/modules/nf-core/bwamem2/mem/main.nf +++ b/modules/nf-core/bwamem2/mem/main.nf @@ -4,8 +4,8 @@ process BWAMEM2_MEM { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-e5d375990341c5aef3c9aff74f96f66f65375ef6:2d15960ccea84e249a150b7f5d4db3a42fc2d6c3-0' : - 'biocontainers/mulled-v2-e5d375990341c5aef3c9aff74f96f66f65375ef6:2d15960ccea84e249a150b7f5d4db3a42fc2d6c3-0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9a/9ac054213e67b3c9308e409b459080bbe438f8fd6c646c351bc42887f35a42e7/data' : + 'community.wave.seqera.io/library/bwa-mem2_htslib_samtools:e1f420694f8e42bd' }" input: tuple val(meta), path(reads) @@ -56,14 +56,11 @@ process BWAMEM2_MEM { stub: - def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def samtools_command = sort_bam ? 'sort' : 'view' def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ def extension_matcher = (args2 =~ extension_pattern) def extension = extension_matcher.getCount() > 0 ? extension_matcher[0][2].toLowerCase() : "bam" - def reference = fasta && extension=="cram" ? "--reference ${fasta}" : "" if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" def create_index = "" diff --git a/modules/nf-core/bwamem2/mem/meta.yml b/modules/nf-core/bwamem2/mem/meta.yml index c6333ca171..d17e0dbd3a 100644 --- a/modules/nf-core/bwamem2/mem/meta.yml +++ b/modules/nf-core/bwamem2/mem/meta.yml @@ -17,7 +17,7 @@ tools: documentation: http://www.htslib.org/doc/samtools.html arxiv: arXiv:1303.3997 licence: ["MIT"] - identifier: "" + identifier: "biotools:bwa-mem2" input: - - meta: type: map @@ -29,6 +29,9 @@ input: description: | List of input FastQ files of size 1 and 2 for single-end and paired-end data, respectively. + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1930" # FASTQ - - meta2: type: map description: | @@ -38,6 +41,8 @@ input: type: file description: BWA genome index files pattern: "Directory containing BWA index *.{0132,amb,ann,bwt.2bit.64,pac}" + ontologies: + - edam: "http://edamontology.org/data_3210" # Genome index - - meta3: type: map description: | @@ -47,6 +52,9 @@ input: type: file description: Reference genome in FASTA format pattern: "*.{fa,fasta,fna}" + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1929" # FASTA - - sort_bam: type: boolean description: use samtools sort (true) or samtools view (false) @@ -62,6 +70,8 @@ output: type: file description: Output SAM file containing read alignments pattern: "*.{sam}" + ontologies: + - edam: "http://edamontology.org/format_2573" # SAM - bam: - meta: type: map @@ -72,6 +82,8 @@ output: type: file description: Output BAM file containing read alignments pattern: "*.{bam}" + ontologies: + - edam: "http://edamontology.org/format_2572" # BAM - cram: - meta: type: map @@ -82,6 +94,8 @@ output: type: file description: Output CRAM file containing read alignments pattern: "*.{cram}" + ontologies: + - edam: "http://edamontology.org/format_3462" # CRAM - crai: - meta: type: map diff --git a/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap b/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap index 69bc3612bf..ec90701f33 100644 --- a/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap +++ b/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap @@ -1,17 +1,17 @@ { "sarscov2 - [fastq1, fastq2], index, fasta, false": { "content": [ - "eefa0f44493fd0504e734efd2f1f4a9e", + "9505760d66e1d5a5d34ab79a98228c6", "57aeef88ed701a8ebc8e2f0a381b2a6", [ - "versions.yml:md5,1c1a9566f189ec077b5179bbf453c51a" + "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:23:37.929675" + "timestamp": "2025-03-27T10:57:52.782442426" }, "sarscov2 - [fastq1, fastq2], index, fasta, true - stub": { "content": [ @@ -44,7 +44,7 @@ ] ], "5": [ - "versions.yml:md5,1c1a9566f189ec077b5179bbf453c51a" + "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" ], "bam": [ [ @@ -74,56 +74,56 @@ ], "versions": [ - "versions.yml:md5,1c1a9566f189ec077b5179bbf453c51a" + "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:12:06.693567" + "timestamp": "2025-03-27T10:58:37.140104324" }, "sarscov2 - [fastq1, fastq2], index, fasta, true": { "content": [ - "7aba324f82d5b4e926a5dd7b46029cb4", + "e0c38d5772ca5f4d5d9999f4477e933c", "af8628d9df18b2d3d4f6fd47ef2bb872", [ - "versions.yml:md5,1c1a9566f189ec077b5179bbf453c51a" + "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:23:53.488374" + "timestamp": "2025-03-27T10:58:19.047052261" }, "sarscov2 - fastq, index, fasta, false": { "content": [ - "bc02b41697b3a8f1021b02becec24052", + "58d05395bbb819e929885bde415947ae", "798439cbd7fd81cbcc5078022dc5479d", [ - "versions.yml:md5,1c1a9566f189ec077b5179bbf453c51a" + "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:23:05.644682" + "timestamp": "2025-03-27T10:56:53.456559296" }, "sarscov2 - fastq, index, fasta, true": { "content": [ - "e41d67320815d29ba5f6e9d1ae21902a", + "276189f6f003f99a87664e74fad2893d", "94fcf617f5b994584c4e8d4044e16b4f", [ - "versions.yml:md5,1c1a9566f189ec077b5179bbf453c51a" + "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-08-02T12:23:21.837763" + "timestamp": "2025-03-27T10:57:21.949711746" } } \ No newline at end of file diff --git a/modules/nf-core/bwamem2/mem/tests/tags.yml b/modules/nf-core/bwamem2/mem/tests/tags.yml deleted file mode 100644 index 134efb2b3d..0000000000 --- a/modules/nf-core/bwamem2/mem/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bwamem2/mem: - - "modules/nf-core/bwamem2/mem/**" diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml index 9b01c865a2..50c2059afb 100644 --- a/modules/nf-core/cat/cat/environment.yml +++ b/modules/nf-core/cat/cat/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/cat/cat/tests/tags.yml b/modules/nf-core/cat/cat/tests/tags.yml deleted file mode 100644 index 37b578f523..0000000000 --- a/modules/nf-core/cat/cat/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -cat/cat: - - modules/nf-core/cat/cat/** diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml index 71e04c3d71..9b926b1ffa 100644 --- a/modules/nf-core/cat/fastq/environment.yml +++ b/modules/nf-core/cat/fastq/environment.yml @@ -1,5 +1,12 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - conda-forge::coreutils=9.5 + - conda-forge::grep=3.11 + - conda-forge::gzip=1.13 + - conda-forge::lbzip2=2.5 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf index 4364a389b7..acfb6d0e62 100644 --- a/modules/nf-core/cat/fastq/main.nf +++ b/modules/nf-core/cat/fastq/main.nf @@ -1,26 +1,25 @@ process CAT_FASTQ { - tag "$meta.id" + tag "${meta.id}" label 'process_single' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/c2/c262fc09eca59edb5a724080eeceb00fb06396f510aefb229c2d2c6897e63975/data' : - 'community.wave.seqera.io/library/coreutils:9.5--ae99c88a9b28c264' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/52/52ccce28d2ab928ab862e25aae26314d69c8e38bd41ca9431c67ef05221348aa/data' + : 'community.wave.seqera.io/library/coreutils_grep_gzip_lbzip2_pruned:838ba80435a629f8'}" input: tuple val(meta), path(reads, stageAs: "input*/*") output: tuple val(meta), path("*.merged.fastq.gz"), emit: reads - path "versions.yml" , emit: versions + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] + def readList = reads instanceof List ? reads.collect { it.toString() } : [reads.toString()] if (meta.single_end) { if (readList.size >= 1) { """ @@ -31,12 +30,15 @@ process CAT_FASTQ { cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') END_VERSIONS """ + } else { + error("Could not find any FASTQ files to concatenate in the process input") } - } else { + } + else { if (readList.size >= 2) { def read1 = [] def read2 = [] - readList.eachWithIndex{ v, ix -> ( ix & 1 ? read2 : read1 ) << v } + readList.eachWithIndex { v, ix -> (ix & 1 ? read2 : read1) << v } """ cat ${read1.join(' ')} > ${prefix}_1.merged.fastq.gz cat ${read2.join(' ')} > ${prefix}_2.merged.fastq.gz @@ -46,12 +48,14 @@ process CAT_FASTQ { cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') END_VERSIONS """ + } else { + error("Could not find any FASTQ file pairs to concatenate in the process input") } } stub: def prefix = task.ext.prefix ?: "${meta.id}" - def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] + def readList = reads instanceof List ? reads.collect { it.toString() } : [reads.toString()] if (meta.single_end) { if (readList.size >= 1) { """ @@ -62,8 +66,11 @@ process CAT_FASTQ { cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') END_VERSIONS """ + } else { + error("Could not find any FASTQ files to concatenate in the process input") } - } else { + } + else { if (readList.size >= 2) { """ echo '' | gzip > ${prefix}_1.merged.fastq.gz @@ -74,6 +81,8 @@ process CAT_FASTQ { cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') END_VERSIONS """ + } else { + error("Could not find any FASTQ file pairs to concatenate in the process input") } } } diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test index f88a78b6ca..013c1d0f49 100644 --- a/modules/nf-core/cat/fastq/tests/main.nf.test +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -1,5 +1,3 @@ -// NOTE The version snaps may not be consistant -// https://github.com/nf-core/modules/pull/4087#issuecomment-1767948035 nextflow_process { name "Test Process CAT_FASTQ" @@ -245,4 +243,92 @@ nextflow_process { ) } } + + test("test_cat_fastq_single_end_no_files") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } + + test("test_cat_fastq_paired_end_no_files") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } + + test("test_cat_fastq_single_end_no_files - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } + + test("test_cat_fastq_paired_end_no_files - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } } diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap index f8689a1ce5..ee5ab36476 100644 --- a/modules/nf-core/cat/fastq/tests/main.nf.test.snap +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -1,5 +1,15 @@ { - "test_cat_fastq_single_end": { + "test_cat_fastq_paired_end_no_files - stub": { + "content": [ + " Could not find any FASTQ file pairs to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:14:51.248685461" + }, + "test_cat_fastq_single_end_single_file": { "content": [ { "0": [ @@ -8,7 +18,7 @@ "id": "test", "single_end": true }, - "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" ] ], "1": [ @@ -20,7 +30,7 @@ "id": "test", "single_end": true }, - "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" ] ], "versions": [ @@ -29,21 +39,24 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:02:07.519211144" + "timestamp": "2025-02-25T17:24:04.902821069" }, - "test_cat_fastq_single_end_same_name": { + "test_cat_fastq_paired_end_same_name": { "content": [ { "0": [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] ] ], "1": [ @@ -53,9 +66,12 @@ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] ] ], "versions": [ @@ -64,21 +80,24 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:02:31.618628921" + "timestamp": "2025-02-25T17:23:57.476357974" }, - "test_cat_fastq_single_end_single_file": { + "test_cat_fastq_paired_end_same_name - stub": { "content": [ { "0": [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] ] ], "1": [ @@ -88,9 +107,12 @@ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] ] ], "versions": [ @@ -99,24 +121,21 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:02:57.904149581" + "timestamp": "2025-02-25T17:24:34.615815265" }, - "test_cat_fastq_paired_end_same_name": { + "test_cat_fastq_single_end": { "content": [ { "0": [ [ { "id": "test", - "single_end": false + "single_end": true }, - [ - "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", - "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" - ] + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" ] ], "1": [ @@ -126,12 +145,9 @@ [ { "id": "test", - "single_end": false + "single_end": true }, - [ - "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", - "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" - ] + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" ] ], "versions": [ @@ -140,12 +156,12 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:02:44.577183829" + "timestamp": "2025-02-25T17:23:32.489874386" }, - "test_cat_fastq_single_end - stub": { + "test_cat_fastq_single_end_same_name": { "content": [ { "0": [ @@ -154,7 +170,7 @@ "id": "test", "single_end": true }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" ] ], "1": [ @@ -166,7 +182,7 @@ "id": "test", "single_end": true }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" ] ], "versions": [ @@ -175,24 +191,21 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:03:10.603734777" + "timestamp": "2025-02-25T17:23:49.184759506" }, - "test_cat_fastq_paired_end_same_name - stub": { + "test_cat_fastq_single_end - stub": { "content": [ { "0": [ [ { "id": "test", - "single_end": false + "single_end": true }, - [ - "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "1": [ @@ -202,12 +215,9 @@ [ { "id": "test", - "single_end": false + "single_end": true }, - [ - "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "versions": [ @@ -216,10 +226,30 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:12.857293744" + }, + "test_cat_fastq_paired_end_no_files": { + "content": [ + " Could not find any FASTQ file pairs to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:14:40.806088747" + }, + "test_cat_fastq_single_end_no_files - stub": { + "content": [ + " Could not find any FASTQ files to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:03:46.041808828" + "timestamp": "2025-02-25T17:14:45.852365218" }, "test_cat_fastq_single_end_same_name - stub": { "content": [ @@ -251,10 +281,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:03:34.13865402" + "timestamp": "2025-02-25T17:24:27.816080065" }, "test_cat_fastq_paired_end": { "content": [ @@ -292,10 +322,20 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:23:41.739469187" + }, + "test_cat_fastq_single_end_no_files": { + "content": [ + " Could not find any FASTQ files to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:02:19.64383573" + "timestamp": "2025-02-25T17:14:35.695192409" }, "test_cat_fastq_paired_end - stub": { "content": [ @@ -333,10 +373,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:03:22.597246066" + "timestamp": "2025-02-25T17:24:21.178950408" }, "test_cat_fastq_single_end_single_file - stub": { "content": [ @@ -368,9 +408,9 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-10-19T20:03:58.44849001" + "timestamp": "2025-02-25T17:24:40.851404993" } } \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml deleted file mode 100644 index 6ac4361405..0000000000 --- a/modules/nf-core/cat/fastq/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -cat/fastq: - - modules/nf-core/cat/fastq/** diff --git a/modules/nf-core/cnvkit/antitarget/environment.yml b/modules/nf-core/cnvkit/antitarget/environment.yml index b683406cc5..9b3082be06 100644 --- a/modules/nf-core/cnvkit/antitarget/environment.yml +++ b/modules/nf-core/cnvkit/antitarget/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/cnvkit/antitarget/tests/tags.yml b/modules/nf-core/cnvkit/antitarget/tests/tags.yml deleted file mode 100644 index 9261ab536e..0000000000 --- a/modules/nf-core/cnvkit/antitarget/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -cnvkit/antitarget: - - "modules/nf-core/cnvkit/antitarget/**" diff --git a/modules/nf-core/cnvkit/batch/environment.yml b/modules/nf-core/cnvkit/batch/environment.yml index 5d79360119..a2466da99f 100644 --- a/modules/nf-core/cnvkit/batch/environment.yml +++ b/modules/nf-core/cnvkit/batch/environment.yml @@ -1,8 +1,10 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - bioconda::cnvkit=0.9.10 - - bioconda::htslib=1.17 # Matched with the container - - bioconda::samtools=1.17 # Matched with the container + - bioconda::htslib=1.17 + - bioconda::samtools=1.17 diff --git a/modules/nf-core/cnvkit/batch/tests/tags.yml b/modules/nf-core/cnvkit/batch/tests/tags.yml deleted file mode 100644 index 1c8565c829..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -cnvkit/batch: - - "modules/nf-core/cnvkit/batch/**" diff --git a/modules/nf-core/cnvkit/call/environment.yml b/modules/nf-core/cnvkit/call/environment.yml index 152af54d19..690d8fd7f7 100644 --- a/modules/nf-core/cnvkit/call/environment.yml +++ b/modules/nf-core/cnvkit/call/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/cnvkit/call/tests/main.nf.test b/modules/nf-core/cnvkit/call/tests/main.nf.test index 6012ef137f..b2435e50dd 100644 --- a/modules/nf-core/cnvkit/call/tests/main.nf.test +++ b/modules/nf-core/cnvkit/call/tests/main.nf.test @@ -17,7 +17,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file('https://raw.githubusercontent.com/etal/cnvkit/v0.9.9/test/formats/amplicon.cns', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true), [] ] @@ -40,7 +40,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file('https://raw.githubusercontent.com/etal/cnvkit/v0.9.9/test/formats/amplicon.cns', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) ] @@ -64,7 +64,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file('https://raw.githubusercontent.com/etal/cnvkit/v0.9.9/test/formats/amplicon.cns', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) ] diff --git a/modules/nf-core/cnvkit/call/tests/main.nf.test.snap b/modules/nf-core/cnvkit/call/tests/main.nf.test.snap index 844a415ecf..d78d39b0b0 100644 --- a/modules/nf-core/cnvkit/call/tests/main.nf.test.snap +++ b/modules/nf-core/cnvkit/call/tests/main.nf.test.snap @@ -8,7 +8,7 @@ "id": "test", "single_end": false }, - "test.cns:md5,7746029caf9ecc134a075a2d50be269f" + "test.cns:md5,6cff57a91d0376d5d3df6cf669935a82" ] ], "1": [ @@ -20,7 +20,7 @@ "id": "test", "single_end": false }, - "test.cns:md5,7746029caf9ecc134a075a2d50be269f" + "test.cns:md5,6cff57a91d0376d5d3df6cf669935a82" ] ], "versions": [ @@ -29,10 +29,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-09-05T22:24:41.048386" + "timestamp": "2024-12-18T17:17:47.974482513" }, "test-cnvkit-call-with-vcf": { "content": [ @@ -43,7 +43,7 @@ "id": "test", "single_end": false }, - "test.cns:md5,2a4b3da8a8131a4ed4ae902a9f96a405" + "test.cns:md5,c9a2bac6fd2980071a499c0ede0d6274" ] ], "1": [ @@ -55,7 +55,7 @@ "id": "test", "single_end": false }, - "test.cns:md5,2a4b3da8a8131a4ed4ae902a9f96a405" + "test.cns:md5,c9a2bac6fd2980071a499c0ede0d6274" ] ], "versions": [ @@ -64,10 +64,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-09-05T22:24:50.134984" + "timestamp": "2024-12-18T17:18:06.750975881" }, "test-cnvkit-call-with-vcf-stub": { "content": [ diff --git a/modules/nf-core/cnvkit/export/environment.yml b/modules/nf-core/cnvkit/export/environment.yml index 152af54d19..690d8fd7f7 100644 --- a/modules/nf-core/cnvkit/export/environment.yml +++ b/modules/nf-core/cnvkit/export/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/cnvkit/export/main.nf b/modules/nf-core/cnvkit/export/main.nf index b65c10632d..d1d7d3415b 100644 --- a/modules/nf-core/cnvkit/export/main.nf +++ b/modules/nf-core/cnvkit/export/main.nf @@ -8,7 +8,7 @@ process CNVKIT_EXPORT { 'biocontainers/cnvkit:0.9.10--pyhdfd78af_0' }" input: - tuple val(meta) , path(cns) + tuple val(meta), path(cns) output: tuple val(meta), path("${prefix}.${suffix}"), emit: output @@ -32,4 +32,16 @@ process CNVKIT_EXPORT { cnvkit: \$(cnvkit.py version | sed -e 's/cnvkit v//g') END_VERSIONS """ + + stub: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.args.tokenize(" ")[0] + """ + touch ${prefix}.${suffix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cnvkit: \$(cnvkit.py version | sed -e 's/cnvkit v//g') + END_VERSIONS + """ } diff --git a/modules/nf-core/cnvkit/export/meta.yml b/modules/nf-core/cnvkit/export/meta.yml index a573e03bac..d37e41f98f 100644 --- a/modules/nf-core/cnvkit/export/meta.yml +++ b/modules/nf-core/cnvkit/export/meta.yml @@ -8,7 +8,10 @@ keywords: tools: - cnvkit: description: | - CNVkit is a Python library and command-line software toolkit to infer and visualize copy number from high-throughput DNA sequencing data. It is designed for use with hybrid capture, including both whole-exome and custom target panels, and short-read sequencing platforms such as Illumina and Ion Torrent. + CNVkit is a Python library and command-line software toolkit to infer and + visualize copy number from high-throughput DNA sequencing data. + It is designed for use with hybrid capture, including both whole-exome and custom + target panels, and short-read sequencing platforms such as Illumina and Ion Torrent. homepage: https://cnvkit.readthedocs.io/en/stable/index.html documentation: https://cnvkit.readthedocs.io/en/stable/index.html licence: ["Apache-2.0"] diff --git a/modules/nf-core/cnvkit/export/tests/main.nf.test b/modules/nf-core/cnvkit/export/tests/main.nf.test new file mode 100644 index 0000000000..604649287a --- /dev/null +++ b/modules/nf-core/cnvkit/export/tests/main.nf.test @@ -0,0 +1,191 @@ + +nextflow_process { + + name "Test Process CNVKIT_EXPORT" + script "../main.nf" + process "CNVKIT_EXPORT" + + tag "modules" + tag "modules_nfcore" + tag "cnvkit" + tag "cnvkit/export" + + config "./nextflow.config" + + test("test_cnvkit_export_bed") { + + when { + params { + cnvkit_export_args = "bed -i test --show all" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cnr', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cnvkit_export_vcf") { + + when { + params { + cnvkit_export_args = "vcf -i test" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cnvkit_export_cdt") { + + when { + params { + cnvkit_export_args = "cdt" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cnvkit_export_jtv") { + + when { + params { + cnvkit_export_args = "jtv" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cnvkit_export_seg") { + + when { + params { + cnvkit_export_args = "seg" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cnvkit_export_theta") { + + when { + params { + cnvkit_export_args = "theta" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cnvkit_export_bed - stub") { + options "-stub" + + when { + params { + cnvkit_export_args = "bed -i test" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/cnvkit/export/tests/main.nf.test.snap b/modules/nf-core/cnvkit/export/tests/main.nf.test.snap new file mode 100644 index 0000000000..5ccf775912 --- /dev/null +++ b/modules/nf-core/cnvkit/export/tests/main.nf.test.snap @@ -0,0 +1,247 @@ +{ + "test_cnvkit_export_jtv": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.jtv:md5,cfffd19614115461f25676943b9aba39" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.jtv:md5,cfffd19614115461f25676943b9aba39" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-18T17:14:35.903562642" + }, + "test_cnvkit_export_theta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.theta:md5,8e914fbdb2ffb89a86c511ac482fcf4c" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.theta:md5,8e914fbdb2ffb89a86c511ac482fcf4c" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-18T17:15:10.840376238" + }, + "test_cnvkit_export_bed": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,9aed33259897ab550ac9663ce0bbe52c" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,9aed33259897ab550ac9663ce0bbe52c" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-18T17:49:08.660743128" + }, + "test_cnvkit_export_bed - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.1" + }, + "timestamp": "2024-12-16T15:14:16.424362905" + }, + "test_cnvkit_export_cdt": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cdt:md5,af9a62a55f9c8f9e0662f5817ead5a11" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cdt:md5,af9a62a55f9c8f9e0662f5817ead5a11" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-18T17:14:20.296270798" + }, + "test_cnvkit_export_seg": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.seg:md5,bdcc95c5dd0ad0882b5fde5f478fb09a" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.seg:md5,bdcc95c5dd0ad0882b5fde5f478fb09a" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-18T17:14:52.372709238" + }, + "test_cnvkit_export_vcf": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.vcf:md5,0a0b4a00192be12f67bb895888026f00" + ] + ], + "1": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.vcf:md5,0a0b4a00192be12f67bb895888026f00" + ] + ], + "versions": [ + "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-18T17:51:27.269813231" + } +} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/export/tests/nextflow.config b/modules/nf-core/cnvkit/export/tests/nextflow.config new file mode 100644 index 0000000000..0ca33b46e3 --- /dev/null +++ b/modules/nf-core/cnvkit/export/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'CNVKIT_EXPORT' { + ext.args = { params.cnvkit_export_args } + } +} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/genemetrics/environment.yml b/modules/nf-core/cnvkit/genemetrics/environment.yml index 152af54d19..690d8fd7f7 100644 --- a/modules/nf-core/cnvkit/genemetrics/environment.yml +++ b/modules/nf-core/cnvkit/genemetrics/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test b/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test index a2d8b4580c..2a24cbab03 100644 --- a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test +++ b/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test @@ -17,8 +17,8 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file('https://raw.githubusercontent.com/etal/cnvkit/v0.9.9/test/formats/amplicon.cnr', checkIfExists: true), - file('https://raw.githubusercontent.com/etal/cnvkit/v0.9.9/test/formats/amplicon.cns', checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cnr', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) ] """ @@ -40,7 +40,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file('https://raw.githubusercontent.com/etal/cnvkit/v0.9.9/test/formats/amplicon.cnr', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cnr', checkIfExists: true), [] ] diff --git a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap b/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap index 53ed81f370..07ce458992 100644 --- a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap +++ b/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap @@ -8,7 +8,7 @@ "id": "test", "single_end": false }, - "test.tsv:md5,622e154a107301da6f456b4b3196b79d" + "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" ] ], "1": [ @@ -20,7 +20,7 @@ "id": "test", "single_end": false }, - "test.tsv:md5,622e154a107301da6f456b4b3196b79d" + "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" ] ], "versions": [ @@ -29,10 +29,10 @@ } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-08-28T11:17:13.604558" + "timestamp": "2024-12-18T17:21:17.917810184" }, "test-cnvkit-genemetrics-with-cns": { "content": [ @@ -43,7 +43,7 @@ "id": "test", "single_end": false }, - "test.tsv:md5,2a18eca552ea33faab1d39795d9e051c" + "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" ] ], "1": [ @@ -55,7 +55,7 @@ "id": "test", "single_end": false }, - "test.tsv:md5,2a18eca552ea33faab1d39795d9e051c" + "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" ] ], "versions": [ @@ -64,9 +64,9 @@ } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-08-28T11:17:04.195978" + "timestamp": "2024-12-18T17:21:03.855092906" } } \ No newline at end of file diff --git a/modules/nf-core/cnvkit/reference/environment.yml b/modules/nf-core/cnvkit/reference/environment.yml index b683406cc5..9b3082be06 100644 --- a/modules/nf-core/cnvkit/reference/environment.yml +++ b/modules/nf-core/cnvkit/reference/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/cnvkit/reference/tests/tags.yml b/modules/nf-core/cnvkit/reference/tests/tags.yml deleted file mode 100644 index 55e13dd0a8..0000000000 --- a/modules/nf-core/cnvkit/reference/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -cnvkit/reference: - - "modules/nf-core/cnvkit/reference/**" diff --git a/modules/nf-core/controlfreec/assesssignificance/controlfreec-assesssignificance.diff b/modules/nf-core/controlfreec/assesssignificance/controlfreec-assesssignificance.diff index 49c0c9af21..0e6ac7d8cf 100644 --- a/modules/nf-core/controlfreec/assesssignificance/controlfreec-assesssignificance.diff +++ b/modules/nf-core/controlfreec/assesssignificance/controlfreec-assesssignificance.diff @@ -1,4 +1,4 @@ -Changes in module 'nf-core/controlfreec/assesssignificance' +Changes in component 'nf-core/controlfreec/assesssignificance' Changes in 'controlfreec/assesssignificance/main.nf': --- modules/nf-core/controlfreec/assesssignificance/main.nf +++ modules/nf-core/controlfreec/assesssignificance/main.nf @@ -36,7 +36,7 @@ Changes in 'controlfreec/assesssignificance/main.nf': Changes in 'controlfreec/assesssignificance/environment.yml': --- modules/nf-core/controlfreec/assesssignificance/environment.yml +++ modules/nf-core/controlfreec/assesssignificance/environment.yml -@@ -2,4 +2,4 @@ +@@ -4,4 +4,4 @@ - conda-forge - bioconda dependencies: @@ -46,5 +46,4 @@ Changes in 'controlfreec/assesssignificance/environment.yml': 'modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test.snap' is unchanged 'modules/nf-core/controlfreec/assesssignificance/tests/nextflow.config' is unchanged 'modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test' is unchanged -'modules/nf-core/controlfreec/assesssignificance/tests/tags.yml' is unchanged ************************************************************ diff --git a/modules/nf-core/controlfreec/assesssignificance/environment.yml b/modules/nf-core/controlfreec/assesssignificance/environment.yml index 444d29ddd4..8912f12f2a 100644 --- a/modules/nf-core/controlfreec/assesssignificance/environment.yml +++ b/modules/nf-core/controlfreec/assesssignificance/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/controlfreec/assesssignificance/tests/tags.yml b/modules/nf-core/controlfreec/assesssignificance/tests/tags.yml deleted file mode 100644 index 35dad632b5..0000000000 --- a/modules/nf-core/controlfreec/assesssignificance/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -controlfreec/assesssignificance: - - "modules/nf-core/controlfreec/assesssignificance/**" diff --git a/modules/nf-core/controlfreec/freec/environment.yml b/modules/nf-core/controlfreec/freec/environment.yml index f6b64529bc..3aebc4bde1 100644 --- a/modules/nf-core/controlfreec/freec/environment.yml +++ b/modules/nf-core/controlfreec/freec/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/controlfreec/freec/tests/tags.yml b/modules/nf-core/controlfreec/freec/tests/tags.yml deleted file mode 100644 index 585f06a523..0000000000 --- a/modules/nf-core/controlfreec/freec/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -controlfreec/freec: - - "modules/nf-core/controlfreec/freec/**" diff --git a/modules/nf-core/controlfreec/freec2bed/environment.yml b/modules/nf-core/controlfreec/freec2bed/environment.yml index f6b64529bc..3aebc4bde1 100644 --- a/modules/nf-core/controlfreec/freec2bed/environment.yml +++ b/modules/nf-core/controlfreec/freec2bed/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/controlfreec/freec2bed/tests/tags.yml b/modules/nf-core/controlfreec/freec2bed/tests/tags.yml deleted file mode 100644 index 0316bd2b28..0000000000 --- a/modules/nf-core/controlfreec/freec2bed/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -controlfreec/freec2bed: - - "modules/nf-core/controlfreec/freec2bed/**" diff --git a/modules/nf-core/controlfreec/freec2circos/environment.yml b/modules/nf-core/controlfreec/freec2circos/environment.yml index f6b64529bc..3aebc4bde1 100644 --- a/modules/nf-core/controlfreec/freec2circos/environment.yml +++ b/modules/nf-core/controlfreec/freec2circos/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/controlfreec/freec2circos/tests/tags.yml b/modules/nf-core/controlfreec/freec2circos/tests/tags.yml deleted file mode 100644 index 2f86e3a54d..0000000000 --- a/modules/nf-core/controlfreec/freec2circos/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -controlfreec/freec2circos: - - "modules/nf-core/controlfreec/freec2circos/**" diff --git a/modules/nf-core/controlfreec/makegraph2/environment.yml b/modules/nf-core/controlfreec/makegraph2/environment.yml index f6b64529bc..3aebc4bde1 100644 --- a/modules/nf-core/controlfreec/makegraph2/environment.yml +++ b/modules/nf-core/controlfreec/makegraph2/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/controlfreec/makegraph2/tests/tags.yml b/modules/nf-core/controlfreec/makegraph2/tests/tags.yml deleted file mode 100644 index f787f72aa5..0000000000 --- a/modules/nf-core/controlfreec/makegraph2/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -controlfreec/makegraph2: - - "modules/nf-core/controlfreec/makegraph2/**" diff --git a/modules/nf-core/deepvariant/rundeepvariant/main.nf b/modules/nf-core/deepvariant/rundeepvariant/main.nf index 7f99c53f6d..d2be378f55 100644 --- a/modules/nf-core/deepvariant/rundeepvariant/main.nf +++ b/modules/nf-core/deepvariant/rundeepvariant/main.nf @@ -3,9 +3,10 @@ process DEEPVARIANT_RUNDEEPVARIANT { label 'process_high' // FIXME Conda is not supported at the moment + // https://github.com/bioconda/bioconda-recipes/pull/45214#issuecomment-1890937836 // BUG https://github.com/nf-core/modules/issues/1754 // BUG https://github.com/bioconda/bioconda-recipes/issues/30310 - container "nf-core/deepvariant:1.6.1" + container "docker.io/google/deepvariant:1.8.0" input: tuple val(meta), path(input), path(index), path(intervals) @@ -15,11 +16,11 @@ process DEEPVARIANT_RUNDEEPVARIANT { tuple val(meta5), path(par_bed) output: - tuple val(meta), path("${prefix}.vcf.gz") , emit: vcf - tuple val(meta), path("${prefix}.vcf.gz.tbi") , emit: vcf_tbi - tuple val(meta), path("${prefix}.g.vcf.gz") , emit: gvcf - tuple val(meta), path("${prefix}.g.vcf.gz.tbi"), emit: gvcf_tbi - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}.vcf.gz") , emit: vcf + tuple val(meta), path("${prefix}.vcf.gz.tbi") , emit: vcf_tbi + tuple val(meta), path("${prefix}.g.vcf.gz") , emit: gvcf + tuple val(meta), path("${prefix}.g.vcf.gz.tbi"), emit: gvcf_tbi + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -33,9 +34,6 @@ process DEEPVARIANT_RUNDEEPVARIANT { prefix = task.ext.prefix ?: "${meta.id}" def regions = intervals ? "--regions=${intervals}" : "" def par_regions = par_bed ? "--par_regions_bed=${par_bed}" : "" - // WARN https://github.com/nf-core/modules/pull/5801#issuecomment-2194293755 - // FIXME Revert this on next version bump - def VERSION = '1.6.1' """ /opt/deepvariant/bin/run_deepvariant \\ @@ -51,7 +49,7 @@ process DEEPVARIANT_RUNDEEPVARIANT { cat <<-END_VERSIONS > versions.yml "${task.process}": - deepvariant: $VERSION + deepvariant: \$(echo \$(/opt/deepvariant/bin/run_deepvariant --version) | sed 's/^.*version //; s/ .*\$//' ) END_VERSIONS """ @@ -61,18 +59,15 @@ process DEEPVARIANT_RUNDEEPVARIANT { error "DEEPVARIANT module does not support Conda. Please use Docker / Singularity / Podman instead." } prefix = task.ext.prefix ?: "${meta.id}" - // WARN https://github.com/nf-core/modules/pull/5801#issuecomment-2194293755 - // FIXME Revert this on next version bump - def VERSION = '1.6.1' """ - touch ${prefix}.vcf.gz + echo "" | gzip > ${prefix}.vcf.gz touch ${prefix}.vcf.gz.tbi - touch ${prefix}.g.vcf.gz + echo "" | gzip > ${prefix}.g.vcf.gz touch ${prefix}.g.vcf.gz.tbi cat <<-END_VERSIONS > versions.yml "${task.process}": - deepvariant: $VERSION + deepvariant: \$(echo \$(/opt/deepvariant/bin/run_deepvariant --version) | sed 's/^.*version //; s/ .*\$//' ) END_VERSIONS """ } diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap index 1ec351eecc..8e836336da 100644 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap +++ b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap @@ -8,7 +8,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" ] ], "1": [ @@ -17,7 +17,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" ] ], "2": [ @@ -26,7 +26,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" ] ], "3": [ @@ -35,11 +35,11 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" ] ], "4": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ], "gvcf": [ [ @@ -47,7 +47,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" ] ], "gvcf_tbi": [ @@ -56,7 +56,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" ] ], "vcf": [ @@ -65,7 +65,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" ] ], "vcf_tbi": [ @@ -74,19 +74,19 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" ] ], "versions": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-08-29T11:36:27.325363" + "timestamp": "2025-01-14T08:16:22.036932742" }, "homo_sapiens - [bam, bai] - fasta - fai": { "content": [ @@ -97,7 +97,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" ] ], "1": [ @@ -106,7 +106,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" ] ], "2": [ @@ -115,7 +115,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" ] ], "3": [ @@ -124,11 +124,11 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" ] ], "4": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ], "gvcf": [ [ @@ -136,7 +136,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" ] ], "gvcf_tbi": [ @@ -145,7 +145,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" ] ], "vcf": [ @@ -154,7 +154,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" ] ], "vcf_tbi": [ @@ -163,19 +163,19 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" ] ], "versions": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-08-29T11:34:41.779153" + "timestamp": "2025-01-14T08:13:35.621497498" }, "homo_sapiens - [cram, crai, genome_bed] - fasta - fai": { "content": [ @@ -186,7 +186,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" ] ], "1": [ @@ -195,7 +195,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" ] ], "2": [ @@ -204,7 +204,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" ] ], "3": [ @@ -213,11 +213,11 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" ] ], "4": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ], "gvcf": [ [ @@ -225,7 +225,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,0a629e1745926cfcedf4b169046a921a" + "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" ] ], "gvcf_tbi": [ @@ -234,7 +234,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,49503913c28ec70a6f4aa52f6b357b4d" + "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" ] ], "vcf": [ @@ -243,7 +243,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,8b8ab4a675f01e437aa72e1438a717d0" + "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" ] ], "vcf_tbi": [ @@ -252,19 +252,19 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0000833138104e87b05eaa906821eb21" + "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" ] ], "versions": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-08-29T11:35:16.993129" + "timestamp": "2025-01-14T08:14:32.23781232" }, "homo_sapiens - [cram, crai, genome_bed] - fasta - fai - par_bed": { "content": [ @@ -275,7 +275,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,d2e26d65dbbcea9b087ed191b5c9841c" + "test_out.vcf.gz:md5,b79936a7bf53fa4ee7e5866664e37d56" ] ], "1": [ @@ -284,7 +284,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0801296d0356415bbf1ef8deb4ec84c3" + "test_out.vcf.gz.tbi:md5,22f9f4c6c8c1faa8b129eddf32b445b8" ] ], "2": [ @@ -293,7 +293,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,4fcaa9a8b55730d191382160c2b5bb0a" + "test_out.g.vcf.gz:md5,c82ce85ed16dcabe411995c52aaffd85" ] ], "3": [ @@ -302,11 +302,11 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,f468e846904733b3231ecf00ef7cd4a2" + "test_out.g.vcf.gz.tbi:md5,6420a456b0507c70c8423293395c29bc" ] ], "4": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ], "gvcf": [ [ @@ -314,7 +314,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz:md5,4fcaa9a8b55730d191382160c2b5bb0a" + "test_out.g.vcf.gz:md5,c82ce85ed16dcabe411995c52aaffd85" ] ], "gvcf_tbi": [ @@ -323,7 +323,7 @@ "id": "test", "single_end": false }, - "test_out.g.vcf.gz.tbi:md5,f468e846904733b3231ecf00ef7cd4a2" + "test_out.g.vcf.gz.tbi:md5,6420a456b0507c70c8423293395c29bc" ] ], "vcf": [ @@ -332,7 +332,7 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz:md5,d2e26d65dbbcea9b087ed191b5c9841c" + "test_out.vcf.gz:md5,b79936a7bf53fa4ee7e5866664e37d56" ] ], "vcf_tbi": [ @@ -341,18 +341,18 @@ "id": "test", "single_end": false }, - "test_out.vcf.gz.tbi:md5,0801296d0356415bbf1ef8deb4ec84c3" + "test_out.vcf.gz.tbi:md5,22f9f4c6c8c1faa8b129eddf32b445b8" ] ], "versions": [ - "versions.yml:md5,a251d8d9f5e8b737d8298eead96c0890" + "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-08-29T11:35:52.23093" + "timestamp": "2025-01-14T08:15:29.680851997" } } \ No newline at end of file diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml b/modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml deleted file mode 100644 index 958b8e4149..0000000000 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -deepvariant/rundeepvariant: - - modules/nf-core/deepvariant/rundeepvariant/** diff --git a/modules/nf-core/dragmap/align/environment.yml b/modules/nf-core/dragmap/align/environment.yml index 507a1e9327..198f3fa726 100644 --- a/modules/nf-core/dragmap/align/environment.yml +++ b/modules/nf-core/dragmap/align/environment.yml @@ -1,8 +1,10 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - dragmap=1.2.1 - - pigz=2.3.4 - # renovate: datasource=conda depName=bioconda/samtools - - samtools=1.19.2 + # WARN: Do not update this tool to 1.3.0 until https://github.com/Illumina/DRAGMAP/issues/47 is resolved + - bioconda::dragmap=1.2.1 + - bioconda::samtools=1.19.2 + - conda-forge::pigz=2.3.4 diff --git a/modules/nf-core/dragmap/align/main.nf b/modules/nf-core/dragmap/align/main.nf index 30e47992f3..3f6ea75366 100644 --- a/modules/nf-core/dragmap/align/main.nf +++ b/modules/nf-core/dragmap/align/main.nf @@ -1,26 +1,27 @@ process DRAGMAP_ALIGN { - tag "$meta.id" + tag "${meta.id}" label 'process_high' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:df80ed8d23d0a2c43181a2b3dd1b39f2d00fab5c-0': - 'biocontainers/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:df80ed8d23d0a2c43181a2b3dd1b39f2d00fab5c-0' }" + // WARN: Do not update this tool to 1.3.0 until https://github.com/Illumina/DRAGMAP/issues/47 is resolved + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://depot.galaxyproject.org/singularity/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:df80ed8d23d0a2c43181a2b3dd1b39f2d00fab5c-0' + : 'biocontainers/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:df80ed8d23d0a2c43181a2b3dd1b39f2d00fab5c-0'}" input: - tuple val(meta) , path(reads) + tuple val(meta), path(reads) tuple val(meta2), path(hashmap) tuple val(meta3), path(fasta) - val sort_bam + val sort_bam output: - tuple val(meta), path("*.sam") , emit: sam , optional: true - tuple val(meta), path("*.bam") , emit: bam , optional: true - tuple val(meta), path("*.cram") , emit: cram , optional: true - tuple val(meta), path("*.crai") , emit: crai , optional: true - tuple val(meta), path("*.csi") , emit: csi , optional: true - tuple val(meta), path('*.log') , emit: log - path "versions.yml" , emit: versions + tuple val(meta), path("*.sam"), emit: sam, optional: true + tuple val(meta), path("*.bam"), emit: bam, optional: true + tuple val(meta), path("*.cram"), emit: cram, optional: true + tuple val(meta), path("*.crai"), emit: crai, optional: true + tuple val(meta), path("*.csi"), emit: csi, optional: true + tuple val(meta), path('*.log'), emit: log + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when @@ -29,22 +30,24 @@ process DRAGMAP_ALIGN { def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def reads_command = meta.single_end ? "-1 $reads" : "-1 ${reads[0]} -2 ${reads[1]}" - def samtools_command = sort_bam ? 'sort' : 'view' - def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ - def extension_matcher = (args2 =~ extension_pattern) - def extension = extension_matcher.getCount() > 0 ? extension_matcher[0][2].toLowerCase() : "bam" - def reference = fasta && extension=="cram" ? "--reference ${fasta}" : "" - if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" + def reads_command = meta.single_end ? "-1 ${reads}" : "-1 ${reads[0]} -2 ${reads[1]}" + def samtools_command = sort_bam ? 'sort' : 'view' + def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ + def extension_matcher = (args2 =~ extension_pattern) + def extension = extension_matcher.getCount() > 0 ? extension_matcher[0][2].toLowerCase() : "bam" + def reference = fasta && extension == "cram" ? "--reference ${fasta}" : "" + if (!fasta && extension == "cram") { + error("Fasta reference is required for CRAM output") + } """ dragen-os \\ - -r $hashmap \\ - $args \\ - --num-threads $task.cpus \\ - $reads_command \\ + -r ${hashmap} \\ + ${args} \\ + --num-threads ${task.cpus} \\ + ${reads_command} \\ 2> >(tee ${prefix}.dragmap.log >&2) \\ - | samtools $samtools_command $args2 --threads $task.cpus ${reference} -o ${prefix}.${extension} - + | samtools ${samtools_command} ${args2} --threads ${task.cpus} ${reference} -o ${prefix}.${extension} - cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -55,21 +58,20 @@ process DRAGMAP_ALIGN { """ stub: - def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def reads_command = meta.single_end ? "-1 $reads" : "-1 ${reads[0]} -2 ${reads[1]}" - def samtools_command = sort_bam ? 'sort' : 'view' def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ - def extension_matcher = (args2 =~ extension_pattern) + def extension_matcher = (args2 =~ extension_pattern) def extension = extension_matcher.getCount() > 0 ? extension_matcher[0][2].toLowerCase() : "bam" - def reference = fasta && extension=="cram" ? "--reference ${fasta}" : "" - if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" + if (!fasta && extension == "cram") { + error("Fasta reference is required for CRAM output") + } def create_index = "" if (extension == "cram") { create_index = "touch ${prefix}.crai" - } else if (extension == "bam") { + } + else if (extension == "bam") { create_index = "touch ${prefix}.csi" } diff --git a/modules/nf-core/dragmap/align/tests/main.nf.test b/modules/nf-core/dragmap/align/tests/main.nf.test index d688c291c1..5abe76f6a7 100644 --- a/modules/nf-core/dragmap/align/tests/main.nf.test +++ b/modules/nf-core/dragmap/align/tests/main.nf.test @@ -40,12 +40,13 @@ nextflow_process { } then { + assert { process.success } assertAll ( - { assert process.success }, { assert snapshot( file(process.out.bam[0][1]).name, file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - file(process.out.versions[0]).name + process.out.versions, + path(process.out.versions[0]).yaml ).match() } ) } @@ -83,12 +84,13 @@ nextflow_process { } then { + assert { process.success } assertAll ( - { assert process.success }, { assert snapshot( file(process.out.bam[0][1]).name, file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - file(process.out.versions[0]).name + process.out.versions, + path(process.out.versions[0]).yaml ).match() } ) } @@ -129,12 +131,13 @@ nextflow_process { } then { + assert { process.success } assertAll ( - { assert process.success }, { assert snapshot( file(process.out.bam[0][1]).name, file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - file(process.out.versions[0]).name + process.out.versions, + path(process.out.versions[0]).yaml ).match() } ) } @@ -175,12 +178,13 @@ nextflow_process { } then { + assert { process.success } assertAll ( - { assert process.success }, { assert snapshot( file(process.out.bam[0][1]).name, file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - file(process.out.versions[0]).name + process.out.versions, + path(process.out.versions[0]).yaml ).match() } ) } @@ -221,12 +225,13 @@ nextflow_process { } then { + assert { process.success } assertAll ( - { assert process.success }, { assert snapshot( file(process.out.bam[0][1]).name, file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - file(process.out.versions[0]).name + process.out.versions, + path(process.out.versions[0]).yaml ).match() } ) } @@ -268,16 +273,13 @@ nextflow_process { } then { + assert { process.success } assertAll ( - { assert process.success }, { assert snapshot( - file(process.out.bam[0][1]).name, - file(process.out.log[0][1]).name, - file(process.out.versions[0]).name + process.out, + path(process.out.versions[0]).yaml ).match() } ) } - } - } diff --git a/modules/nf-core/dragmap/align/tests/main.nf.test.snap b/modules/nf-core/dragmap/align/tests/main.nf.test.snap index 4bd60ebf49..9a63fde007 100644 --- a/modules/nf-core/dragmap/align/tests/main.nf.test.snap +++ b/modules/nf-core/dragmap/align/tests/main.nf.test.snap @@ -10,13 +10,22 @@ "decompHashTableAutoHits...", "decompHashTableSetFlags..." ], - "versions.yml" + [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ], + { + "DRAGMAP_ALIGN": { + "dragmap": "1.2.1", + "samtools": "1.19.2", + "pigz": "2.3.4" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-03-20T10:46:54.961203552" + "timestamp": "2025-04-10T11:33:50.428894432" }, "homo_sapiens - [fastq1, fastq2], hashtable, fasta, true": { "content": [ @@ -29,13 +38,22 @@ "decompHashTableAutoHits...", "decompHashTableSetFlags..." ], - "versions.yml" + [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ], + { + "DRAGMAP_ALIGN": { + "dragmap": "1.2.1", + "samtools": "1.19.2", + "pigz": "2.3.4" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-03-20T10:47:24.495131137" + "timestamp": "2025-04-10T11:34:27.492548556" }, "sarscov2 - fastq, hashtable, fasta, true": { "content": [ @@ -48,13 +66,22 @@ "decompHashTableAutoHits...", "decompHashTableSetFlags..." ], - "versions.yml" + [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ], + { + "DRAGMAP_ALIGN": { + "dragmap": "1.2.1", + "samtools": "1.19.2", + "pigz": "2.3.4" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-03-20T10:46:42.57679755" + "timestamp": "2025-04-10T11:33:39.843877739" }, "sarscov2 - [fastq1, fastq2], hashtable, fasta, true": { "content": [ @@ -67,25 +94,118 @@ "decompHashTableAutoHits...", "decompHashTableSetFlags..." ], - "versions.yml" + [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ], + { + "DRAGMAP_ALIGN": { + "dragmap": "1.2.1", + "samtools": "1.19.2", + "pigz": "2.3.4" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-03-20T10:47:08.943445149" + "timestamp": "2025-04-10T11:34:00.702498161" }, "sarscov2 - [fastq1, fastq2], hashtable, fasta, true - stub": { "content": [ - "test.bam", - "test.log", - "versions.yml" + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + + ], + "versions": [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ] + }, + { + "DRAGMAP_ALIGN": { + "dragmap": "1.2.1", + "samtools": "1.19.2", + "pigz": "2.3.4" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-03-20T10:47:38.346392133" + "timestamp": "2025-04-10T11:13:17.187912755" }, "sarscov2 - fastq, hashtable, fasta, false": { "content": [ @@ -98,12 +218,21 @@ "decompHashTableAutoHits...", "decompHashTableSetFlags..." ], - "versions.yml" + [ + "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" + ], + { + "DRAGMAP_ALIGN": { + "dragmap": "1.2.1", + "samtools": "1.19.2", + "pigz": "2.3.4" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-03-20T10:46:28.406548681" + "timestamp": "2025-04-10T11:33:28.056988229" } } \ No newline at end of file diff --git a/modules/nf-core/dragmap/align/tests/tags.yml b/modules/nf-core/dragmap/align/tests/tags.yml deleted file mode 100644 index a2a388af37..0000000000 --- a/modules/nf-core/dragmap/align/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -dragmap/align: - - modules/nf-core/dragmap/align/** diff --git a/modules/nf-core/dragmap/hashtable/environment.yml b/modules/nf-core/dragmap/hashtable/environment.yml index 9adca49bae..8225f820ca 100644 --- a/modules/nf-core/dragmap/hashtable/environment.yml +++ b/modules/nf-core/dragmap/hashtable/environment.yml @@ -1,5 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: + # WARN: Do not update this tool to 1.3.0 until https://github.com/Illumina/DRAGMAP/issues/47 is resolved - bioconda::dragmap=1.2.1 diff --git a/modules/nf-core/dragmap/hashtable/main.nf b/modules/nf-core/dragmap/hashtable/main.nf index d7f0692061..e86b110094 100644 --- a/modules/nf-core/dragmap/hashtable/main.nf +++ b/modules/nf-core/dragmap/hashtable/main.nf @@ -1,18 +1,19 @@ process DRAGMAP_HASHTABLE { - tag "$fasta" + tag "${fasta}" label 'process_high' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/dragmap:1.2.1--h72d16da_1': - 'biocontainers/dragmap:1.2.1--h72d16da_1' }" + // WARN: Do not update this tool to 1.3.0 until https://github.com/Illumina/DRAGMAP/issues/47 is resolved + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://depot.galaxyproject.org/singularity/dragmap:1.2.1--h72d16da_1' + : 'biocontainers/dragmap:1.2.1--h72d16da_1'}" input: tuple val(meta), path(fasta) output: - tuple val(meta), path("dragmap") , emit: hashmap - path "versions.yml" , emit: versions + tuple val(meta), path("dragmap"), emit: hashmap + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when @@ -23,10 +24,10 @@ process DRAGMAP_HASHTABLE { mkdir dragmap dragen-os \\ --build-hash-table true \\ - --ht-reference $fasta \\ + --ht-reference ${fasta} \\ --output-directory dragmap \\ - $args \\ - --ht-num-threads $task.cpus + ${args} \\ + --ht-num-threads ${task.cpus} cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -43,5 +44,4 @@ process DRAGMAP_HASHTABLE { dragmap: \$(echo \$(dragen-os --version 2>&1)) END_VERSIONS """ - } diff --git a/modules/nf-core/dragmap/hashtable/tests/main.nf.test b/modules/nf-core/dragmap/hashtable/tests/main.nf.test index 474039911f..f22b453feb 100644 --- a/modules/nf-core/dragmap/hashtable/tests/main.nf.test +++ b/modules/nf-core/dragmap/hashtable/tests/main.nf.test @@ -23,16 +23,16 @@ nextflow_process { } then { + assert { process.success } assertAll( - { assert process.success }, { assert snapshot( file(process.out.hashmap[0][1]).name, - file(process.out.versions[0]).name + process.out.versions, + path(process.out.versions[0]).yaml ).match() } ) } - } test("sarscov2 - fasta - stub") { @@ -51,19 +51,16 @@ nextflow_process { } then { + assert { process.success } assertAll( - { assert process.success }, { assert snapshot( - file(process.out.hashmap[0][1]).name, - file(process.out.versions[0]).name - ).match() - } + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } // TODO Add test using alt-masked bed file // https://github.com/Illumina/dragmap#build-hash-table-using-an-alt-masked-bed-file - } diff --git a/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap b/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap index 9b4b90d8a3..af7efb419b 100644 --- a/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap +++ b/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap @@ -1,16 +1,62 @@ { "sarscov2 - fasta - stub": { "content": [ - "dragmap", - "versions.yml" + { + "0": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "1": [ + "versions.yml:md5,050c28333b92fac50eec250c28b841d0" + ], + "hashmap": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,050c28333b92fac50eec250c28b841d0" + ] + }, + { + "DRAGMAP_HASHTABLE": { + "dragmap": "1.2.1" + } + } ], - "timestamp": "2023-11-22T13:42:22.53412378" + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-10T11:34:52.49644133" }, "sarscov2 - fasta": { "content": [ "dragmap", - "versions.yml" + [ + "versions.yml:md5,050c28333b92fac50eec250c28b841d0" + ], + { + "DRAGMAP_HASHTABLE": { + "dragmap": "1.2.1" + } + } ], - "timestamp": "2023-11-22T12:53:25.493202451" + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-10T11:34:44.786652653" } } \ No newline at end of file diff --git a/modules/nf-core/dragmap/hashtable/tests/tags.yml b/modules/nf-core/dragmap/hashtable/tests/tags.yml deleted file mode 100644 index cd26117b29..0000000000 --- a/modules/nf-core/dragmap/hashtable/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -dragmap/hashtable: - - modules/nf-core/dragmap/hashtable/** diff --git a/modules/nf-core/ensemblvep/download/environment.yml b/modules/nf-core/ensemblvep/download/environment.yml index cac59e8820..ca3c7434b7 100644 --- a/modules/nf-core/ensemblvep/download/environment.yml +++ b/modules/nf-core/ensemblvep/download/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::ensembl-vep=113.0 + - bioconda::ensembl-vep=113.4 diff --git a/modules/nf-core/ensemblvep/download/main.nf b/modules/nf-core/ensemblvep/download/main.nf index 0664a2dfb9..bed8c858b4 100644 --- a/modules/nf-core/ensemblvep/download/main.nf +++ b/modules/nf-core/ensemblvep/download/main.nf @@ -4,8 +4,8 @@ process ENSEMBLVEP_DOWNLOAD { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ensembl-vep:113.0--pl5321h2a3209d_0' : - 'biocontainers/ensembl-vep:113.0--pl5321h2a3209d_0' }" + 'https://depot.galaxyproject.org/singularity/ensembl-vep:113.4--pl5321h2a3209d_0' : + 'biocontainers/ensembl-vep:113.4--pl5321h2a3209d_0' }" input: tuple val(meta), val(assembly), val(species), val(cache_version) diff --git a/modules/nf-core/ensemblvep/download/tests/tags.yml b/modules/nf-core/ensemblvep/download/tests/tags.yml deleted file mode 100644 index 26671f3d31..0000000000 --- a/modules/nf-core/ensemblvep/download/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -ensemblvep/download: - - "modules/nf-core/ensemblvep/download/**" diff --git a/modules/nf-core/ensemblvep/vep/environment.yml b/modules/nf-core/ensemblvep/vep/environment.yml index cac59e8820..ca3c7434b7 100644 --- a/modules/nf-core/ensemblvep/vep/environment.yml +++ b/modules/nf-core/ensemblvep/vep/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::ensembl-vep=113.0 + - bioconda::ensembl-vep=113.4 diff --git a/modules/nf-core/ensemblvep/vep/main.nf b/modules/nf-core/ensemblvep/vep/main.nf index 7bd74fc4ae..b57c236d04 100644 --- a/modules/nf-core/ensemblvep/vep/main.nf +++ b/modules/nf-core/ensemblvep/vep/main.nf @@ -4,8 +4,8 @@ process ENSEMBLVEP_VEP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ensembl-vep:113.0--pl5321h2a3209d_0' : - 'biocontainers/ensembl-vep:113.0--pl5321h2a3209d_0' }" + 'https://depot.galaxyproject.org/singularity/ensembl-vep:113.4--pl5321h2a3209d_0' : + 'biocontainers/ensembl-vep:113.4--pl5321h2a3209d_0' }" input: tuple val(meta), path(vcf), path(custom_extra_files) diff --git a/modules/nf-core/ensemblvep/vep/tests/tags.yml b/modules/nf-core/ensemblvep/vep/tests/tags.yml deleted file mode 100644 index 4aa4aa458a..0000000000 --- a/modules/nf-core/ensemblvep/vep/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -ensemblvep/vep: - - "modules/nf-core/ensemblvep/vep/**" diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml index 26d4aca5dd..90adcd2c52 100644 --- a/modules/nf-core/fastp/environment.yml +++ b/modules/nf-core/fastp/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::fastp=0.23.4 + - bioconda::fastp=0.24.0 diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index e1b9f56560..1342741d53 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -4,8 +4,8 @@ process FASTP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' : - 'biocontainers/fastp:0.23.4--h5f740d0_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/88/889a182b8066804f4799f3808a5813ad601381a8a0e3baa4ab8d73e739b97001/data' : + 'community.wave.seqera.io/library/fastp:0.24.0--62c97b06e8447690' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index 159404d08d..9c4b245844 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -30,8 +30,9 @@ input: pattern: "*.{fasta,fna,fas,fa}" - - discard_trimmed_pass: type: boolean - description: Specify true to not write any reads that pass trimming thresholds. - | This can be used to use fastp for the output report only. + description: | + Specify true to not write any reads that pass trimming thresholds. + This can be used to use fastp for the output report only. - - save_trimmed_fail: type: boolean description: Specify true to save files that failed to pass trimming thresholds diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap index 54be7e45f7..9e2aaf3158 100644 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -39,7 +39,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -78,15 +78,15 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T14:31:10.841098" + "timestamp": "2025-03-31T13:40:51.8619133" }, "test_fastp_paired_end": { "content": [ @@ -96,7 +96,7 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + "test.fastp.json:md5,7cf3bff1922b512bcca58439eb2d3679" ] ], [ @@ -118,14 +118,14 @@ ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:43:28.665779" + "timestamp": "2025-03-31T13:39:15.121411815" }, "test_fastp_paired_end_merged_adapterlist": { "content": [ @@ -135,7 +135,7 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6" + "test.fastp.json:md5,533983f8c11cc3f2ccdcea01531f68ae" ] ], [ @@ -163,14 +163,14 @@ ] ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:44:18.210375" + "timestamp": "2025-03-31T13:39:51.561598206" }, "test_fastp_single_end_qc_only": { "content": [ @@ -180,7 +180,7 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a" + "test.fastp.json:md5,93f407199ee8b94c023c291bddfc4dce" ] ], [ @@ -202,14 +202,14 @@ ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:44:27.380974" + "timestamp": "2025-03-31T13:39:56.392912049" }, "test_fastp_paired_end_trim_fail": { "content": [ @@ -247,18 +247,18 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" + "test.fastp.json:md5,5009a892192f2084c2af69c153d88d6c" ] ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:43:58.749589" + "timestamp": "2025-03-31T13:39:38.690242568" }, "fastp - stub test_fastp_interleaved": { "content": [ @@ -306,7 +306,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -351,15 +351,15 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:50:00.270029" + "timestamp": "2025-03-31T13:40:23.678200076" }, "test_fastp_single_end - stub": { "content": [ @@ -407,7 +407,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -452,15 +452,15 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:49:42.502789" + "timestamp": "2025-03-31T13:40:08.756547678" }, "test_fastp_paired_end_merged_adapterlist - stub": { "content": [ @@ -517,7 +517,7 @@ ] ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -571,15 +571,15 @@ ] ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:54:53.458252" + "timestamp": "2025-03-31T13:40:47.596331823" }, "test_fastp_paired_end_merged - stub": { "content": [ @@ -636,7 +636,7 @@ ] ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -690,15 +690,15 @@ ] ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:50:27.689379" + "timestamp": "2025-03-31T13:40:39.962303534" }, "test_fastp_paired_end_merged": { "content": [ @@ -708,7 +708,7 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + "test.fastp.json:md5,8f99097bfa04b629891105b8af9c429f" ] ], [ @@ -736,14 +736,14 @@ ] ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:44:08.68476" + "timestamp": "2025-03-31T13:39:46.300238743" }, "test_fastp_paired_end - stub": { "content": [ @@ -794,7 +794,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -842,15 +842,15 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:49:51.679221" + "timestamp": "2025-03-31T13:40:16.309925689" }, "test_fastp_single_end": { "content": [ @@ -860,7 +860,7 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + "test.fastp.json:md5,81dc86dd695967bb5c015e0a978bf20c" ] ], [ @@ -879,14 +879,14 @@ ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:43:18.834322" + "timestamp": "2025-03-31T13:39:07.133909607" }, "test_fastp_single_end_trim_fail - stub": { "content": [ @@ -940,7 +940,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -991,15 +991,15 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T14:05:36.898142" + "timestamp": "2025-03-31T13:40:28.086573661" }, "test_fastp_paired_end_trim_fail - stub": { "content": [ @@ -1060,7 +1060,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -1118,15 +1118,15 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T14:05:49.212847" + "timestamp": "2025-03-31T13:40:35.606162029" }, "fastp test_fastp_interleaved": { "content": [ @@ -1145,18 +1145,18 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" + "test.fastp.json:md5,101003b8ac634ca5fd381656ac2b8b9f" ] ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:43:38.910832" + "timestamp": "2025-03-31T13:39:23.114582408" }, "test_fastp_single_end_trim_fail": { "content": [ @@ -1166,7 +1166,7 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + "test.fastp.json:md5,d721f75d68a382c819b6499e6325a942" ] ], [ @@ -1191,14 +1191,14 @@ ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:43:48.22378" + "timestamp": "2025-03-31T13:39:30.757538842" }, "test_fastp_paired_end_qc_only": { "content": [ @@ -1208,7 +1208,7 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df" + "test.fastp.json:md5,1ad31d6559ff5d4d275f501f3f5c02b9" ] ], [ @@ -1230,14 +1230,14 @@ ], [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T13:44:36.334938" + "timestamp": "2025-03-31T13:40:01.381972575" }, "test_fastp_paired_end_qc_only - stub": { "content": [ @@ -1279,7 +1279,7 @@ ], "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ], "html": [ [ @@ -1318,14 +1318,14 @@ ], "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-05T14:31:27.096468" + "timestamp": "2025-03-31T13:40:56.392034947" } } \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml deleted file mode 100644 index c1afcce75f..0000000000 --- a/modules/nf-core/fastp/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fastp: - - modules/nf-core/fastp/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml index 691d4c7638..f9f54ee9b4 100644 --- a/modules/nf-core/fastqc/environment.yml +++ b/modules/nf-core/fastqc/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d8989f4812..23e16634c3 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -1,5 +1,5 @@ process FASTQC { - tag "$meta.id" + tag "${meta.id}" label 'process_medium' conda "${moduleDir}/environment.yml" @@ -19,30 +19,30 @@ process FASTQC { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" // Make list of old name and new name pairs to use for renaming in the bash while loop def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } - def rename_to = old_new_pairs*.join(' ').join(' ') - def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') + def rename_to = old_new_pairs*.join(' ').join(' ') + def renamed_files = old_new_pairs.collect{ _old_name, new_name -> new_name }.join(' ') // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label - def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus + def memory_in_mb = task.memory ? task.memory.toUnit('MB') / task.cpus : null // FastQC memory value allowed range (100 - 10000) def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) """ - printf "%s %s\\n" $rename_to | while read old_name new_name; do + printf "%s %s\\n" ${rename_to} | while read old_name new_name; do [ -f "\${new_name}" ] || ln -s \$old_name \$new_name done fastqc \\ - $args \\ - --threads $task.cpus \\ - --memory $fastqc_memory \\ - $renamed_files + ${args} \\ + --threads ${task.cpus} \\ + --memory ${fastqc_memory} \\ + ${renamed_files} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4827da7af2..2b2e62b8ae 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -11,6 +11,7 @@ tools: FastQC gives general quality metrics about your reads. It provides information about the quality score distribution across your reads, the per base sequence content (%A/C/G/T). + You get information about adapter contamination and other overrepresented sequences. homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml deleted file mode 100644 index 7834294ba0..0000000000 --- a/modules/nf-core/fastqc/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fastqc: - - modules/nf-core/fastqc/** diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/environment.yml b/modules/nf-core/fgbio/callmolecularconsensusreads/environment.yml index 6f3c75600d..4ebc0924d7 100644 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/environment.yml +++ b/modules/nf-core/fgbio/callmolecularconsensusreads/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::fgbio=2.2.1 + - bioconda::fgbio=2.4.0 diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/main.nf b/modules/nf-core/fgbio/callmolecularconsensusreads/main.nf index 8a2cdb247e..7d2e660d02 100644 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/main.nf +++ b/modules/nf-core/fgbio/callmolecularconsensusreads/main.nf @@ -4,8 +4,8 @@ process FGBIO_CALLMOLECULARCONSENSUSREADS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fgbio:2.2.1--hdfd78af_0' : - 'biocontainers/fgbio:2.2.1--hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/87/87626ef674e2f19366ae6214575a114fe80ce598e796894820550731706a84be/data' : + 'community.wave.seqera.io/library/fgbio:2.4.0--913bad9d47ff8ddc' }" input: tuple val(meta), path(grouped_bam) diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap b/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap index 088f99238c..e7e4507f2d 100644 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap +++ b/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap @@ -11,7 +11,7 @@ ] ], "1": [ - "versions.yml:md5,8a39cbc62685ce7afb5ae36609898bde" + "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" ], "bam": [ [ @@ -22,15 +22,15 @@ ] ], "versions": [ - "versions.yml:md5,8a39cbc62685ce7afb5ae36609898bde" + "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-17T06:01:29.676084265" + "timestamp": "2024-11-11T12:22:07.722755" }, "homo_sapiens - bam": { "content": [ @@ -44,7 +44,7 @@ ] ], "1": [ - "versions.yml:md5,8a39cbc62685ce7afb5ae36609898bde" + "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" ], "bam": [ [ @@ -55,14 +55,14 @@ ] ], "versions": [ - "versions.yml:md5,8a39cbc62685ce7afb5ae36609898bde" + "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:34:16.47828891" + "timestamp": "2024-11-11T12:21:46.241305" } } \ No newline at end of file diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/tags.yml b/modules/nf-core/fgbio/callmolecularconsensusreads/tests/tags.yml deleted file mode 100644 index 4f9fcbad0f..0000000000 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fgbio/callmolecularconsensusreads: - - "modules/nf-core/fgbio/callmolecularconsensusreads/**" diff --git a/modules/nf-core/fgbio/fastqtobam/environment.yml b/modules/nf-core/fgbio/fastqtobam/environment.yml index 6f3c75600d..4ebc0924d7 100644 --- a/modules/nf-core/fgbio/fastqtobam/environment.yml +++ b/modules/nf-core/fgbio/fastqtobam/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::fgbio=2.2.1 + - bioconda::fgbio=2.4.0 diff --git a/modules/nf-core/fgbio/fastqtobam/main.nf b/modules/nf-core/fgbio/fastqtobam/main.nf index b1c884e863..b4223db0f8 100644 --- a/modules/nf-core/fgbio/fastqtobam/main.nf +++ b/modules/nf-core/fgbio/fastqtobam/main.nf @@ -4,8 +4,8 @@ process FGBIO_FASTQTOBAM { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fgbio:2.2.1--hdfd78af_0' : - 'biocontainers/fgbio:2.2.1--hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/87/87626ef674e2f19366ae6214575a114fe80ce598e796894820550731706a84be/data' : + 'community.wave.seqera.io/library/fgbio:2.4.0--913bad9d47ff8ddc' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap b/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap index fe9c01cdab..dd167b9768 100644 --- a/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap +++ b/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap @@ -6,14 +6,14 @@ ], "test.cram", [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:35:16.955213727" + "timestamp": "2024-11-11T12:23:19.214068" }, "homo_sapiens - fastq1": { "content": [ @@ -22,14 +22,14 @@ ], [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:35:50.320465546" + "timestamp": "2024-11-11T12:23:52.501663" }, "homo_sapiens - [fastq1, fastq2] - default": { "content": [ @@ -38,14 +38,14 @@ ], [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:34:53.093519753" + "timestamp": "2024-11-11T12:23:02.561152" }, "homo_sapiens - [fastq1, fastq2] - umi": { "content": [ @@ -54,14 +54,14 @@ ], [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:36:07.216840033" + "timestamp": "2024-11-11T12:24:09.020635" }, "homo_sapiens - [fastq1, fastq2] - bam": { "content": [ @@ -70,14 +70,14 @@ ], [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:35:33.666898844" + "timestamp": "2024-11-11T12:23:35.97054" }, "homo_sapiens - [fastq1, fastq2] - custom sample": { "content": [ @@ -86,14 +86,14 @@ ], [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:36:24.905643178" + "timestamp": "2024-11-11T12:24:25.692023" }, "homo_sapiens - [fastq1, fastq2] - stub": { "content": [ @@ -102,13 +102,13 @@ ], [ - "versions.yml:md5,f6c3db3a20ce5e11c96e0ddd8ccd51de" + "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:36:38.954087571" + "timestamp": "2024-11-11T12:24:37.828713" } } \ No newline at end of file diff --git a/modules/nf-core/fgbio/fastqtobam/tests/tags.yml b/modules/nf-core/fgbio/fastqtobam/tests/tags.yml deleted file mode 100644 index 0e40ba3563..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fgbio/fastqtobam: - - "modules/nf-core/fgbio/fastqtobam/**" diff --git a/modules/nf-core/fgbio/groupreadsbyumi/environment.yml b/modules/nf-core/fgbio/groupreadsbyumi/environment.yml index 6f3c75600d..4ebc0924d7 100644 --- a/modules/nf-core/fgbio/groupreadsbyumi/environment.yml +++ b/modules/nf-core/fgbio/groupreadsbyumi/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::fgbio=2.2.1 + - bioconda::fgbio=2.4.0 diff --git a/modules/nf-core/fgbio/groupreadsbyumi/main.nf b/modules/nf-core/fgbio/groupreadsbyumi/main.nf index da9bf80ace..c0506c9022 100644 --- a/modules/nf-core/fgbio/groupreadsbyumi/main.nf +++ b/modules/nf-core/fgbio/groupreadsbyumi/main.nf @@ -4,8 +4,8 @@ process FGBIO_GROUPREADSBYUMI { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fgbio:2.2.1--hdfd78af_0' : - 'biocontainers/fgbio:2.2.1--hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/87/87626ef674e2f19366ae6214575a114fe80ce598e796894820550731706a84be/data' : + 'community.wave.seqera.io/library/fgbio:2.4.0--913bad9d47ff8ddc' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/fgbio/groupreadsbyumi/meta.yml b/modules/nf-core/fgbio/groupreadsbyumi/meta.yml index 3e525fd647..c6d588daf1 100644 --- a/modules/nf-core/fgbio/groupreadsbyumi/meta.yml +++ b/modules/nf-core/fgbio/groupreadsbyumi/meta.yml @@ -34,7 +34,7 @@ input: type: string enum: ["Identity", "Edit", "Adjacency", "Paired"] description: | - Reguired argument: defines the UMI assignment strategy. + Required argument: defines the UMI assignment strategy. Must be chosen among: Identity, Edit, Adjacency, Paired. output: - bam: diff --git a/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap b/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap index dc89a622c7..67956c5337 100644 --- a/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap +++ b/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap @@ -21,7 +21,7 @@ ] ], "2": [ - "versions.yml:md5,e293eed3614f921114b3bd5b0e1ada10" + "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" ], "bam": [ [ @@ -42,15 +42,15 @@ ] ], "versions": [ - "versions.yml:md5,e293eed3614f921114b3bd5b0e1ada10" + "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:48:29.108067677" + "timestamp": "2024-11-11T12:25:36.897639" }, "sarscov2 - bam": { "content": [ @@ -74,7 +74,7 @@ ] ], "2": [ - "versions.yml:md5,e293eed3614f921114b3bd5b0e1ada10" + "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" ], "bam": [ [ @@ -95,14 +95,14 @@ ] ], "versions": [ - "versions.yml:md5,e293eed3614f921114b3bd5b0e1ada10" + "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-05-21T10:48:14.269677258" + "timestamp": "2024-11-11T12:25:25.077144" } } \ No newline at end of file diff --git a/modules/nf-core/fgbio/groupreadsbyumi/tests/tags.yml b/modules/nf-core/fgbio/groupreadsbyumi/tests/tags.yml deleted file mode 100644 index 83146c4414..0000000000 --- a/modules/nf-core/fgbio/groupreadsbyumi/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -fgbio/groupreadsbyumi: - - "modules/nf-core/fgbio/groupreadsbyumi/**" diff --git a/modules/nf-core/freebayes/environment.yml b/modules/nf-core/freebayes/environment.yml index 3f59369680..8f1878ef42 100644 --- a/modules/nf-core/freebayes/environment.yml +++ b/modules/nf-core/freebayes/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/freebayes/main.nf b/modules/nf-core/freebayes/main.nf index c07895c051..f68814b3a4 100644 --- a/modules/nf-core/freebayes/main.nf +++ b/modules/nf-core/freebayes/main.nf @@ -9,11 +9,11 @@ process FREEBAYES { input: tuple val(meta), path(input_1), path(input_1_index), path(input_2), path(input_2_index), path(target_bed) - tuple val(ref_meta), path(fasta) - tuple val(ref_idx_meta), path(fasta_fai) - tuple val(samples_meta), path(samples) - tuple val(populations_meta), path(populations) - tuple val(cnv_meta), path(cnv) + tuple val(meta2), path(fasta) + tuple val(meta3), path(fasta_fai) + tuple val(meta4), path(samples) + tuple val(meta5), path(populations) + tuple val(meta6), path(cnv) output: tuple val(meta), path("*.vcf.gz"), emit: vcf diff --git a/modules/nf-core/freebayes/meta.yml b/modules/nf-core/freebayes/meta.yml index 45fc61d5bd..327fe311ef 100644 --- a/modules/nf-core/freebayes/meta.yml +++ b/modules/nf-core/freebayes/meta.yml @@ -44,7 +44,7 @@ input: description: Optional - Limit analysis to targets listed in this BED-format FILE. pattern: "*.bed" - - - ref_meta: + - - meta2: type: map description: | Groovy Map containing reference information. @@ -53,7 +53,7 @@ input: type: file description: reference fasta file pattern: ".{fa,fa.gz,fasta,fasta.gz}" - - - ref_idx_meta: + - - meta3: type: map description: | Groovy Map containing reference information. @@ -62,7 +62,7 @@ input: type: file description: reference fasta file index pattern: "*.{fa,fasta}.fai" - - - samples_meta: + - - meta4: type: map description: | Groovy Map containing meta information for the samples file. @@ -72,7 +72,7 @@ input: description: Optional - Limit analysis to samples listed (one per line) in the FILE. pattern: "*.txt" - - - populations_meta: + - - meta5: type: map description: | Groovy Map containing meta information for the populations file. @@ -82,7 +82,7 @@ input: description: Optional - Each line of FILE should list a sample and a population which it is part of. pattern: "*.txt" - - - cnv_meta: + - - meta6: type: map description: | Groovy Map containing meta information for the cnv file. diff --git a/modules/nf-core/freebayes/tests/tags.yml b/modules/nf-core/freebayes/tests/tags.yml deleted file mode 100644 index 5563fb3267..0000000000 --- a/modules/nf-core/freebayes/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -freebayes: - - "modules/nf-core/freebayes/**" diff --git a/modules/nf-core/gatk4/applybqsr/environment.yml b/modules/nf-core/gatk4/applybqsr/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/applybqsr/environment.yml +++ b/modules/nf-core/gatk4/applybqsr/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/applybqsr/main.nf b/modules/nf-core/gatk4/applybqsr/main.nf index 4e91c311b0..5267454e8e 100644 --- a/modules/nf-core/gatk4/applybqsr/main.nf +++ b/modules/nf-core/gatk4/applybqsr/main.nf @@ -4,8 +4,8 @@ process GATK4_APPLYBQSR { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input), path(input_index), path(bqsr_table), path(intervals) diff --git a/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap b/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap index 19b37d0636..427cbddb8d 100644 --- a/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap @@ -14,7 +14,7 @@ ], "2": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ], "bam": [ [ @@ -28,15 +28,15 @@ ], "versions": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-20T10:25:00.314573" + "timestamp": "2024-10-31T10:32:45.888751339" }, "sarscov2 - bam - intervals": { "content": [ @@ -46,48 +46,48 @@ { "id": "test" }, - "test.bam:md5,096d269e17f4ae53f765013479240db8" + "test.bam:md5,51259943bca01c92b20fb5b7ac09a246" ] ], "1": [ ], "2": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ], "bam": [ [ { "id": "test" }, - "test.bam:md5,096d269e17f4ae53f765013479240db8" + "test.bam:md5,51259943bca01c92b20fb5b7ac09a246" ] ], "cram": [ ], "versions": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-13T16:21:48.144461" + "timestamp": "2024-10-31T10:31:59.340916681" }, "sarscov2 - cram": { "content": [ [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-13T16:22:09.308602" + "timestamp": "2024-10-31T10:32:16.162569909" }, "test.cram": { "content": [ @@ -114,7 +114,7 @@ ] ], "2": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ], "bam": [ @@ -128,15 +128,15 @@ ] ], "versions": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-20T10:24:52.761169" + "timestamp": "2024-10-31T10:32:34.223186142" }, "sarscov2 - bam": { "content": [ @@ -146,35 +146,35 @@ { "id": "test" }, - "test.bam:md5,022271b9ce0a07579282a2a5c1186513" + "test.bam:md5,213acb451007a0098a6a6a360fa68d72" ] ], "1": [ ], "2": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ], "bam": [ [ { "id": "test" }, - "test.bam:md5,022271b9ce0a07579282a2a5c1186513" + "test.bam:md5,213acb451007a0098a6a6a360fa68d72" ] ], "cram": [ ], "versions": [ - "versions.yml:md5,bb2a060a0280c812fba3c74b1707b350" + "versions.yml:md5,91928754768510a59bde637403ee6a94" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-13T16:21:28.719225" + "timestamp": "2024-10-31T10:31:44.601557038" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/applybqsr/tests/tags.yml b/modules/nf-core/gatk4/applybqsr/tests/tags.yml deleted file mode 100644 index 8da9292df7..0000000000 --- a/modules/nf-core/gatk4/applybqsr/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/applybqsr: - - "modules/nf-core/gatk4/applybqsr/**" diff --git a/modules/nf-core/gatk4/applyvqsr/environment.yml b/modules/nf-core/gatk4/applyvqsr/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/applyvqsr/environment.yml +++ b/modules/nf-core/gatk4/applyvqsr/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/applyvqsr/main.nf b/modules/nf-core/gatk4/applyvqsr/main.nf index 047321b8e9..c8ea3da5bf 100644 --- a/modules/nf-core/gatk4/applyvqsr/main.nf +++ b/modules/nf-core/gatk4/applyvqsr/main.nf @@ -4,8 +4,8 @@ process GATK4_APPLYVQSR { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(vcf), path(vcf_tbi), path(recal), path(recal_index), path(tranches) diff --git a/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap b/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap index ad2fe8be65..1f3e97cbfd 100644 --- a/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap @@ -22,14 +22,14 @@ "versions": { "content": [ [ - "versions.yml:md5,4a6890d486a62ce6f2edfd2f8961da4f" + "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T13:00:49.353138" + "timestamp": "2024-10-31T10:33:41.980566137" }, "human - vcf - stub": { "content": [ @@ -51,7 +51,7 @@ ] ], "2": [ - "versions.yml:md5,4a6890d486a62ce6f2edfd2f8961da4f" + "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" ], "tbi": [ [ @@ -70,26 +70,26 @@ ] ], "versions": [ - "versions.yml:md5,4a6890d486a62ce6f2edfd2f8961da4f" + "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T13:01:24.370421" + "timestamp": "2024-10-31T10:34:08.561335315" }, "versions_allelspecific": { "content": [ [ - "versions.yml:md5,4a6890d486a62ce6f2edfd2f8961da4f" + "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T13:01:08.104194" + "timestamp": "2024-10-31T10:33:56.418381574" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/applyvqsr/tests/tags.yml b/modules/nf-core/gatk4/applyvqsr/tests/tags.yml deleted file mode 100644 index c65706301a..0000000000 --- a/modules/nf-core/gatk4/applyvqsr/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/applyvqsr: - - "modules/nf-core/gatk4/applyvqsr/**" diff --git a/modules/nf-core/gatk4/baserecalibrator/environment.yml b/modules/nf-core/gatk4/baserecalibrator/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/baserecalibrator/environment.yml +++ b/modules/nf-core/gatk4/baserecalibrator/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/baserecalibrator/main.nf b/modules/nf-core/gatk4/baserecalibrator/main.nf index 1a29986265..493533c726 100644 --- a/modules/nf-core/gatk4/baserecalibrator/main.nf +++ b/modules/nf-core/gatk4/baserecalibrator/main.nf @@ -4,16 +4,16 @@ process GATK4_BASERECALIBRATOR { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input), path(input_index), path(intervals) - path fasta - path fai - path dict - path known_sites - path known_sites_tbi + tuple val(meta2), path(fasta) + tuple val(meta3), path(fai) + tuple val(meta4), path(dict) + tuple val(meta5), path(known_sites) + tuple val(meta6), path(known_sites_tbi) output: tuple val(meta), path("*.table"), emit: table diff --git a/modules/nf-core/gatk4/baserecalibrator/meta.yml b/modules/nf-core/gatk4/baserecalibrator/meta.yml index 876b796039..c3caeb8084 100644 --- a/modules/nf-core/gatk4/baserecalibrator/meta.yml +++ b/modules/nf-core/gatk4/baserecalibrator/meta.yml @@ -34,23 +34,48 @@ input: - intervals: type: file description: Bed file with the genomic regions included in the library (optional) - - - fasta: + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome'] + - fasta: type: file description: The reference fasta file pattern: "*.fasta" - - - fai: + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome'] + - fai: type: file description: Index of reference fasta file pattern: "*.fasta.fai" - - - dict: + - - meta4: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome'] + - dict: type: file description: GATK sequence dictionary pattern: "*.dict" - - - known_sites: + - - meta5: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome'] + - known_sites: type: file description: VCF files with known sites for indels / snps (optional) pattern: "*.vcf.gz" - - - known_sites_tbi: + - - meta6: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome'] + - known_sites_tbi: type: file description: Tabix index of the known_sites (optional) pattern: "*.vcf.gz.tbi" diff --git a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test b/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test index fbd91beae2..97c1c1ecb1 100644 --- a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test +++ b/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test @@ -13,18 +13,17 @@ nextflow_process { when { process { """ - input[0] = [ + input[0] = Channel.of([ [ id:'test' ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - input[4] = file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) + input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) """ } } @@ -35,26 +34,23 @@ nextflow_process { { assert snapshot(process.out).match() } ) } - } test("sarscov2 - bam - intervals") { when { process { """ - - input[0] = [ + input[0] = Channel.of([ [ id:'test' ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - input[4] = file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) + input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) """ } } @@ -72,25 +68,23 @@ nextflow_process { when { process { """ - - input[0] = [ + input[0] = Channel.of([ [ id:'test' ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - input[4] = [ + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) - ] - input[5] = [ + ]) + input[5] = Channel.of([ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - + ]) """ } } @@ -101,7 +95,34 @@ nextflow_process { { assert snapshot(process.out).match() } ) } + } + + test("homo_sapiens - cram") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + [] + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)]) + input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)]) + """ + } + } + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } } test("sarscov2 - bam - stub") { @@ -110,17 +131,46 @@ nextflow_process { when { process { """ - input[0] = [ + input[0] = Channel.of([ [ id:'test' ], // meta map - [], - [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), [] - ] - input[1] = [] - input[2] = [] - input[3] = [] - input[4] = [] - input[5] = [] + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) + input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 - bam - intervals - stub") { + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) + input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) """ } } @@ -134,22 +184,58 @@ nextflow_process { } - test("homo_sapiens - cram ") { + test("sarscov2 - bam - multiple sites - stub") { + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) + ]) + input[5] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - cram - stub") { + options "-stub" when { process { """ - input[0] = [ + input[0] = Channel.of([ [ id:'test' ], // meta map file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true) + ]) + input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)]) + input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)]) + input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)]) + input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)]) """ } } @@ -160,7 +246,5 @@ nextflow_process { { assert snapshot(process.out).match() } ) } - } - } diff --git a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap b/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap index 8291304ba8..efdf46b3df 100644 --- a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap @@ -1,4 +1,37 @@ { + "homo_sapiens - cram": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,35d89a3811aa31711fc9815b6b80e6ec" + ] + ], + "1": [ + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,35d89a3811aa31711fc9815b6b80e6ec" + ] + ], + "versions": [ + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-01-23T15:37:29.36262858" + }, "sarscov2 - bam - stub": { "content": [ { @@ -11,7 +44,7 @@ ] ], "1": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ], "table": [ [ @@ -22,15 +55,15 @@ ] ], "versions": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-13T16:16:00.04396" + "timestamp": "2024-10-31T10:36:20.634357503" }, "sarscov2 - bam - intervals": { "content": [ @@ -44,7 +77,7 @@ ] ], "1": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ], "table": [ [ @@ -55,15 +88,15 @@ ] ], "versions": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-13T16:15:17.899391" + "timestamp": "2024-10-31T10:35:55.223087741" }, "sarscov2 - bam - multiple sites": { "content": [ @@ -77,7 +110,7 @@ ] ], "1": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ], "table": [ [ @@ -88,17 +121,17 @@ ] ], "versions": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-13T16:15:47.770383" + "timestamp": "2024-10-31T10:36:10.08523788" }, - "homo_sapiens - cram ": { + "homo_sapiens - cram - stub": { "content": [ { "0": [ @@ -106,30 +139,30 @@ { "id": "test" }, - "test.table:md5,35d89a3811aa31711fc9815b6b80e6ec" + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "1": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ], "table": [ [ { "id": "test" }, - "test.table:md5,35d89a3811aa31711fc9815b6b80e6ec" + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "versions": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-02-13T16:16:42.135898" + "timestamp": "2025-01-23T15:38:23.045092592" }, "sarscov2 - bam": { "content": [ @@ -143,7 +176,7 @@ ] ], "1": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ], "table": [ [ @@ -154,14 +187,80 @@ ] ], "versions": [ - "versions.yml:md5,4ff697a3a05bb4d30701e6750c246ed2" + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-10-31T10:35:41.89476551" + }, + "sarscov2 - bam - intervals - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-01-23T15:37:56.722728282" + }, + "sarscov2 - bam - multiple sites - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-02-13T16:14:57.629443" + "timestamp": "2025-01-23T15:38:09.797767675" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/baserecalibrator/tests/tags.yml b/modules/nf-core/gatk4/baserecalibrator/tests/tags.yml deleted file mode 100644 index 648b462695..0000000000 --- a/modules/nf-core/gatk4/baserecalibrator/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/baserecalibrator: - - "modules/nf-core/gatk4/baserecalibrator/**" diff --git a/modules/nf-core/gatk4/calculatecontamination/environment.yml b/modules/nf-core/gatk4/calculatecontamination/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/calculatecontamination/environment.yml +++ b/modules/nf-core/gatk4/calculatecontamination/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/calculatecontamination/main.nf b/modules/nf-core/gatk4/calculatecontamination/main.nf index 1ca3fd9d45..20fe3c5e13 100644 --- a/modules/nf-core/gatk4/calculatecontamination/main.nf +++ b/modules/nf-core/gatk4/calculatecontamination/main.nf @@ -4,8 +4,8 @@ process GATK4_CALCULATECONTAMINATION { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(pileup), path(matched) diff --git a/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap b/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap index 5c2930f948..756c2452f8 100644 --- a/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap @@ -2,38 +2,38 @@ "versions_pair": { "content": [ [ - "versions.yml:md5,4a72b1da18f7045d470225881e7266a6" + "versions.yml:md5,05685d2e6a839916a120c07b4db98914" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T11:08:17.057861" + "timestamp": "2024-10-31T10:39:04.844937172" }, "versions": { "content": [ [ - "versions.yml:md5,4a72b1da18f7045d470225881e7266a6" + "versions.yml:md5,05685d2e6a839916a120c07b4db98914" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T11:08:07.193762" + "timestamp": "2024-10-31T10:38:50.36175509" }, "versions_segmentation": { "content": [ [ - "versions.yml:md5,4a72b1da18f7045d470225881e7266a6" + "versions.yml:md5,05685d2e6a839916a120c07b4db98914" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T11:08:26.99069" + "timestamp": "2024-10-31T10:39:22.516513354" }, "segmentation": { "content": [ @@ -75,7 +75,7 @@ ] ], "2": [ - "versions.yml:md5,4a72b1da18f7045d470225881e7266a6" + "versions.yml:md5,05685d2e6a839916a120c07b4db98914" ], "contamination": [ [ @@ -94,15 +94,15 @@ ] ], "versions": [ - "versions.yml:md5,4a72b1da18f7045d470225881e7266a6" + "versions.yml:md5,05685d2e6a839916a120c07b4db98914" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T12:56:14.817045" + "timestamp": "2024-10-31T10:39:40.353818746" }, "human - pileup-table - matched-pair": { "content": [ diff --git a/modules/nf-core/gatk4/calculatecontamination/tests/tags.yml b/modules/nf-core/gatk4/calculatecontamination/tests/tags.yml deleted file mode 100644 index 29acb20487..0000000000 --- a/modules/nf-core/gatk4/calculatecontamination/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/calculatecontamination: - - "modules/nf-core/gatk4/calculatecontamination/**" diff --git a/modules/nf-core/gatk4/cnnscorevariants/README.md b/modules/nf-core/gatk4/cnnscorevariants/README.md deleted file mode 100644 index c6a4545655..0000000000 --- a/modules/nf-core/gatk4/cnnscorevariants/README.md +++ /dev/null @@ -1,9 +0,0 @@ -# Conda is not supported at the moment - -The [bioconda](https://bioconda.github.io/recipes/gatk4/README.html) recipe is not fully working as expected, cf [github issue](https://github.com/broadinstitute/gatk/issues/7811) - -Hence, we are using the docker container provided by the authors of the tool: - -- [broadinstitute/gatk](https://hub.docker.com/r/broadinstitute/gatk) - -This image is mirrored on the [nf-core quay.io](https://quay.io/repository/nf-core/gatk) for convenience. diff --git a/modules/nf-core/gatk4/cnnscorevariants/environment.yml b/modules/nf-core/gatk4/cnnscorevariants/environment.yml new file mode 100644 index 0000000000..da693d88d5 --- /dev/null +++ b/modules/nf-core/gatk4/cnnscorevariants/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.5.0.0 diff --git a/modules/nf-core/gatk4/cnnscorevariants/main.nf b/modules/nf-core/gatk4/cnnscorevariants/main.nf index 92de2267e0..5ff13b41d1 100644 --- a/modules/nf-core/gatk4/cnnscorevariants/main.nf +++ b/modules/nf-core/gatk4/cnnscorevariants/main.nf @@ -28,10 +28,10 @@ process GATK4_CNNSCOREVARIANTS { } def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def aligned_input = aligned_input ? "--input $aligned_input" : "" + def aligned_input_cmd = aligned_input ? "--input $aligned_input" : "" def interval_command = intervals ? "--intervals $intervals" : "" - def architecture = architecture ? "--architecture $architecture" : "" - def weights = weights ? "--weights $weights" : "" + def architecture_cmd = architecture ? "--architecture $architecture" : "" + def weights_cmd = weights ? "--weights $weights" : "" def avail_mem = 3072 if (!task.memory) { @@ -48,9 +48,9 @@ process GATK4_CNNSCOREVARIANTS { --output ${prefix}.cnn.vcf.gz \\ --reference $fasta \\ $interval_command \\ - $aligned_input \\ - $architecture \\ - $weights \\ + $aligned_input_cmd \\ + $architecture_cmd \\ + $weights_cmd \\ --tmp-dir . \\ $args @@ -59,4 +59,17 @@ process GATK4_CNNSCOREVARIANTS { gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + echo "" | gzip -c > ${prefix}.cnn.vcf.gz + touch ${prefix}.cnn.vcf.gz.tbi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test b/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test new file mode 100644 index 0000000000..db58bf421c --- /dev/null +++ b/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test @@ -0,0 +1,77 @@ +nextflow_process { + + name "Test Process GATK4_CNNSCOREVARIANTS" + script "../main.nf" + process "GATK4_CNNSCOREVARIANTS" + + tag "modules" + tag "modules_nfcore" + tag "gatk4" + tag "gatk4/cnnscorevariants" + + test("homo sapiens - vcf") { + when { + process { + """ + input_vcf = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi", checkIfExists: true), + [], + [] + ] + fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) + fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) + dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) + + input = [input_vcf, fasta, fai, dict, [], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.versions, + path(process.out.vcf[0][1]).vcf.variantsMD5, + file(process.out.tbi[0][1]).name, + ).match() } + ) + } + + } + + test("homo sapiens - vcf - stub") { + + options "-stub" + + when { + process { + """ + input_vcf = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi", checkIfExists: true), + [], + [] + ] + fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) + fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) + dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) + + input = [input_vcf, fasta, fai, dict, [], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap b/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap new file mode 100644 index 0000000000..63be00cfee --- /dev/null +++ b/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap @@ -0,0 +1,65 @@ +{ + "homo sapiens - vcf": { + "content": [ + [ + "versions.yml:md5,7e0d98246eb35725469a53e6fb8acfbf" + ], + "34e15624519ba7408d53cb8bb365ffc1", + "test.cnn.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-18T09:39:27.896072791" + }, + "homo sapiens - vcf - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.cnn.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.cnn.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,7e0d98246eb35725469a53e6fb8acfbf" + ], + "tbi": [ + [ + { + "id": "test" + }, + "test.cnn.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "vcf": [ + [ + { + "id": "test" + }, + "test.cnn.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,7e0d98246eb35725469a53e6fb8acfbf" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-06T10:46:55.099673108" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4/createsequencedictionary/environment.yml b/modules/nf-core/gatk4/createsequencedictionary/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/createsequencedictionary/environment.yml +++ b/modules/nf-core/gatk4/createsequencedictionary/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/createsequencedictionary/main.nf b/modules/nf-core/gatk4/createsequencedictionary/main.nf index c7f1d75b3c..998622a065 100644 --- a/modules/nf-core/gatk4/createsequencedictionary/main.nf +++ b/modules/nf-core/gatk4/createsequencedictionary/main.nf @@ -1,11 +1,11 @@ process GATK4_CREATESEQUENCEDICTIONARY { tag "$fasta" - label 'process_medium' + label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap b/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap index 16735f9549..e8a600fd11 100644 --- a/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap @@ -11,7 +11,7 @@ ] ], "1": [ - "versions.yml:md5,e60dd34a71fc2029d81dc67ccb5d6be6" + "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" ], "dict": [ [ @@ -22,15 +22,15 @@ ] ], "versions": [ - "versions.yml:md5,e60dd34a71fc2029d81dc67ccb5d6be6" + "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T10:16:16.34453" + "timestamp": "2024-10-31T10:51:56.155954077" }, "sarscov2 - fasta": { "content": [ @@ -44,7 +44,7 @@ ] ], "1": [ - "versions.yml:md5,e60dd34a71fc2029d81dc67ccb5d6be6" + "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" ], "dict": [ [ @@ -55,14 +55,14 @@ ] ], "versions": [ - "versions.yml:md5,e60dd34a71fc2029d81dc67ccb5d6be6" + "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T13:58:25.822068" + "timestamp": "2024-10-31T10:51:45.562993875" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/createsequencedictionary/tests/tags.yml b/modules/nf-core/gatk4/createsequencedictionary/tests/tags.yml deleted file mode 100644 index 035c5e4c74..0000000000 --- a/modules/nf-core/gatk4/createsequencedictionary/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/createsequencedictionary: - - "modules/nf-core/gatk4/createsequencedictionary/**" diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/environment.yml b/modules/nf-core/gatk4/estimatelibrarycomplexity/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/environment.yml +++ b/modules/nf-core/gatk4/estimatelibrarycomplexity/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/main.nf b/modules/nf-core/gatk4/estimatelibrarycomplexity/main.nf index e0744e16f7..9071279577 100644 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/main.nf +++ b/modules/nf-core/gatk4/estimatelibrarycomplexity/main.nf @@ -1,11 +1,11 @@ process GATK4_ESTIMATELIBRARYCOMPLEXITY { tag "$meta.id" - label 'process_medium' + label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input) @@ -46,4 +46,16 @@ process GATK4_ESTIMATELIBRARYCOMPLEXITY { gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + touch ${prefix}.metrics + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test index e23b65573c..8552ca47dc 100644 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test +++ b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test @@ -75,7 +75,7 @@ nextflow_process { } - test("sarscov2 - bam - stub") { + test("homo sapiens - bam - stub") { options "-stub" diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap index bbcef1471e..73752535e9 100644 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap @@ -3,39 +3,39 @@ "content": [ "test.metrics", [ - "versions.yml:md5,1d9c175d88b6c50c7dc999c1f70261a8" + "versions.yml:md5,a7b6a9d538151a577da5f5727ace31e6" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-03-20T14:41:39.857566" + "timestamp": "2024-10-31T11:01:20.304274717" }, - "sarscov2 - bam - stub": { + "homo sapiens - bam - stub": { "content": [ "test.metrics", [ - "versions.yml:md5,1d9c175d88b6c50c7dc999c1f70261a8" + "versions.yml:md5,a7b6a9d538151a577da5f5727ace31e6" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-03-20T14:27:55.337569" + "timestamp": "2024-11-07T10:17:35.145738139" }, "homo_sapiens - bam": { "content": [ "test.metrics", [ - "versions.yml:md5,1d9c175d88b6c50c7dc999c1f70261a8" + "versions.yml:md5,a7b6a9d538151a577da5f5727ace31e6" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-03-20T14:24:41.460191" + "timestamp": "2024-10-31T11:00:54.378191881" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/tags.yml b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/tags.yml deleted file mode 100644 index 0949d08563..0000000000 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/estimatelibrarycomplexity: - - "modules/nf-core/gatk4/estimatelibrarycomplexity/**" diff --git a/modules/nf-core/gatk4/filtermutectcalls/environment.yml b/modules/nf-core/gatk4/filtermutectcalls/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/filtermutectcalls/environment.yml +++ b/modules/nf-core/gatk4/filtermutectcalls/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/filtermutectcalls/main.nf b/modules/nf-core/gatk4/filtermutectcalls/main.nf index 0532ec0258..d3c5bb5ad7 100644 --- a/modules/nf-core/gatk4/filtermutectcalls/main.nf +++ b/modules/nf-core/gatk4/filtermutectcalls/main.nf @@ -4,8 +4,8 @@ process GATK4_FILTERMUTECTCALLS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(vcf), path(vcf_tbi), path(stats), path(orientationbias), path(segmentation), path(table), val(estimate) diff --git a/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap b/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap index 1c39e3b5d7..28a63357e7 100644 --- a/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap @@ -12,14 +12,14 @@ "versions_with-files": { "content": [ [ - "versions.yml:md5,1e86368bd682668a6777ccf2cfd90689" + "versions.yml:md5,029e46832ac21665f3ba027974061ed0" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T12:45:43.679571" + "timestamp": "2024-10-31T11:04:55.625468064" }, "human - vcf - stub": { "content": [ @@ -49,7 +49,7 @@ ] ], "3": [ - "versions.yml:md5,1e86368bd682668a6777ccf2cfd90689" + "versions.yml:md5,029e46832ac21665f3ba027974061ed0" ], "stats": [ [ @@ -76,39 +76,39 @@ ] ], "versions": [ - "versions.yml:md5,1e86368bd682668a6777ccf2cfd90689" + "versions.yml:md5,029e46832ac21665f3ba027974061ed0" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T12:46:32.666273" + "timestamp": "2024-10-31T11:05:33.111919824" }, "versions_use-val": { "content": [ [ - "versions.yml:md5,1e86368bd682668a6777ccf2cfd90689" + "versions.yml:md5,029e46832ac21665f3ba027974061ed0" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T12:46:03.876073" + "timestamp": "2024-10-31T11:05:19.277193087" }, "versions_base": { "content": [ [ - "versions.yml:md5,1e86368bd682668a6777ccf2cfd90689" + "versions.yml:md5,029e46832ac21665f3ba027974061ed0" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-15T12:47:39.930795" + "timestamp": "2024-10-31T11:04:36.657284567" }, "human - vcf - with-files": { "content": [ diff --git a/modules/nf-core/gatk4/filtermutectcalls/tests/tags.yml b/modules/nf-core/gatk4/filtermutectcalls/tests/tags.yml deleted file mode 100644 index 4473103181..0000000000 --- a/modules/nf-core/gatk4/filtermutectcalls/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/filtermutectcalls: - - "modules/nf-core/gatk4/filtermutectcalls/**" diff --git a/modules/nf-core/gatk4/filtervarianttranches/environment.yml b/modules/nf-core/gatk4/filtervarianttranches/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/filtervarianttranches/environment.yml +++ b/modules/nf-core/gatk4/filtervarianttranches/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/filtervarianttranches/main.nf b/modules/nf-core/gatk4/filtervarianttranches/main.nf index 05489e179b..c5249b7a05 100644 --- a/modules/nf-core/gatk4/filtervarianttranches/main.nf +++ b/modules/nf-core/gatk4/filtervarianttranches/main.nf @@ -4,8 +4,8 @@ process GATK4_FILTERVARIANTTRANCHES { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(vcf), path(tbi), path(intervals) @@ -27,7 +27,7 @@ process GATK4_FILTERVARIANTTRANCHES { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def resources = resources.collect{"--resource $it"}.join(' ') + def resource_list = resources.collect{"--resource $it"}.join(' ') def avail_mem = 3072 if (!task.memory) { @@ -39,7 +39,7 @@ process GATK4_FILTERVARIANTTRANCHES { gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ FilterVariantTranches \\ --variant $vcf \\ - $resources \\ + $resource_list \\ --output ${prefix}.filtered.vcf.gz \\ --tmp-dir . \\ $args @@ -49,4 +49,17 @@ process GATK4_FILTERVARIANTTRANCHES { gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + echo "" | gzip -c > ${prefix}.vcf.gz + touch ${prefix}.vcf.gz.tbi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test b/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test new file mode 100644 index 0000000000..c315ed8fc0 --- /dev/null +++ b/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test @@ -0,0 +1,78 @@ +nextflow_process { + + name "Test Process GATK4_FILTERVARIANTTRANCHES" + script "../main.nf" + config "./nextflow.config" + process "GATK4_FILTERVARIANTTRANCHES" + + tag "modules" + tag "modules_nfcore" + tag "gatk4" + tag "gatk4/filtervarianttranches" + + test("homo sapiens - vcf") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi", checkIfExists: true), + [] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz", checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi", checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) + input[4] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) + input[5] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.versions, + file(process.out.vcf[0][1]).name, + file(process.out.tbi[0][1]).name, + ).match() + } + ) + } + + } + + test("homo sapiens - vcf - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi", checkIfExists: true), + [] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz", checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi", checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) + input[4] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) + input[5] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap b/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap new file mode 100644 index 0000000000..8bc251b61c --- /dev/null +++ b/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap @@ -0,0 +1,65 @@ +{ + "homo sapiens - vcf": { + "content": [ + [ + "versions.yml:md5,bad82b4b3eb370f70925cc069b16b63a" + ], + "test.filtered.vcf.gz", + "test.filtered.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-04T14:45:11.404254527" + }, + "homo sapiens - vcf - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,bad82b4b3eb370f70925cc069b16b63a" + ], + "tbi": [ + [ + { + "id": "test" + }, + "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "vcf": [ + [ + { + "id": "test" + }, + "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,bad82b4b3eb370f70925cc069b16b63a" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-04T14:18:50.66032726" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config b/modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config new file mode 100644 index 0000000000..7a8f0a061b --- /dev/null +++ b/modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + + publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } + + ext.args = "--info-key CNN_1D" +} diff --git a/modules/nf-core/gatk4/gatherbqsrreports/environment.yml b/modules/nf-core/gatk4/gatherbqsrreports/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/gatherbqsrreports/environment.yml +++ b/modules/nf-core/gatk4/gatherbqsrreports/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/gatherbqsrreports/main.nf b/modules/nf-core/gatk4/gatherbqsrreports/main.nf index 79667a2994..fdc5a2a723 100644 --- a/modules/nf-core/gatk4/gatherbqsrreports/main.nf +++ b/modules/nf-core/gatk4/gatherbqsrreports/main.nf @@ -1,11 +1,11 @@ process GATK4_GATHERBQSRREPORTS { tag "$meta.id" - label 'process_medium' + label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(table) diff --git a/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap b/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap index bc5d4bd133..e792d07ec5 100644 --- a/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap @@ -12,7 +12,7 @@ ] ], "1": [ - "versions.yml:md5,413fc0014d5dc41ab67d65f59f61a4a0" + "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" ], "table": [ [ @@ -24,15 +24,15 @@ ] ], "versions": [ - "versions.yml:md5,413fc0014d5dc41ab67d65f59f61a4a0" + "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-26T12:22:34.490694" + "timestamp": "2024-10-31T11:07:33.025431761" }, "test-gatk4-gatherbqsrreports": { "content": [ @@ -47,7 +47,7 @@ ] ], "1": [ - "versions.yml:md5,413fc0014d5dc41ab67d65f59f61a4a0" + "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" ], "table": [ [ @@ -59,14 +59,14 @@ ] ], "versions": [ - "versions.yml:md5,413fc0014d5dc41ab67d65f59f61a4a0" + "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-26T12:22:10.552951" + "timestamp": "2024-10-31T11:07:09.791064374" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/gatherpileupsummaries/environment.yml b/modules/nf-core/gatk4/gatherpileupsummaries/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/gatherpileupsummaries/environment.yml +++ b/modules/nf-core/gatk4/gatherpileupsummaries/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/gatherpileupsummaries/main.nf b/modules/nf-core/gatk4/gatherpileupsummaries/main.nf index bcafd544b4..af397a1a2d 100644 --- a/modules/nf-core/gatk4/gatherpileupsummaries/main.nf +++ b/modules/nf-core/gatk4/gatherpileupsummaries/main.nf @@ -4,8 +4,8 @@ process GATK4_GATHERPILEUPSUMMARIES { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: diff --git a/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap b/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap index fd9f258344..e7094d73f4 100644 --- a/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap @@ -12,7 +12,7 @@ ] ], "1": [ - "versions.yml:md5,d3772ab0d5963a88a2748fd83af76c02" + "versions.yml:md5,585747d3136a5bf0563bbbe229690526" ], "table": [ [ @@ -24,15 +24,15 @@ ] ], "versions": [ - "versions.yml:md5,d3772ab0d5963a88a2748fd83af76c02" + "versions.yml:md5,585747d3136a5bf0563bbbe229690526" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-20T10:44:42.759098" + "timestamp": "2024-10-31T11:08:38.118444526" }, "test-gatk4-gatherpileupsummaries": { "content": [ @@ -47,7 +47,7 @@ ] ], "1": [ - "versions.yml:md5,d3772ab0d5963a88a2748fd83af76c02" + "versions.yml:md5,585747d3136a5bf0563bbbe229690526" ], "table": [ [ @@ -59,14 +59,14 @@ ] ], "versions": [ - "versions.yml:md5,d3772ab0d5963a88a2748fd83af76c02" + "versions.yml:md5,585747d3136a5bf0563bbbe229690526" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-26T12:18:40.835226" + "timestamp": "2024-10-31T11:08:17.759423015" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/genomicsdbimport/environment.yml b/modules/nf-core/gatk4/genomicsdbimport/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/genomicsdbimport/environment.yml +++ b/modules/nf-core/gatk4/genomicsdbimport/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/genomicsdbimport/main.nf b/modules/nf-core/gatk4/genomicsdbimport/main.nf index 6f1d4c5370..90f1200dc7 100644 --- a/modules/nf-core/gatk4/genomicsdbimport/main.nf +++ b/modules/nf-core/gatk4/genomicsdbimport/main.nf @@ -1,11 +1,11 @@ process GATK4_GENOMICSDBIMPORT { tag "$meta.id" - label 'process_medium' + label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(vcf), path(tbi), path(interval_file), val(interval_value), path(wspace) diff --git a/modules/nf-core/gatk4/genomicsdbimport/meta.yml b/modules/nf-core/gatk4/genomicsdbimport/meta.yml index 174ae2eb0a..ba734b288f 100644 --- a/modules/nf-core/gatk4/genomicsdbimport/meta.yml +++ b/modules/nf-core/gatk4/genomicsdbimport/meta.yml @@ -38,7 +38,7 @@ input: pattern: "*.interval_list" - interval_value: type: string - description: if an intervals file has not been spcified, the value enetered + description: if an intervals file has not been specified, the value entered here will be used as an interval via the "-L" argument pattern: "example: chr1:1000-10000" - wspace: diff --git a/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap b/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap index 55ced0d880..cb47a432c9 100644 --- a/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap @@ -3,14 +3,14 @@ "content": [ "test.interval_list:md5,4c85812ac15fc1cd29711a851d23c0bf", [ - "versions.yml:md5,c1233a04213021aa66599a36e0fb28cc" + "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-07-09T10:42:51.836379" + "timestamp": "2024-10-31T11:09:55.9195126" }, "test_gatk4_genomicsdbimport_create_genomicsdb": { "content": [ @@ -22,14 +22,14 @@ "vidmap.json" ], [ - "versions.yml:md5,c1233a04213021aa66599a36e0fb28cc" + "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-07-09T10:42:36.846239" + "timestamp": "2024-10-31T11:09:25.302350893" }, "test_gatk4_genomicsdbimport_update_genomicsdb": { "content": [ @@ -41,14 +41,14 @@ "vidmap.json" ], [ - "versions.yml:md5,c1233a04213021aa66599a36e0fb28cc" + "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-07-09T10:43:09.00769" + "timestamp": "2024-10-31T11:10:13.206208761" }, "test_gatk4_genomicsdbimport_stub": { "content": [ @@ -68,7 +68,7 @@ ], "3": [ - "versions.yml:md5,c1233a04213021aa66599a36e0fb28cc" + "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" ], "genomicsdb": [ [ @@ -85,14 +85,14 @@ ], "versions": [ - "versions.yml:md5,c1233a04213021aa66599a36e0fb28cc" + "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-07-09T10:43:20.921712" + "timestamp": "2024-10-31T11:10:36.510210505" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/genomicsdbimport/tests/tags.yml b/modules/nf-core/gatk4/genomicsdbimport/tests/tags.yml deleted file mode 100644 index 8a0085731f..0000000000 --- a/modules/nf-core/gatk4/genomicsdbimport/tests/tags.yml +++ /dev/null @@ -1,3 +0,0 @@ -gatk4/genomicsdbimport: - - "modules/nf-core/gatk4/genomicsdbimport/**" - - "modules/nf-core/untar/**" diff --git a/modules/nf-core/gatk4/genotypegvcfs/environment.yml b/modules/nf-core/gatk4/genotypegvcfs/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/genotypegvcfs/environment.yml +++ b/modules/nf-core/gatk4/genotypegvcfs/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/genotypegvcfs/main.nf b/modules/nf-core/gatk4/genotypegvcfs/main.nf index f180f74975..dc2813a350 100644 --- a/modules/nf-core/gatk4/genotypegvcfs/main.nf +++ b/modules/nf-core/gatk4/genotypegvcfs/main.nf @@ -1,11 +1,11 @@ process GATK4_GENOTYPEGVCFS { tag "$meta.id" - label 'process_high' + label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input), path(gvcf_index), path(intervals), path(intervals_index) diff --git a/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap b/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap index 1621618e7a..30e2dc1cc6 100644 --- a/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap @@ -18,14 +18,14 @@ ] ], [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-04T14:27:24.926097884" + "timestamp": "2024-10-31T11:16:45.625453031" }, "homo_sapiens - [gvcf, idx, [], []], fasta, fai, dict, [], []": { "content": [ @@ -46,14 +46,14 @@ ] ], [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-04T14:26:24.426228557" + "timestamp": "2024-10-31T11:15:55.296562046" }, "homo_sapiens - [gvcf_gz, tbi, bed, []], fasta, fai, dict, [], []": { "content": [ @@ -74,14 +74,14 @@ ] ], [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-04T14:27:04.179308513" + "timestamp": "2024-10-31T11:16:30.471742609" }, "homo_sapiens - [gvcf_gz, tbi, [], []], fasta, fai, dict, dbsnp, dbsnp_tbi": { "content": [ @@ -102,14 +102,14 @@ ] ], [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-04T14:26:43.9088684" + "timestamp": "2024-10-31T11:16:13.266019505" }, "homo_sapiens - [gvcf, idx, [], []], fasta, fai, dict, [], [] - stub": { "content": [ @@ -131,7 +131,7 @@ ] ], "2": [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ], "tbi": [ [ @@ -150,15 +150,15 @@ ] ], "versions": [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-04T14:19:57.615552867" + "timestamp": "2024-10-31T11:17:19.342242664" }, "homo_sapiens - [gendb, bed, [], []], fasta, fai, dict, [], []": { "content": [ @@ -179,13 +179,13 @@ ] ], [ - "versions.yml:md5,3c16cbf71737813609ad10d901d92ab3" + "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-09-04T14:27:46.189794941" + "timestamp": "2024-10-31T11:17:01.475664058" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/getpileupsummaries/environment.yml b/modules/nf-core/gatk4/getpileupsummaries/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/getpileupsummaries/environment.yml +++ b/modules/nf-core/gatk4/getpileupsummaries/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/getpileupsummaries/main.nf b/modules/nf-core/gatk4/getpileupsummaries/main.nf index 43611271e0..41fd312811 100644 --- a/modules/nf-core/gatk4/getpileupsummaries/main.nf +++ b/modules/nf-core/gatk4/getpileupsummaries/main.nf @@ -4,8 +4,8 @@ process GATK4_GETPILEUPSUMMARIES { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input), path(index), path(intervals) diff --git a/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap b/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap index d9304bcdc5..e44c13bad8 100644 --- a/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap @@ -11,7 +11,7 @@ ] ], "1": [ - "versions.yml:md5,a243840d67560fd6de1209a0aa99401a" + "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" ], "table": [ [ @@ -22,15 +22,15 @@ ] ], "versions": [ - "versions.yml:md5,a243840d67560fd6de1209a0aa99401a" + "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T10:18:25.186463" + "timestamp": "2024-10-31T11:19:28.038865911" }, "human - bam": { "content": [ @@ -40,30 +40,30 @@ { "id": "test" }, - "test.pileups.table:md5,8e0ca6f66e112bd2f7ec1d31a2d62469" + "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" ] ], "1": [ - "versions.yml:md5,a243840d67560fd6de1209a0aa99401a" + "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" ], "table": [ [ { "id": "test" }, - "test.pileups.table:md5,8e0ca6f66e112bd2f7ec1d31a2d62469" + "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" ] ], "versions": [ - "versions.yml:md5,a243840d67560fd6de1209a0aa99401a" + "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T14:14:59.7414" + "timestamp": "2024-10-31T11:18:47.633313304" }, "human - cram": { "content": [ @@ -73,29 +73,29 @@ { "id": "test" }, - "test.pileups.table:md5,8e0ca6f66e112bd2f7ec1d31a2d62469" + "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" ] ], "1": [ - "versions.yml:md5,a243840d67560fd6de1209a0aa99401a" + "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" ], "table": [ [ { "id": "test" }, - "test.pileups.table:md5,8e0ca6f66e112bd2f7ec1d31a2d62469" + "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" ] ], "versions": [ - "versions.yml:md5,a243840d67560fd6de1209a0aa99401a" + "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T14:15:25.680928" + "timestamp": "2024-10-31T11:19:14.207172594" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/getpileupsummaries/tests/tags.yml b/modules/nf-core/gatk4/getpileupsummaries/tests/tags.yml deleted file mode 100644 index bac8007d9e..0000000000 --- a/modules/nf-core/gatk4/getpileupsummaries/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/getpileupsummaries: - - "modules/nf-core/gatk4/getpileupsummaries/**" diff --git a/modules/nf-core/gatk4/haplotypecaller/environment.yml b/modules/nf-core/gatk4/haplotypecaller/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/haplotypecaller/environment.yml +++ b/modules/nf-core/gatk4/haplotypecaller/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/haplotypecaller/main.nf b/modules/nf-core/gatk4/haplotypecaller/main.nf index b2aff48969..1ef76789de 100644 --- a/modules/nf-core/gatk4/haplotypecaller/main.nf +++ b/modules/nf-core/gatk4/haplotypecaller/main.nf @@ -1,11 +1,11 @@ process GATK4_HAPLOTYPECALLER { tag "$meta.id" - label 'process_medium' + label 'process_low' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input), path(input_index), path(intervals), path(dragstr_model) diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap index 0203fcfcf4..e3ba2bdfa9 100644 --- a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap @@ -4,55 +4,55 @@ "test_cram.vcf.gz", "test_cram.vcf.gz.tbi", [ - "versions.yml:md5,05431a0ab28c85412c8b3582e863a7ab" + "versions.yml:md5,2528212fed975c92514cf6641379e878" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-14T09:36:54.158605" + "timestamp": "2024-10-31T11:20:32.392608448" }, "homo_sapiens - [cram, crai] - fasta - fai - dict - sites - sites_tbi": { "content": [ "test_cram_sites.vcf.gz", "test_cram_sites.vcf.gz.tbi", [ - "versions.yml:md5,05431a0ab28c85412c8b3582e863a7ab" + "versions.yml:md5,2528212fed975c92514cf6641379e878" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-14T09:37:13.77024" + "timestamp": "2024-10-31T11:20:49.012555768" }, "homo_sapiens - [bam, bai] - fasta - fai - dict": { "content": [ "test_bam.vcf.gz", "test_bam.vcf.gz.tbi", [ - "versions.yml:md5,05431a0ab28c85412c8b3582e863a7ab" + "versions.yml:md5,2528212fed975c92514cf6641379e878" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-14T09:36:34.77631" + "timestamp": "2024-10-31T11:20:09.342159899" }, "homo_sapiens - [cram, crai, dragstr_model] - fasta - fai - dict - sites - sites_tbi": { "content": [ "test_cram_sites_dragstr.vcf.gz", "test_cram_sites_dragstr.vcf.gz.tbi", [ - "versions.yml:md5,05431a0ab28c85412c8b3582e863a7ab" + "versions.yml:md5,2528212fed975c92514cf6641379e878" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-14T09:37:32.967085" + "timestamp": "2024-10-31T11:21:06.551678783" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml b/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml deleted file mode 100644 index d05bb65548..0000000000 --- a/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/haplotypecaller: - - "modules/nf-core/gatk4/haplotypecaller/**" diff --git a/modules/nf-core/gatk4/intervallisttobed/environment.yml b/modules/nf-core/gatk4/intervallisttobed/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/intervallisttobed/environment.yml +++ b/modules/nf-core/gatk4/intervallisttobed/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff b/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff index 03086949c6..c5b321b292 100644 --- a/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff +++ b/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff @@ -1,10 +1,8 @@ -Changes in module 'nf-core/gatk4/intervallisttobed' -'modules/nf-core/gatk4/intervallisttobed/environment.yml' is unchanged -'modules/nf-core/gatk4/intervallisttobed/meta.yml' is unchanged +Changes in component 'nf-core/gatk4/intervallisttobed' Changes in 'gatk4/intervallisttobed/main.nf': --- modules/nf-core/gatk4/intervallisttobed/main.nf +++ modules/nf-core/gatk4/intervallisttobed/main.nf -@@ -40,4 +40,18 @@ +@@ -52,4 +52,18 @@ gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') END_VERSIONS """ @@ -24,4 +22,8 @@ Changes in 'gatk4/intervallisttobed/main.nf': + """ } +'modules/nf-core/gatk4/intervallisttobed/meta.yml' is unchanged +'modules/nf-core/gatk4/intervallisttobed/environment.yml' is unchanged +'modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap' is unchanged +'modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test' is unchanged ************************************************************ diff --git a/modules/nf-core/gatk4/intervallisttobed/main.nf b/modules/nf-core/gatk4/intervallisttobed/main.nf index 743bb3413a..3d8a4689dc 100644 --- a/modules/nf-core/gatk4/intervallisttobed/main.nf +++ b/modules/nf-core/gatk4/intervallisttobed/main.nf @@ -4,8 +4,8 @@ process GATK4_INTERVALLISTTOBED { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(intervals) @@ -41,6 +41,18 @@ process GATK4_INTERVALLISTTOBED { END_VERSIONS """ + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + touch ${prefix}.bed + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + END_VERSIONS + """ + stub: def prefix = task.ext.prefix ?: "${meta.id}.cram" def metrics = task.ext.metrics ?: "${prefix}.metrics" diff --git a/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test b/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test new file mode 100644 index 0000000000..33bf46fbf1 --- /dev/null +++ b/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test @@ -0,0 +1,58 @@ +nextflow_process { + + name "Test Process GATK4_INTERVALLISTTOBED" + script "../main.nf" + process "GATK4_INTERVALLISTTOBED" + + tag "modules" + tag "modules_nfcore" + tag "gatk4" + tag "gatk4/intervallisttobed" + + test("homo sapiens - bed") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list", checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo sapiens - bed - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list", checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap b/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap new file mode 100644 index 0000000000..0664f5e913 --- /dev/null +++ b/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap @@ -0,0 +1,72 @@ +{ + "homo sapiens - bed": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,9046675d01199fbbee79f2bc1c5dce52" + ] + ], + "1": [ + "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,9046675d01199fbbee79f2bc1c5dce52" + ] + ], + "versions": [ + "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-04T13:44:42.715318379" + }, + "homo sapiens - bed - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-04T13:45:01.440631153" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4/learnreadorientationmodel/environment.yml b/modules/nf-core/gatk4/learnreadorientationmodel/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/learnreadorientationmodel/environment.yml +++ b/modules/nf-core/gatk4/learnreadorientationmodel/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/learnreadorientationmodel/main.nf b/modules/nf-core/gatk4/learnreadorientationmodel/main.nf index a61b292812..86e7daaa6c 100644 --- a/modules/nf-core/gatk4/learnreadorientationmodel/main.nf +++ b/modules/nf-core/gatk4/learnreadorientationmodel/main.nf @@ -4,8 +4,8 @@ process GATK4_LEARNREADORIENTATIONMODEL { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(f1r2) diff --git a/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap b/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap index b829bd9c4a..638e058359 100644 --- a/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap @@ -9,13 +9,13 @@ "CAA\tTTG\t0.0\t3.4445551925564533E-6\t3.435193155024585E-6\t5.139879646597498E-6\t0.0\t3.4674461103560476E-6\t3.428570449688764E-6\t6.343168047383713E-6\t0.9945238954147358\t1.3629167993931722E-4\t0.0052793454402581125\t3.5208652465150646E-5\t29263\t197" ], [ - "versions.yml:md5,88928ff140a0967e574e66944fd2a2f2" + "versions.yml:md5,e8e087001bd49c02f325e90b1fbeb44d" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-08-26T12:16:08.296564" + "timestamp": "2024-10-31T11:24:53.596350009" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/markduplicates/environment.yml b/modules/nf-core/gatk4/markduplicates/environment.yml index 3c73c17e43..8afaba0656 100644 --- a/modules/nf-core/gatk4/markduplicates/environment.yml +++ b/modules/nf-core/gatk4/markduplicates/environment.yml @@ -1,8 +1,12 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 - bioconda::htslib=1.19.1 - bioconda::samtools=1.19.2 diff --git a/modules/nf-core/gatk4/markduplicates/main.nf b/modules/nf-core/gatk4/markduplicates/main.nf index baadefef41..cf770308d5 100644 --- a/modules/nf-core/gatk4/markduplicates/main.nf +++ b/modules/nf-core/gatk4/markduplicates/main.nf @@ -1,6 +1,6 @@ process GATK4_MARKDUPLICATES { tag "$meta.id" - label 'process_medium' + label 'process_low' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? diff --git a/modules/nf-core/gatk4/markduplicates/tests/tags.yml b/modules/nf-core/gatk4/markduplicates/tests/tags.yml deleted file mode 100644 index 8632e32b37..0000000000 --- a/modules/nf-core/gatk4/markduplicates/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/markduplicates: - - "modules/nf-core/gatk4/markduplicates/**" diff --git a/modules/nf-core/gatk4/mergemutectstats/environment.yml b/modules/nf-core/gatk4/mergemutectstats/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/mergemutectstats/environment.yml +++ b/modules/nf-core/gatk4/mergemutectstats/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/mergemutectstats/main.nf b/modules/nf-core/gatk4/mergemutectstats/main.nf index 06bce31e31..e6ddc6994c 100644 --- a/modules/nf-core/gatk4/mergemutectstats/main.nf +++ b/modules/nf-core/gatk4/mergemutectstats/main.nf @@ -4,8 +4,8 @@ process GATK4_MERGEMUTECTSTATS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(stats) @@ -19,7 +19,7 @@ process GATK4_MERGEMUTECTSTATS { script: def args = task.ext.args ?: '' - prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}" def input_list = stats.collect{ "--stats ${it}"}.join(' ') def avail_mem = 3072 diff --git a/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap b/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap index d0279f272e..77da5d7820 100644 --- a/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "versions": { "content": [ [ - "versions.yml:md5,7298d6e6e18024f7c2ed0fe38d259a52" + "versions.yml:md5,2b6e8361dd6734be029e7480dbcb7794" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T10:13:56.2195" + "timestamp": "2024-10-31T11:29:44.84165293" }, "human - stats,tsv - stub": { "content": [ @@ -24,7 +24,7 @@ ] ], "1": [ - "versions.yml:md5,7298d6e6e18024f7c2ed0fe38d259a52" + "versions.yml:md5,2b6e8361dd6734be029e7480dbcb7794" ], "stats": [ [ @@ -36,15 +36,15 @@ ] ], "versions": [ - "versions.yml:md5,7298d6e6e18024f7c2ed0fe38d259a52" + "versions.yml:md5,2b6e8361dd6734be029e7480dbcb7794" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-05-16T10:14:10.058769" + "timestamp": "2024-10-31T11:29:54.48600467" }, "human - stats, tsv": { "content": [ diff --git a/modules/nf-core/gatk4/mergemutectstats/tests/tags.yml b/modules/nf-core/gatk4/mergemutectstats/tests/tags.yml deleted file mode 100644 index b750e551f9..0000000000 --- a/modules/nf-core/gatk4/mergemutectstats/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/mergemutectstats: - - "modules/nf-core/gatk4/mergemutectstats/**" diff --git a/modules/nf-core/gatk4/mergevcfs/environment.yml b/modules/nf-core/gatk4/mergevcfs/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/mergevcfs/environment.yml +++ b/modules/nf-core/gatk4/mergevcfs/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/mergevcfs/main.nf b/modules/nf-core/gatk4/mergevcfs/main.nf index 9e8d43915c..1752f48a60 100644 --- a/modules/nf-core/gatk4/mergevcfs/main.nf +++ b/modules/nf-core/gatk4/mergevcfs/main.nf @@ -1,11 +1,11 @@ process GATK4_MERGEVCFS { tag "$meta.id" - label 'process_medium' + label 'process_low' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(vcf) diff --git a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test b/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test index 77ace10a21..343fff68c9 100644 --- a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test +++ b/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test @@ -24,6 +24,7 @@ nextflow_process { { assert process.success }, { assert snapshot( + process.out.versions, file(process.out.vcf.get(0).get(1)).name, file(process.out.tbi.get(0).get(1)).name ).match("test_gatk4_mergevcfs") @@ -48,6 +49,7 @@ nextflow_process { { assert process.success }, { assert snapshot( + process.out.versions, file(process.out.vcf.get(0).get(1)).name, file(process.out.tbi.get(0).get(1)).name ).match("test_gatk4_mergevcfs_no_dict") @@ -75,6 +77,7 @@ nextflow_process { { assert process.success }, { assert snapshot( + process.out.versions, file(process.out.vcf.get(0).get(1)).name, file(process.out.tbi.get(0).get(1)).name ).match("test_gatk4_mergevcfs_no_dict_stub") diff --git a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap b/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap index 62cceed57b..5fab6dca1b 100644 --- a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap @@ -1,35 +1,44 @@ { "test_gatk4_mergevcfs_no_dict_stub": { "content": [ + [ + "versions.yml:md5,829a91432cc945f3227b1355587d25e0" + ], "test.vcf.gz", "test.vcf.gz.tbi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-14T14:57:40.784590995" + "timestamp": "2024-11-07T08:29:25.813956308" }, "test_gatk4_mergevcfs": { "content": [ + [ + "versions.yml:md5,829a91432cc945f3227b1355587d25e0" + ], "test.vcf.gz", "test.vcf.gz.tbi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-14T14:56:42.178255913" + "timestamp": "2024-11-07T08:28:42.580265083" }, "test_gatk4_mergevcfs_no_dict": { "content": [ + [ + "versions.yml:md5,829a91432cc945f3227b1355587d25e0" + ], "test.vcf.gz", "test.vcf.gz.tbi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.1", + "nextflow": "24.10.0" }, - "timestamp": "2024-02-14T14:57:11.404322124" + "timestamp": "2024-11-07T08:29:12.795329336" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/mergevcfs/tests/tags.yml b/modules/nf-core/gatk4/mergevcfs/tests/tags.yml deleted file mode 100644 index d2a74ba2c9..0000000000 --- a/modules/nf-core/gatk4/mergevcfs/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/mergevcfs: - - "modules/nf-core/gatk4/mergevcfs/**" diff --git a/modules/nf-core/gatk4/mutect2/environment.yml b/modules/nf-core/gatk4/mutect2/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/mutect2/environment.yml +++ b/modules/nf-core/gatk4/mutect2/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/mutect2/main.nf b/modules/nf-core/gatk4/mutect2/main.nf index 79d8d2826c..756dfca942 100644 --- a/modules/nf-core/gatk4/mutect2/main.nf +++ b/modules/nf-core/gatk4/mutect2/main.nf @@ -1,11 +1,11 @@ process GATK4_MUTECT2 { tag "$meta.id" - label 'process_medium' + label 'process_low' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(input), path(input_index), path(intervals) @@ -62,10 +62,10 @@ process GATK4_MUTECT2 { stub: def prefix = task.ext.prefix ?: "${meta.id}" """ - touch ${prefix}.vcf.gz + echo "" | gzip > ${prefix}.vcf.gz touch ${prefix}.vcf.gz.tbi touch ${prefix}.vcf.gz.stats - touch ${prefix}.f1r2.tar.gz + echo "" | gzip > ${prefix}.f1r2.tar.gz cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/gatk4/mutect2/tests/f1r2.config b/modules/nf-core/gatk4/mutect2/tests/f1r2.config deleted file mode 100644 index 2d3c8a1708..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/f1r2.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = { "--normal-sample $meta.normal_id --f1r2-tar-gz ${meta.id}.f1r2.tar.gz" } -} diff --git a/modules/nf-core/gatk4/mutect2/tests/main.nf.test b/modules/nf-core/gatk4/mutect2/tests/main.nf.test index aea8d22694..b0e22144c6 100644 --- a/modules/nf-core/gatk4/mutect2/tests/main.nf.test +++ b/modules/nf-core/gatk4/mutect2/tests/main.nf.test @@ -8,10 +8,13 @@ nextflow_process { tag "modules_nfcore" tag "gatk4" tag "gatk4/mutect2" + config "./nextflow.config" - test("tumor_normal_pair") { - config "./pair.config" + test("human - bam - tumor_normal_pair") { when { + params { + module_args = "--normal-sample normal" + } process { """ input[0] = [ @@ -55,7 +58,7 @@ nextflow_process { { assert process.success }, { assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, + path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, process.out.tbi.collect { file(it[1]).getName() }, process.out.stats, process.out.f1r2, @@ -66,9 +69,12 @@ nextflow_process { } } - test("tumor_normal_pair_f1r2") { - config "./f1r2.config" + test("human - bam - tumor_normal_pair_f1r2") { + when { + params { + module_args = "--normal-sample normal --f1r2-tar-gz test.f1r2.tar.gz" + } process { """ input[0] = [ @@ -111,7 +117,7 @@ nextflow_process { { assert process.success }, { assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, + path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, process.out.tbi.collect { file(it[1]).getName() }, process.out.stats, process.out.f1r2.collect { file(it[1]).getName() }, @@ -121,8 +127,11 @@ nextflow_process { ) } } - test("tumor_single"){ + test("human - bam - tumor_only"){ when { + params { + module_args = '' + } process { """ input[0] = [ @@ -155,7 +164,7 @@ nextflow_process { { assert process.success }, { assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, + path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, process.out.tbi.collect { file(it[1]).getName() }, process.out.stats, process.out.f1r2, @@ -165,8 +174,11 @@ nextflow_process { ) } } - test("cram_input"){ + test("human - cram"){ when { + params { + module_args = '' + } process{ """ input[0] = [ @@ -199,7 +211,7 @@ nextflow_process { { assert process.success }, { assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, + path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, process.out.tbi.collect { file(it[1]).getName() }, process.out.stats, process.out.f1r2, @@ -210,8 +222,11 @@ nextflow_process { } } - test("generate_pon") { + test("human - bam - generate_pon") { when { + params { + module_args = '' + } process { """ input[0] = [ @@ -244,7 +259,7 @@ nextflow_process { { assert process.success }, { assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, + path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, process.out.tbi.collect { file(it[1]).getName() }, process.out.stats, process.out.f1r2, @@ -255,8 +270,11 @@ nextflow_process { } } - test("mitochondria"){ + test("mitochondria - bam"){ when { + params { + module_args = "--mitochondria-mode" + } process { """ input[0] = [ @@ -289,7 +307,7 @@ nextflow_process { { assert process.success }, { assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, + path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, process.out.tbi.collect { file(it[1]).getName() }, process.out.stats, process.out.f1r2, @@ -300,9 +318,14 @@ nextflow_process { } } - test("tumor_normal_pair_f1r2_stubs"){ - options "-stub-run" + test("human - bam - tumor_normal_pair_f1r2 - stub"){ + + options "-stub" + when { + params { + module_args = '' + } process { """ input[0] = [ @@ -343,15 +366,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - process.out.vcf.collect { file(it[1]).getName() }, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats.collect { file(it[1]).getName() }, - process.out.f1r2.collect { file(it[1]).getName() }, - process.out.versions.collect { file(it[1]).getName() } - ).match() - } + { assert snapshot(process.out).match() } ) } diff --git a/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap b/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap index f047af19dd..80d07bccbe 100644 --- a/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap @@ -1,33 +1,34 @@ { - "tumor_normal_pair_f1r2_stubs": { + "human - bam - generate_pon": { "content": [ - [ - "test.vcf.gz" - ], + "876aa6be01c0c8fc71ad8e99ed842240", [ "test.vcf.gz.tbi" ], [ - "test.vcf.gz.stats" + [ + { + "id": "test" + }, + "test.vcf.gz.stats:md5,b569ce66bbffe9588b3d221e821023ee" + ] ], [ - "test.f1r2.tar.gz" + ], [ - "h" + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-21T10:14:45.599103891" + "timestamp": "2025-04-08T15:44:32.616294519" }, - "generate_pon": { + "human - cram": { "content": [ - [ - "test.vcf.gz" - ], + "1b65f1a163b517944bf2e4b74230e035", [ "test.vcf.gz.tbi" ], @@ -36,27 +37,25 @@ { "id": "test" }, - "test.vcf.gz.stats:md5,b569ce66bbffe9588b3d221e821023ee" + "test.vcf.gz.stats:md5,55ed641e16089afb33cdbc478e202d3d" ] ], [ ], [ - "versions.yml:md5,d94731c50c20569fe9896235a843f382" + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-20T15:57:18.264453766" + "timestamp": "2025-04-08T15:42:27.117032089" }, - "mitochondria": { + "mitochondria - bam": { "content": [ - [ - "test.vcf.gz" - ], + "ea70f79e33805a2c0b47b32a48a8d26f", [ "test.vcf.gz.tbi" ], @@ -65,56 +64,54 @@ { "id": "test" }, - "test.vcf.gz.stats:md5,4f77301a125913170b8e9e7828b4ca3f" + "test.vcf.gz.stats:md5,fc6ea14ca2da346babe78161beea28c9" ] ], [ ], [ - "versions.yml:md5,d94731c50c20569fe9896235a843f382" + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-20T16:05:47.668766905" + "timestamp": "2025-04-08T15:44:46.867520687" }, - "cram_input": { + "human - bam - tumor_normal_pair": { "content": [ - [ - "test.vcf.gz" - ], + "7418ed45a029394253817a5eb7149334", [ "test.vcf.gz.tbi" ], [ [ { - "id": "test" + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" }, - "test.vcf.gz.stats:md5,55ed641e16089afb33cdbc478e202d3d" + "test.vcf.gz.stats:md5,17d2091015d04cbd4a26b7a67dc659e6" ] ], [ ], [ - "versions.yml:md5,d94731c50c20569fe9896235a843f382" + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-20T15:52:27.894730554" + "timestamp": "2025-04-08T16:02:48.334206829" }, - "tumor_single": { + "human - bam - tumor_only": { "content": [ - [ - "test.vcf.gz" - ], + "1b65f1a163b517944bf2e4b74230e035", [ "test.vcf.gz.tbi" ], @@ -130,51 +127,115 @@ ], [ - "versions.yml:md5,d94731c50c20569fe9896235a843f382" + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-20T15:43:28.935723443" + "timestamp": "2025-04-08T15:40:12.534802185" }, - "tumor_normal_pair": { + "human - bam - tumor_normal_pair_f1r2 - stub": { "content": [ - [ - "test.vcf.gz" - ], - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.stats:md5,17d2091015d04cbd4a26b7a67dc659e6" + { + "0": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.vcf.gz.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.f1r2.tar.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "4": [ + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" + ], + "f1r2": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.f1r2.tar.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "stats": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.vcf.gz.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tbi": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "vcf": [ + [ + { + "id": "test", + "normal_id": "normal", + "tumor_id": "tumour" + }, + "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] - ], - [ - - ], - [ - "versions.yml:md5,d94731c50c20569fe9896235a843f382" - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-20T15:31:31.913366311" + "timestamp": "2025-04-08T15:44:59.443047344" }, - "tumor_normal_pair_f1r2": { + "human - bam - tumor_normal_pair_f1r2": { "content": [ - [ - "test.vcf.gz" - ], + "7418ed45a029394253817a5eb7149334", [ "test.vcf.gz.tbi" ], @@ -192,13 +253,13 @@ "test.f1r2.tar.gz" ], [ - "versions.yml:md5,d94731c50c20569fe9896235a843f382" + "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-03-21T09:45:52.321385704" + "timestamp": "2025-04-08T16:25:12.434872797" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4/mutect2/tests/mito.config b/modules/nf-core/gatk4/mutect2/tests/mito.config deleted file mode 100644 index de61d3e243..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/mito.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = { "--mitochondria-mode" } -} diff --git a/modules/nf-core/gatk4/mutect2/tests/nextflow.config b/modules/nf-core/gatk4/mutect2/tests/nextflow.config new file mode 100644 index 0000000000..08e9428517 --- /dev/null +++ b/modules/nf-core/gatk4/mutect2/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GATK4_MUTECT2 { + ext.args = params.module_args + } +} diff --git a/modules/nf-core/gatk4/mutect2/tests/pair.config b/modules/nf-core/gatk4/mutect2/tests/pair.config deleted file mode 100644 index 2a812b8254..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/pair.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = { "--normal-sample $meta.normal_id" } -} diff --git a/modules/nf-core/gatk4/mutect2/tests/tags.yml b/modules/nf-core/gatk4/mutect2/tests/tags.yml deleted file mode 100644 index 4618792742..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4/mutect2: - - "modules/nf-core/gatk4/mutect2/**" diff --git a/modules/nf-core/gatk4/variantrecalibrator/environment.yml b/modules/nf-core/gatk4/variantrecalibrator/environment.yml index 55993f440c..b562b72c74 100644 --- a/modules/nf-core/gatk4/variantrecalibrator/environment.yml +++ b/modules/nf-core/gatk4/variantrecalibrator/environment.yml @@ -1,5 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4=4.5.0.0 + # renovate: datasource=conda depName=bioconda/gatk4 + - bioconda::gatk4=4.6.1.0 + - bioconda::gcnvkernel=0.9 diff --git a/modules/nf-core/gatk4/variantrecalibrator/main.nf b/modules/nf-core/gatk4/variantrecalibrator/main.nf index 24844ce0c9..3c6048f4ba 100644 --- a/modules/nf-core/gatk4/variantrecalibrator/main.nf +++ b/modules/nf-core/gatk4/variantrecalibrator/main.nf @@ -4,8 +4,8 @@ process GATK4_VARIANTRECALIBRATOR { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.5.0.0--py36hdfd78af_0': - 'biocontainers/gatk4:4.5.0.0--py36hdfd78af_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': + 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" input: tuple val(meta), path(vcf), path(tbi) // input vcf and tbi of variants to recalibrate diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/AS.config b/modules/nf-core/gatk4/variantrecalibrator/tests/AS.config new file mode 100644 index 0000000000..eadb336e9d --- /dev/null +++ b/modules/nf-core/gatk4/variantrecalibrator/tests/AS.config @@ -0,0 +1,7 @@ +process { + + publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } + withName: GATK4_VARIANTRECALIBRATOR { + ext.args = '-mode SNP -an QD -an MQ -an FS -AS' + } +} diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test b/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test new file mode 100644 index 0000000000..2ce4b46e53 --- /dev/null +++ b/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test @@ -0,0 +1,167 @@ +nextflow_process { + + name "Test Process GATK4_VARIANTRECALIBRATOR" + script "../main.nf" + process "GATK4_VARIANTRECALIBRATOR" + + tag "modules" + tag "modules_nfcore" + tag "gatk4" + tag "gatk4/variantrecalibrator" + + test("homo sapiens - vcf - allele specificity") { + config "./AS.config" + when { + process { + """ + input_vcf = [ [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi", checkIfExists: true) + ] + + resources_vcf = [ + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz", checkIfExists: true) + ] + resources_tbi = [ + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi", checkIfExists: true) + ] + labels = [ + '--resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.hg38.vcf.gz', + '--resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.hg38.vcf.gz', + '--resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.hg38.vcf.gz', + '--resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp_138.hg38.vcf.gz' + ] + + fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta", checkIfExists: true) + fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) + dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.dict", checkIfExists: true) + + input = [input_vcf, resources_vcf, resources_tbi, labels, fasta, fai, dict] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.versions, + file(process.out.recal[0][1]).name, + file(process.out.idx[0][1]).name, + process.out.tranches, + process.out.plots, + ).match() } + ) + } + + } + + test("homo sapiens - vcf - no allele specificity") { + config "./noAS.config" + when { + process { + """ + input_vcf = [ [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi", checkIfExists: true) + ] + + resources_vcf = [ + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz", checkIfExists: true) + ] + resources_tbi = [ + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi", checkIfExists: true) + ] + labels = [ + '--resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.hg38.vcf.gz', + '--resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.hg38.vcf.gz', + '--resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.hg38.vcf.gz', + '--resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp_138.hg38.vcf.gz' + ] + + fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta", checkIfExists: true) + fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) + dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.dict", checkIfExists: true) + + input = [input_vcf, resources_vcf, resources_tbi, labels, fasta, fai, dict] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.versions, + file(process.out.recal[0][1]).name, + file(process.out.idx[0][1]).name, + process.out.tranches, + process.out.plots, + ).match() } + ) + } + + } + + test("homo sapiens - vcf - stub") { + + options "-stub" + + when { + process { + """ + input_vcf = [ [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi", checkIfExists: true) + ] + + resources_vcf = [ + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz", checkIfExists: true) + ] + resources_tbi = [ + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz.tbi", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi", checkIfExists: true) + ] + labels = [ + '--resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.hg38.vcf.gz', + '--resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.hg38.vcf.gz', + '--resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.hg38.vcf.gz', + '--resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp_138.hg38.vcf.gz' + ] + + fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta", checkIfExists: true) + fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) + dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.dict", checkIfExists: true) + + input = [input_vcf, resources_vcf, resources_tbi, labels, fasta, fai, dict] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap b/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap new file mode 100644 index 0000000000..62882f25fa --- /dev/null +++ b/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap @@ -0,0 +1,133 @@ +{ + "homo sapiens - vcf - allele specificity": { + "content": [ + [ + "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" + ], + "test.recal", + "test.recal.idx", + [ + [ + { + "id": "test" + }, + "test.tranches:md5,ad52fa69325c758f458a30ee5b43d6b5" + ] + ], + [ + + ] + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-06T10:19:03.416258473" + }, + "homo sapiens - vcf - no allele specificity": { + "content": [ + [ + "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" + ], + "test.recal", + "test.recal.idx", + [ + [ + { + "id": "test" + }, + "test.tranches:md5,c029e52fd63a893e1154cc9144a19eeb" + ] + ], + [ + + ] + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-06T10:26:53.032044124" + }, + "homo sapiens - vcf - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.recal:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.idx:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "test.tranches:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test" + }, + "testplots.R:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" + ], + "idx": [ + [ + { + "id": "test" + }, + "test.idx:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "plots": [ + [ + { + "id": "test" + }, + "testplots.R:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "recal": [ + [ + { + "id": "test" + }, + "test.recal:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tranches": [ + [ + { + "id": "test" + }, + "test.tranches:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" + ] + } + ], + "meta": { + "nf-test": "0.9.1", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-06T10:14:43.858797367" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config b/modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config new file mode 100644 index 0000000000..69efa09ea8 --- /dev/null +++ b/modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config @@ -0,0 +1,8 @@ +process { + + publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } + + withName: GATK4_VARIANTRECALIBRATOR { + ext.args = '-mode SNP -an QD -an MQ -an FS -an SOR' + } +} diff --git a/modules/nf-core/gatk4spark/applybqsr/environment.yml b/modules/nf-core/gatk4spark/applybqsr/environment.yml index 14075a574a..a5c49e9557 100644 --- a/modules/nf-core/gatk4spark/applybqsr/environment.yml +++ b/modules/nf-core/gatk4spark/applybqsr/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4-spark=4.5.0.0 + - bioconda::gatk4-spark=4.6.1.0 diff --git a/modules/nf-core/gatk4spark/applybqsr/main.nf b/modules/nf-core/gatk4spark/applybqsr/main.nf index 316ddc0b1d..da17760967 100644 --- a/modules/nf-core/gatk4spark/applybqsr/main.nf +++ b/modules/nf-core/gatk4spark/applybqsr/main.nf @@ -1,49 +1,50 @@ process GATK4SPARK_APPLYBQSR { - tag "$meta.id" + tag "${meta.id}" label 'process_low' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4-spark:4.5.0.0--hdfd78af_0': - 'biocontainers/gatk4-spark:4.5.0.0--hdfd78af_0' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://depot.galaxyproject.org/singularity/gatk4-spark:4.6.1.0--hdfd78af_0' + : 'biocontainers/gatk4-spark:4.6.1.0--hdfd78af_0'}" input: tuple val(meta), path(input), path(input_index), path(bqsr_table), path(intervals) - path fasta - path fai - path dict + path fasta + path fai + path dict output: - tuple val(meta), path("*.bam") , emit: bam, optional: true - tuple val(meta), path("*.cram"), emit: cram, optional: true - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}.bam"), emit: bam, optional: true + tuple val(meta), path("${prefix}.cram"), emit: cram, optional: true + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when script: def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def interval_command = intervals ? "--intervals $intervals" : "" + prefix = task.ext.prefix ?: "${meta.id}" + def interval_command = intervals ? "--intervals ${intervals}" : "" def avail_mem = 3072 if (!task.memory) { - log.info '[GATK ApplyBQSRSpark] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' - } else { - avail_mem = (task.memory.mega*0.8).intValue() + log.info('[GATK ApplyBQSRSpark] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.') + } + else { + avail_mem = (task.memory.mega * 0.8).intValue() } """ gatk \\ --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ ApplyBQSRSpark \\ - --input $input \\ + --input ${input} \\ --output ${prefix}.${input.getExtension()} \\ - --reference $fasta \\ - --bqsr-recal-file $bqsr_table \\ - $interval_command \\ + --reference ${fasta} \\ + --bqsr-recal-file ${bqsr_table} \\ + ${interval_command} \\ --spark-master local[${task.cpus}] \\ --tmp-dir . \\ - $args + ${args} cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -52,7 +53,7 @@ process GATK4SPARK_APPLYBQSR { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" + prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.bam touch ${prefix}.cram diff --git a/modules/nf-core/gatk4spark/applybqsr/meta.yml b/modules/nf-core/gatk4spark/applybqsr/meta.yml index 609af2f450..909be9276a 100644 --- a/modules/nf-core/gatk4spark/applybqsr/meta.yml +++ b/modules/nf-core/gatk4spark/applybqsr/meta.yml @@ -1,85 +1,91 @@ name: gatk4spark_applybqsr description: Apply base quality score recalibration (BQSR) to a bam file keywords: - - bam - - base quality score recalibration - - bqsr - - cram - - gatk4spark +- bam +- base quality score recalibration +- bqsr +- cram +- gatk4spark tools: - - gatk4: - description: | - Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools - with a primary focus on variant discovery and genotyping. Its powerful processing engine - and high-performance computing features make it capable of taking on projects of any size. - homepage: https://gatk.broadinstitute.org/hc/en-us - documentation: https://gatk.broadinstitute.org/hc/en-us/categories/360002369672s - doi: 10.1158/1538-7445.AM2017-3590 - licence: ["Apache-2.0"] - identifier: "" +- gatk4: + description: | + Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools + with a primary focus on variant discovery and genotyping. Its powerful processing engine + and high-performance computing features make it capable of taking on projects of any size. + homepage: https://gatk.broadinstitute.org/hc/en-us + documentation: https://gatk.broadinstitute.org/hc/en-us/categories/360002369672s + doi: 10.1158/1538-7445.AM2017-3590 + licence: ["Apache-2.0"] + identifier: "" input: - - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM file from alignment - pattern: "*.{bam,cram}" - - input_index: - type: file - description: BAI/CRAI file from alignment - pattern: "*.{bai,crai}" - - bqsr_table: - type: file - description: Recalibration table from gatk4_baserecalibrator - - intervals: - type: file - description: Bed file with the genomic regions included in the library (optional) - - - fasta: - type: file - description: The reference fasta file - pattern: "*.fasta" - - - fai: - type: file - description: Index of reference fasta file - pattern: "*.fasta.fai" - - - dict: - type: file - description: GATK sequence dictionary - pattern: "*.dict" +- - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM file from alignment + pattern: "*.{bam,cram}" + - input_index: + type: file + description: BAI/CRAI file from alignment + pattern: "*.{bai,crai}" + - bqsr_table: + type: file + description: Recalibration table from gatk4_baserecalibrator + - intervals: + type: file + description: Bed file with the genomic regions included in the library (optional) +- - fasta: + type: file + description: The reference fasta file + pattern: "*.fasta" +- - fai: + type: file + description: Index of reference fasta file + pattern: "*.fasta.fai" +- - dict: + type: file + description: GATK sequence dictionary + pattern: "*.dict" output: - - bam: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.bam": - type: file - description: Recalibrated BAM file - pattern: "*.{bam}" - - cram: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.cram": - type: file - description: Recalibrated CRAM file - pattern: "*.{cram}" - - versions: - - versions.yml: - type: file - description: File containing software versions - pattern: "versions.yml" +- bam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*.{bam}" + - ${prefix}.bam: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*.{bam}" +- cram: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*.{cram}" + - ${prefix}.cram: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*.{cram}" +- versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - - "@yocra3" - - "@FriederikeHanssen" - - "@maxulysse" +- "@yocra3" +- "@FriederikeHanssen" +- "@maxulysse" maintainers: - - "@yocra3" - - "@FriederikeHanssen" - - "@maxulysse" +- "@yocra3" +- "@FriederikeHanssen" +- "@maxulysse" diff --git a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test b/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test index 53f2021613..25284c769c 100644 --- a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test +++ b/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test @@ -17,27 +17,62 @@ nextflow_process { """ input[0] = [ [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_baserecalibrator_table'], checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), [] ] - input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['sarscov2']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("sarscov2 - bam - stub") { + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [], + [], + [], + [] + ] + input[1] = [] + input[2] = [] + input[3] = [] + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } } + test("sarscov2 - bam intervals") { when { @@ -45,28 +80,30 @@ nextflow_process { """ input[0] = [ [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_baserecalibrator_table'], checkIfExists: true), - file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] - input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['sarscov2']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } - test("sarscov2 - bam - stub") { + test("sarscov2 - bam intervals -stub") { options "-stub" when { @@ -74,25 +111,27 @@ nextflow_process { """ input[0] = [ [ id:'test' ], // meta map - [], - [], - [], - [] + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] - input[1] = [] - input[2] = [] - input[3] = [] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } test("sarscov2 - cram") { @@ -102,26 +141,57 @@ nextflow_process { """ input[0] = [ [ id:'test' ], // meta map - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test_baserecalibrator_table'], checkIfExists: true), - file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) ] - input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } + test("sarscov2 - cram -stub") { + options "-stub" + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } } diff --git a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap b/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap index c4171be861..cd2a088c73 100644 --- a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap @@ -19,7 +19,7 @@ ] ], "2": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ], "bam": [ [ @@ -38,15 +38,20 @@ ] ], "versions": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ] + }, + { + "GATK4SPARK_APPLYBQSR": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T10:12:13.226593047" + "timestamp": "2025-04-11T14:56:27.915627809" }, "sarscov2 - cram": { "content": [ @@ -63,7 +68,7 @@ ] ], "2": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ], "bam": [ @@ -77,15 +82,74 @@ ] ], "versions": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" + ] + }, + { + "GATK4SPARK_APPLYBQSR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T14:57:42.699756036" + }, + "sarscov2 - cram -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" + ], + "bam": [ + [ + { + "id": "test" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + [ + { + "id": "test" + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ] + }, + { + "GATK4SPARK_APPLYBQSR": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:43:27.971279286" + "timestamp": "2025-04-11T14:57:58.189642524" }, "sarscov2 - bam": { "content": [ @@ -102,7 +166,7 @@ ], "2": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ], "bam": [ [ @@ -116,15 +180,20 @@ ], "versions": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ] + }, + { + "GATK4SPARK_APPLYBQSR": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:40:33.915518205" + "timestamp": "2025-04-11T14:56:13.425170564" }, "sarscov2 - bam intervals": { "content": [ @@ -141,7 +210,7 @@ ], "2": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ], "bam": [ [ @@ -155,14 +224,73 @@ ], "versions": [ - "versions.yml:md5,908022a782ee4e7d9c8264a2aa2c1c9f" + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" + ] + }, + { + "GATK4SPARK_APPLYBQSR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T14:56:55.562307069" + }, + "sarscov2 - bam intervals -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" + ], + "bam": [ + [ + { + "id": "test" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + [ + { + "id": "test" + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" ] + }, + { + "GATK4SPARK_APPLYBQSR": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:42:52.310003463" + "timestamp": "2025-04-11T14:57:11.97218192" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4spark/applybqsr/tests/tags.yml b/modules/nf-core/gatk4spark/applybqsr/tests/tags.yml deleted file mode 100644 index 275670766f..0000000000 --- a/modules/nf-core/gatk4spark/applybqsr/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4spark/applybqsr: - - "modules/nf-core/gatk4spark/applybqsr/**" diff --git a/modules/nf-core/gatk4spark/baserecalibrator/environment.yml b/modules/nf-core/gatk4spark/baserecalibrator/environment.yml index 14075a574a..a5c49e9557 100644 --- a/modules/nf-core/gatk4spark/baserecalibrator/environment.yml +++ b/modules/nf-core/gatk4spark/baserecalibrator/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4-spark=4.5.0.0 + - bioconda::gatk4-spark=4.6.1.0 diff --git a/modules/nf-core/gatk4spark/baserecalibrator/main.nf b/modules/nf-core/gatk4spark/baserecalibrator/main.nf index 32af761912..1f9e2cb595 100644 --- a/modules/nf-core/gatk4spark/baserecalibrator/main.nf +++ b/modules/nf-core/gatk4spark/baserecalibrator/main.nf @@ -1,23 +1,23 @@ process GATK4SPARK_BASERECALIBRATOR { - tag "$meta.id" + tag "${meta.id}" label 'process_low' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4-spark:4.5.0.0--hdfd78af_0': - 'biocontainers/gatk4-spark:4.5.0.0--hdfd78af_0' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://depot.galaxyproject.org/singularity/gatk4-spark:4.6.1.0--hdfd78af_0' + : 'biocontainers/gatk4-spark:4.6.1.0--hdfd78af_0'}" input: tuple val(meta), path(input), path(input_index), path(intervals) - path fasta - path fai - path dict - path known_sites - path known_sites_tbi + path fasta + path fai + path dict + path known_sites + path known_sites_tbi output: tuple val(meta), path("*.table"), emit: table - path "versions.yml" , emit: versions + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when @@ -25,26 +25,39 @@ process GATK4SPARK_BASERECALIBRATOR { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def interval_command = intervals ? "--intervals $intervals" : "" - def sites_command = known_sites.collect{"--known-sites $it"}.join(' ') + def interval_command = intervals ? "--intervals ${intervals}" : "" + def sites_command = known_sites.collect { "--known-sites ${it}" }.join(' ') def avail_mem = 3072 if (!task.memory) { - log.info '[GATK BaseRecalibratorSpark] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' - } else { - avail_mem = (task.memory.mega*0.8).intValue() + log.info('[GATK BaseRecalibratorSpark] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.') + } + else { + avail_mem = (task.memory.mega * 0.8).intValue() } """ gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ BaseRecalibratorSpark \\ - --input $input \\ + --input ${input} \\ --output ${prefix}.table \\ - --reference $fasta \\ - $interval_command \\ - $sites_command \\ + --reference ${fasta} \\ + ${interval_command} \\ + ${sites_command} \\ --spark-master local[${task.cpus}] \\ --tmp-dir . \\ - $args + ${args} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + touch ${prefix}.table cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test b/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test new file mode 100644 index 0000000000..6bb4d9dd01 --- /dev/null +++ b/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test @@ -0,0 +1,268 @@ +nextflow_process { + + name "Test Process GATK4SPARK_BASERECALIBRATOR" + script "../main.nf" + config "./nextflow.config" + process "GATK4SPARK_BASERECALIBRATOR" + + tag "modules" + tag "modules_nfcore" + tag "gatk4spark" + tag "gatk4spark/baserecalibrator" + + test("sarscov2 - bam") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) + input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("homo sapiens - cram") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + [] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true)) + input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true)) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("sarscov2 - bam - intervals") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) + input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("sarscov2 - bam - multi sites") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) + ]) + input[5] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) + ]) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("sarscov2 - bam -stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) + input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("homo sapiens - cram -stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), + [] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true)) + input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true)) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("sarscov2 - bam - intervals -stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) + input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("sarscov2 - bam - multi sites -stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), + [] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) + input[4] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) + ]) + input[5] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) + ]) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } +} diff --git a/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap b/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap new file mode 100644 index 0000000000..28394ad3db --- /dev/null +++ b/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap @@ -0,0 +1,306 @@ +{ + "sarscov2 - bam - intervals -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T15:00:38.617564388" + }, + "sarscov2 - bam - multi sites": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T14:59:50.213616922" + }, + "homo sapiens - cram": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,ab82f81e027d8762b01c631b4ef792c0" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,ab82f81e027d8762b01c631b4ef792c0" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T14:58:59.091441241" + }, + "sarscov2 - bam - intervals": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,9ecb5f00a2229291705addc09c0ec231" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,9ecb5f00a2229291705addc09c0ec231" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T14:59:24.000377035" + }, + "sarscov2 - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T14:58:25.814297279" + }, + "sarscov2 - bam - multi sites -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T15:00:55.024158381" + }, + "sarscov2 - bam -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T15:00:05.696488985" + }, + "homo sapiens - cram -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ], + "table": [ + [ + { + "id": "test" + }, + "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" + ] + }, + { + "GATK4SPARK_BASERECALIBRATOR": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T15:00:21.556918585" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config b/modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config new file mode 100644 index 0000000000..a1a17be887 --- /dev/null +++ b/modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config @@ -0,0 +1,2 @@ +docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64 -e "HOME=${HOME}" -v /etc/passwd:/etc/passwd:ro -v /etc/shadow:/etc/shadow:ro -v /etc/group:/etc/group:ro -v $HOME:$HOME' + diff --git a/modules/nf-core/gatk4spark/markduplicates/environment.yml b/modules/nf-core/gatk4spark/markduplicates/environment.yml index 14075a574a..a5c49e9557 100644 --- a/modules/nf-core/gatk4spark/markduplicates/environment.yml +++ b/modules/nf-core/gatk4spark/markduplicates/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::gatk4-spark=4.5.0.0 + - bioconda::gatk4-spark=4.6.1.0 diff --git a/modules/nf-core/gatk4spark/markduplicates/main.nf b/modules/nf-core/gatk4spark/markduplicates/main.nf index b6a6daffea..a0dcf3fee4 100644 --- a/modules/nf-core/gatk4spark/markduplicates/main.nf +++ b/modules/nf-core/gatk4spark/markduplicates/main.nf @@ -1,23 +1,23 @@ process GATK4SPARK_MARKDUPLICATES { - tag "$meta.id" + tag "${meta.id}" label 'process_high' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4-spark:4.5.0.0--hdfd78af_0': - 'biocontainers/gatk4-spark:4.5.0.0--hdfd78af_0' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://depot.galaxyproject.org/singularity/gatk4-spark:4.6.1.0--hdfd78af_0' + : 'biocontainers/gatk4-spark:4.6.1.0--hdfd78af_0'}" input: tuple val(meta), path(bam) - path fasta - path fasta_fai - path dict + path fasta + path fasta_fai + path dict output: tuple val(meta), path("${prefix}"), emit: output - tuple val(meta), path("${prefix}.bai"), emit: bam_index, optional:true - tuple val(meta), path("*.metrics"), emit: metrics, optional: true - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}.bai"), emit: bam_index, optional: true + tuple val(meta), path("*.metrics"), emit: metrics, optional: true + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when @@ -25,23 +25,24 @@ process GATK4SPARK_MARKDUPLICATES { script: def args = task.ext.args ?: '' prefix = task.ext.prefix ?: "${meta.id}.bam" - def input_list = bam.collect{"--input $it"}.join(' ') + def input_list = bam.collect { "--input ${it}" }.join(' ') def avail_mem = 3072 if (!task.memory) { - log.info '[GATK MarkDuplicatesSpark] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' - } else { - avail_mem = (task.memory.mega*0.8).intValue() + log.info('[GATK MarkDuplicatesSpark] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.') + } + else { + avail_mem = (task.memory.mega * 0.8).intValue() } """ gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ MarkDuplicatesSpark \\ - $input_list \\ - --output $prefix \\ - --reference $fasta \\ + ${input_list} \\ + --output ${prefix} \\ + --reference ${fasta} \\ --spark-master local[${task.cpus}] \\ --tmp-dir . \\ - $args + ${args} cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -55,6 +56,7 @@ process GATK4SPARK_MARKDUPLICATES { touch ${prefix} touch ${prefix}.bai touch ${prefix}.metrics + cat <<-END_VERSIONS > versions.yml "${task.process}": gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test b/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test index 2aa2db69ed..40dbb713a0 100644 --- a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test +++ b/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test @@ -17,23 +17,25 @@ nextflow_process { process { """ input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + [ id:'test', single_end:false ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) ] - input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['sarscov2']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } test("homo_sapiens - bam - multiple") { @@ -43,26 +45,28 @@ nextflow_process { process { """ input[0] = [ - [ id:'test', single_end:false ], // meta map + [ id:'test', single_end:false ], [ - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_name_sorted_bam'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_name_sorted_bam'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) ] ] - input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } test("homo_sapiens - bam - metrics") { @@ -72,30 +76,33 @@ nextflow_process { process { """ input[0] = [ - [ id:'test', single_end:false ], // meta map + [ id:'test', single_end:false ], [ - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_name_sorted_bam'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_name_sorted_bam'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) ] ] - input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("homo_sapiens - bam - metrics - versions") }, - { assert snapshot(process.out.output).match("homo_sapiens - bam - metrics - output") }, - { assert snapshot(process.out.bam_index).match("homo_sapiens - bam - metrics - bam_index") }, - { assert path(process.out.metrics[0][1]).readLines()[5].contains("GATKDuplicationMetrics") }, - { assert path(process.out.metrics[0][1]).readLines().size() == 11 } + { assert snapshot( + process.out.versions, + process.out.output, + process.out.bam_index, + path(process.out.metrics[0][1]).readLines()[5], + path(process.out.metrics[0][1]).readLines().size(), + path(process.out.versions[0]).yaml + ) + } ) } - } test("homo_sapiens - cram") { @@ -105,54 +112,152 @@ nextflow_process { process { """ input[0] = [ - [ id:'test', single_end:false ], // meta map + [ id:'test', single_end:false ], [ - file(params.test_data['homo_sapiens']['illumina']['test_paired_end_name_sorted_bam'], checkIfExists: true), - file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_name_sorted_bam'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) ] ] - input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) - input[2] = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) - input[3] = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } - } - test("stub") { + test("sarscov2 - bam -stub") { + options "-stub" config "./bam.config" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } + + test("homo_sapiens - bam - multiple -stub") { options "-stub" + config "./bam.config" when { process { """ input[0] = [ - [ id:'test', single_end:false ], // meta map - [] + [ id:'test', single_end:false ], + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) + ] ] - input[1] = [] - input[2] = [] - input[3] = [] + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) """ } } then { + assert process.success assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } ) } + } + + test("homo_sapiens - bam - metrics -stub") { + options "-stub" + config "./metrics.config" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) + ] + ] + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) + """ + } + } + + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } } + test("homo_sapiens - cram -stub") { + options "-stub" + config "./cram.config" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) + ] + ] + input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) + """ + } + } + then { + assert process.success + assertAll( + { assert snapshot( + process.out, + path(process.out.versions[0]).yaml + ).match() } + ) + } + } } diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap b/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap index 4968a1ce65..1482578a1c 100644 --- a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap +++ b/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap @@ -24,7 +24,7 @@ ], "3": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ], "bam_index": [ [ @@ -48,33 +48,20 @@ ] ], "versions": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-15T11:53:11.621016088" - }, - "homo_sapiens - bam - metrics - output": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,1154a16717d430199f3e9994a87b546a" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:53:32.254055925" + "timestamp": "2025-04-11T15:01:54.825208573" }, "homo_sapiens - cram": { "content": [ @@ -95,7 +82,7 @@ ], "3": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ], "bam_index": [ @@ -113,47 +100,98 @@ ] ], "versions": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-15T11:53:53.339811107" - }, - "homo_sapiens - bam - metrics - versions": { - "content": [ - [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:53:32.199010065" + "timestamp": "2025-04-11T15:03:51.19014784" }, - "homo_sapiens - bam - metrics - bam_index": { + "homo_sapiens - bam - metrics -stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d947dccacf3fb7fcf174d364a5f7856d" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" + ], + "bam_index": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ] - ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:53:32.305216975" + "timestamp": "2025-04-11T15:05:23.678812172" }, - "stub": { + "homo_sapiens - bam - multiple -stub": { "content": [ { "0": [ @@ -184,7 +222,7 @@ ] ], "3": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ], "bam_index": [ [ @@ -214,15 +252,96 @@ ] ], "versions": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T10:56:48.15652292" + "timestamp": "2025-04-11T15:04:49.498784821" + }, + "homo_sapiens - cram -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" + ], + "bam_index": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" + ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T15:05:56.744218653" }, "sarscov2 - bam": { "content": [ @@ -249,7 +368,7 @@ ], "3": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ], "bam_index": [ [ @@ -273,14 +392,95 @@ ] ], "versions": [ - "versions.yml:md5,9699197d0e667ab368a8c6d2a6893cc6" + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" + ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-11T15:01:22.411041697" + }, + "sarscov2 - bam -stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" + ], + "bam_index": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" ] + }, + { + "GATK4SPARK_MARKDUPLICATES": { + "gatk4": "4.6.1.0" + } } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-02-15T11:52:51.5386181" + "timestamp": "2025-04-11T15:04:15.984302135" } } \ No newline at end of file diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/tags.yml b/modules/nf-core/gatk4spark/markduplicates/tests/tags.yml deleted file mode 100644 index fc04bfa576..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gatk4spark/markduplicates: - - "modules/nf-core/gatk4spark/markduplicates/**" diff --git a/modules/nf-core/gawk/environment.yml b/modules/nf-core/gawk/environment.yml index 315f6dc67e..f52109e83b 100644 --- a/modules/nf-core/gawk/environment.yml +++ b/modules/nf-core/gawk/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/gawk/main.nf b/modules/nf-core/gawk/main.nf index 7514246eeb..615b2ce923 100644 --- a/modules/nf-core/gawk/main.nf +++ b/modules/nf-core/gawk/main.nf @@ -10,10 +10,11 @@ process GAWK { input: tuple val(meta), path(input, arity: '0..*') path(program_file) + val(disable_redirect_output) output: - tuple val(meta), path("${prefix}.${suffix}"), emit: output - path "versions.yml" , emit: versions + tuple val(meta), path("*.${suffix}"), emit: output + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -21,21 +22,31 @@ process GAWK { script: def args = task.ext.args ?: '' // args is used for the main arguments of the tool def args2 = task.ext.args2 ?: '' // args2 is used to specify a program when no program file has been given - prefix = task.ext.prefix ?: "${meta.id}" - suffix = task.ext.suffix ?: "${input.collect{ it.getExtension()}.get(0)}" // use the first extension of the input files + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "${input.collect{ it.getExtension()}.get(0)}" // use the first extension of the input files + + program = program_file ? "-f ${program_file}" : "${args2}" + lst_gz = input.findResults{ it.getExtension().endsWith("gz") ? it.toString() : null } + unzip = lst_gz ? "gunzip -q -f ${lst_gz.join(" ")}" : "" + input_cmd = input.collect { it.toString() - ~/\.gz$/ }.join(" ") + output_cmd = suffix.endsWith("gz") ? "| gzip > ${prefix}.${suffix}" : "> ${prefix}.${suffix}" + output = disable_redirect_output ? "" : output_cmd + cleanup = lst_gz ? "rm ${lst_gz.collect{ it - ~/\.gz$/ }.join(" ")}" : "" - program = program_file ? "-f ${program_file}" : "${args2}" - lst_gz = input.collect{ it.getExtension().endsWith("gz") } - unzip = lst_gz.contains(false) ? "" : "find ${input} -exec zcat {} \\; | \\" - input_cmd = unzip ? "" : "${input}" + input.collect{ + assert it.name != "${prefix}.${suffix}" : "Input and output names are the same, set prefix in module configuration to disambiguate!" + } """ ${unzip} + awk \\ ${args} \\ ${program} \\ ${input_cmd} \\ - > ${prefix}.${suffix} + ${output} + + ${cleanup} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/gawk/meta.yml b/modules/nf-core/gawk/meta.yml index 2da41405de..34c50b125c 100644 --- a/modules/nf-core/gawk/meta.yml +++ b/modules/nf-core/gawk/meta.yml @@ -34,6 +34,11 @@ input: description: Optional file containing logic for awk to execute. If you don't wish to use a file, you can use `ext.args2` to specify the logic. pattern: "*" + - - disable_redirect_output: + type: boolean + description: Disable the redirection of awk output to a given file. This is + useful if you want to use awk's built-in redirect to write files instead + of the shell's redirect. output: - output: - meta: @@ -41,10 +46,11 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - - ${prefix}.${suffix}: + - "*.${suffix}": type: file - description: The output file - specify the name of this file using `ext.prefix` - and the extension using `ext.suffix` + description: The output file - if using shell redirection, specify the name of this + file using `ext.prefix` and the extension using `ext.suffix`. Otherwise, ensure + the awk program produces files with the extension in `ext.suffix`. pattern: "*" - versions: - versions.yml: diff --git a/modules/nf-core/gawk/tests/main.nf.test b/modules/nf-core/gawk/tests/main.nf.test index 5952e9a293..54462271dd 100644 --- a/modules/nf-core/gawk/tests/main.nf.test +++ b/modules/nf-core/gawk/tests/main.nf.test @@ -8,10 +8,14 @@ nextflow_process { tag "modules_nfcore" tag "gawk" - test("Convert fasta to bed") { - config "./nextflow.config" + config "./nextflow.config" + test("Convert fasta to bed") { when { + params { + gawk_suffix = "bed" + gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }\'' + } process { """ input[0] = [ @@ -19,6 +23,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] input[1] = [] + input[2] = false """ } } @@ -32,16 +37,45 @@ nextflow_process { } test("Convert fasta to bed with program file") { - config "./nextflow_with_program_file.config" + when { + params { + gawk_suffix = "bed" + gawk_args2 = "" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[1] = Channel.of('BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }').collectFile(name:"program.awk") + input[2] = false + """ + } + } + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Convert fasta to bed using awk redirect instead of shell redirect") { when { + params { + gawk_suffix = "bed" + gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 > "test.bed" }\'' + } process { """ input[0] = [ [ id:'test' ], // meta map file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[1] = Channel.of('BEGIN {FS="\t"}; {print \$1 FS "0" FS \$2}').collectFile(name:"program.txt") + input[1] = [] + input[2] = true """ } } @@ -55,9 +89,11 @@ nextflow_process { } test("Extract first column from multiple files") { - config "./nextflow_with_program_file.config" - tag "test" when { + params { + gawk_suffix = "bed" + gawk_args2 = "" + } process { """ input[0] = [ @@ -65,7 +101,8 @@ nextflow_process { [file(params.modules_testdata_base_path + 'generic/txt/hello.txt', checkIfExists: true), file(params.modules_testdata_base_path + 'generic/txt/species_names.txt', checkIfExists: true)] ] - input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.txt") + input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.awk") + input[2] = false """ } } @@ -79,9 +116,11 @@ nextflow_process { } test("Unzip files before processing") { - config "./nextflow_with_program_file.config" - when { + params { + gawk_suffix = "bed" + gawk_args2 = "" + } process { """ input[0] = [ @@ -89,7 +128,34 @@ nextflow_process { [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/NA12878_chrM.vcf.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/NA24385_sv.vcf.gz', checkIfExists: true)] ] - input[1] = Channel.of('/^#CHROM/ { print \$1, \$10 }').collectFile(name:"column_header.txt") + input[1] = Channel.of('/^#CHROM/ { print \$1, \$10 }').collectFile(name:"column_header.awk") + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Compress after processing") { + when { + params { + gawk_suffix = "txt.gz" + gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }\'' + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[1] = [] + input[2] = false """ } } @@ -101,4 +167,32 @@ nextflow_process { ) } } + + test("Input and output files are similar") { + when { + params { + gawk_suffix = "txt" + gawk_args = "" + gawk_args2 = "" + } + process { + """ + input[0] = [ + [ id:'hello' ], // meta map + [file(params.modules_testdata_base_path + 'generic/txt/hello.txt', checkIfExists: true), + file(params.modules_testdata_base_path + 'generic/txt/species_names.txt', checkIfExists: true)] + ] + input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.awk") + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert process.errorReport.contains("Input and output names are the same, set prefix in module configuration to disambiguate!") } + ) + } + } } \ No newline at end of file diff --git a/modules/nf-core/gawk/tests/main.nf.test.snap b/modules/nf-core/gawk/tests/main.nf.test.snap index d396f738b6..d8e8ac755d 100644 --- a/modules/nf-core/gawk/tests/main.nf.test.snap +++ b/modules/nf-core/gawk/tests/main.nf.test.snap @@ -1,4 +1,37 @@ { + "Compress after processing": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.txt.gz:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.txt.gz:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.1" + }, + "timestamp": "2024-11-27T17:11:20.054143406" + }, "Convert fasta to bed": { "content": [ { @@ -130,5 +163,38 @@ "nextflow": "24.04.4" }, "timestamp": "2024-10-19T22:08:19.533527657" + }, + "Convert fasta to bed using awk redirect instead of shell redirect": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-03-05T08:31:09.88842854" } -} +} \ No newline at end of file diff --git a/modules/nf-core/gawk/tests/nextflow.config b/modules/nf-core/gawk/tests/nextflow.config index 6e5d43a35c..895709a763 100644 --- a/modules/nf-core/gawk/tests/nextflow.config +++ b/modules/nf-core/gawk/tests/nextflow.config @@ -1,6 +1,6 @@ process { withName: GAWK { - ext.suffix = "bed" - ext.args2 = '\'BEGIN {FS="\t"}; {print \$1 FS "0" FS \$2}\'' + ext.suffix = params.gawk_suffix + ext.args2 = params.gawk_args2 } } diff --git a/modules/nf-core/gawk/tests/nextflow_with_program_file.config b/modules/nf-core/gawk/tests/nextflow_with_program_file.config deleted file mode 100644 index 693ad41963..0000000000 --- a/modules/nf-core/gawk/tests/nextflow_with_program_file.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GAWK { - ext.suffix = "bed" - } -} diff --git a/modules/nf-core/gawk/tests/tags.yml b/modules/nf-core/gawk/tests/tags.yml deleted file mode 100644 index 72e4531d22..0000000000 --- a/modules/nf-core/gawk/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -gawk: - - "modules/nf-core/gawk/**" diff --git a/modules/nf-core/goleft/indexcov/environment.yml b/modules/nf-core/goleft/indexcov/environment.yml index 813146929c..7aa46cc4f0 100644 --- a/modules/nf-core/goleft/indexcov/environment.yml +++ b/modules/nf-core/goleft/indexcov/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/goleft/indexcov/tests/tags.yml b/modules/nf-core/goleft/indexcov/tests/tags.yml deleted file mode 100644 index c27c4b9d5e..0000000000 --- a/modules/nf-core/goleft/indexcov/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -goleft/indexcov: - - "modules/nf-core/goleft/indexcov/**" diff --git a/modules/nf-core/lofreq/callparallel/environment.yml b/modules/nf-core/lofreq/callparallel/environment.yml index 011ce6cbda..4ade529a78 100644 --- a/modules/nf-core/lofreq/callparallel/environment.yml +++ b/modules/nf-core/lofreq/callparallel/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/lofreq/callparallel/tests/tags.yml b/modules/nf-core/lofreq/callparallel/tests/tags.yml deleted file mode 100644 index 14c36bc274..0000000000 --- a/modules/nf-core/lofreq/callparallel/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -lofreq/callparallel: - - "modules/nf-core/lofreq/callparallel/**" diff --git a/modules/nf-core/manta/germline/environment.yml b/modules/nf-core/manta/germline/environment.yml index fe5ade5068..56c00291a3 100644 --- a/modules/nf-core/manta/germline/environment.yml +++ b/modules/nf-core/manta/germline/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/manta/germline/tests/tags.yml b/modules/nf-core/manta/germline/tests/tags.yml deleted file mode 100644 index 99d1a73ca3..0000000000 --- a/modules/nf-core/manta/germline/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -manta/germline: - - "modules/nf-core/manta/germline/**" diff --git a/modules/nf-core/manta/somatic/environment.yml b/modules/nf-core/manta/somatic/environment.yml index fe5ade5068..56c00291a3 100644 --- a/modules/nf-core/manta/somatic/environment.yml +++ b/modules/nf-core/manta/somatic/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/manta/somatic/tests/tags.yml b/modules/nf-core/manta/somatic/tests/tags.yml deleted file mode 100644 index 0f4e8ea2c8..0000000000 --- a/modules/nf-core/manta/somatic/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -manta/somatic: - - "modules/nf-core/manta/somatic/**" diff --git a/modules/nf-core/manta/tumoronly/environment.yml b/modules/nf-core/manta/tumoronly/environment.yml index fe5ade5068..56c00291a3 100644 --- a/modules/nf-core/manta/tumoronly/environment.yml +++ b/modules/nf-core/manta/tumoronly/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/manta/tumoronly/tests/tags.yml b/modules/nf-core/manta/tumoronly/tests/tags.yml deleted file mode 100644 index cf38c24225..0000000000 --- a/modules/nf-core/manta/tumoronly/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -manta/tumoronly: - - "modules/nf-core/manta/tumoronly/**" diff --git a/modules/nf-core/mosdepth/environment.yml b/modules/nf-core/mosdepth/environment.yml index e937987380..f871e054e4 100644 --- a/modules/nf-core/mosdepth/environment.yml +++ b/modules/nf-core/mosdepth/environment.yml @@ -1,6 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: # renovate: datasource=conda depName=bioconda/mosdepth - - mosdepth=0.3.8 + - mosdepth=0.3.10 diff --git a/modules/nf-core/mosdepth/main.nf b/modules/nf-core/mosdepth/main.nf index 6f4a838343..3bf945f909 100644 --- a/modules/nf-core/mosdepth/main.nf +++ b/modules/nf-core/mosdepth/main.nf @@ -4,8 +4,8 @@ process MOSDEPTH { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mosdepth:0.3.8--hd299d5a_0' : - 'biocontainers/mosdepth:0.3.8--hd299d5a_0'}" + 'https://depot.galaxyproject.org/singularity/mosdepth:0.3.10--h4e814b3_1' : + 'biocontainers/mosdepth:0.3.10--h4e814b3_1'}" input: tuple val(meta), path(bam), path(bai), path(bed) diff --git a/modules/nf-core/mosdepth/tests/main.nf.test.snap b/modules/nf-core/mosdepth/tests/main.nf.test.snap index c604540b03..67e16562bc 100644 --- a/modules/nf-core/mosdepth/tests/main.nf.test.snap +++ b/modules/nf-core/mosdepth/tests/main.nf.test.snap @@ -39,7 +39,7 @@ ] ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ [ @@ -222,15 +222,15 @@ ] ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:33:16.953408231" + "timestamp": "2025-01-17T14:57:12.350279421" }, "homo_sapiens - cram, crai, bed": { "content": [ @@ -260,7 +260,7 @@ ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ [ @@ -289,7 +289,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -307,7 +307,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,e7df086f0a36e88ca231e143d43bd3f9" + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" ] ], "8": [ @@ -340,7 +340,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -367,7 +367,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,e7df086f0a36e88ca231e143d43bd3f9" + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" ] ], "regions_txt": [ @@ -395,15 +395,15 @@ ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:32:50.160217828" + "timestamp": "2025-01-17T14:56:12.528228123" }, "homo_sapiens - bam, bai, [] - quantized": { "content": [ @@ -433,7 +433,7 @@ ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ @@ -456,7 +456,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -480,7 +480,7 @@ "id": "test", "single_end": true }, - "test.quantized.bed.gz.csi:md5,4f69e6ace50206a2768be66ded3a56f0" + "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93" ] ], "global_txt": [ @@ -507,7 +507,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -528,7 +528,7 @@ "id": "test", "single_end": true }, - "test.quantized.bed.gz.csi:md5,4f69e6ace50206a2768be66ded3a56f0" + "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93" ] ], "regions_bed": [ @@ -556,15 +556,15 @@ ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:33:01.164885111" + "timestamp": "2025-01-17T14:56:38.422491251" }, "homo_sapiens - bam, bai, bed": { "content": [ @@ -594,7 +594,7 @@ ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ [ @@ -623,7 +623,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -641,7 +641,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,e7df086f0a36e88ca231e143d43bd3f9" + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" ] ], "8": [ @@ -674,7 +674,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -701,7 +701,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,e7df086f0a36e88ca231e143d43bd3f9" + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" ] ], "regions_txt": [ @@ -729,15 +729,15 @@ ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:32:39.071657456" + "timestamp": "2025-01-17T14:55:43.01015749" }, "homo_sapiens - bam, bai, [] - window": { "content": [ @@ -767,7 +767,7 @@ ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ [ @@ -796,7 +796,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -814,7 +814,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,2a30bcb7f5c7632136b3efce24723970" + "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d" ] ], "8": [ @@ -847,7 +847,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -874,7 +874,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,2a30bcb7f5c7632136b3efce24723970" + "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d" ] ], "regions_txt": [ @@ -902,15 +902,15 @@ ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:32:55.631776118" + "timestamp": "2025-01-17T14:56:27.10647246" }, "homo_sapiens - bam, bai, []": { "content": [ @@ -940,7 +940,7 @@ ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ @@ -963,7 +963,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -1002,7 +1002,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -1039,15 +1039,15 @@ ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:32:33.642125299" + "timestamp": "2025-01-17T14:55:30.449110281" }, "homo_sapiens - cram, crai, []": { "content": [ @@ -1077,7 +1077,7 @@ ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ @@ -1100,7 +1100,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -1139,7 +1139,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -1176,15 +1176,15 @@ ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:32:44.704920941" + "timestamp": "2025-01-17T14:55:55.244274402" }, "homo_sapiens - bam, bai, bed - thresholds": { "content": [ @@ -1222,11 +1222,11 @@ "id": "test", "single_end": true }, - "test.thresholds.bed.gz.csi:md5,219414a0751185adb98d2235d83ea055" + "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196" ] ], "12": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ], "2": [ [ @@ -1255,7 +1255,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "6": [ @@ -1273,7 +1273,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,e7df086f0a36e88ca231e143d43bd3f9" + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" ] ], "8": [ @@ -1306,7 +1306,7 @@ "id": "test", "single_end": true }, - "test.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294" + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" ] ], "per_base_d4": [ @@ -1333,7 +1333,7 @@ "id": "test", "single_end": true }, - "test.regions.bed.gz.csi:md5,e7df086f0a36e88ca231e143d43bd3f9" + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" ] ], "regions_txt": [ @@ -1369,18 +1369,18 @@ "id": "test", "single_end": true }, - "test.thresholds.bed.gz.csi:md5,219414a0751185adb98d2235d83ea055" + "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196" ] ], "versions": [ - "versions.yml:md5,87634e525fb18990cd98fe1080ad72ce" + "versions.yml:md5,333368078626c18a32eeb12299080cc9" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-04-29T13:33:06.737266831" + "timestamp": "2025-01-17T14:56:49.888375978" } } \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/tags.yml b/modules/nf-core/mosdepth/tests/tags.yml deleted file mode 100644 index 5cd2e08e2c..0000000000 --- a/modules/nf-core/mosdepth/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -mosdepth: - - "modules/nf-core/mosdepth/**" diff --git a/modules/nf-core/msisensorpro/msisomatic/environment.yml b/modules/nf-core/msisensorpro/msisomatic/environment.yml index f67b9b733e..f17216d6c5 100644 --- a/modules/nf-core/msisensorpro/msisomatic/environment.yml +++ b/modules/nf-core/msisensorpro/msisomatic/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/msisensorpro/scan/environment.yml b/modules/nf-core/msisensorpro/scan/environment.yml index f67b9b733e..f17216d6c5 100644 --- a/modules/nf-core/msisensorpro/scan/environment.yml +++ b/modules/nf-core/msisensorpro/scan/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index 6f5b867b76..d430da5f7c 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::multiqc=1.25.1 + - bioconda::multiqc=1.28 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index cc0643e1d5..f3b5704720 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,8 +3,8 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : - 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.28--pyhdfd78af_0' : + 'biocontainers/multiqc:1.28--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index 2fcbb5ff7d..26d74307d0 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" + "versions.yml:md5,b05075d2d2b4f485c0d627a5c8e475b2" ] ], "meta": { "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nextflow": "24.10.4" }, - "timestamp": "2024-10-02T17:51:46.317523" + "timestamp": "2025-03-26T16:05:18.927925" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" + "versions.yml:md5,b05075d2d2b4f485c0d627a5c8e475b2" ] ], "meta": { "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nextflow": "24.10.4" }, - "timestamp": "2024-10-02T17:52:20.680978" + "timestamp": "2025-03-26T16:05:55.639955" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" + "versions.yml:md5,b05075d2d2b4f485c0d627a5c8e475b2" ] ], "meta": { "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nextflow": "24.10.4" }, - "timestamp": "2024-10-02T17:52:09.185842" + "timestamp": "2025-03-26T16:05:44.067369" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml deleted file mode 100644 index bea6c0d37f..0000000000 --- a/modules/nf-core/multiqc/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -multiqc: - - modules/nf-core/multiqc/** diff --git a/modules/nf-core/ngscheckmate/ncm/environment.yml b/modules/nf-core/ngscheckmate/ncm/environment.yml index 117b4e5783..7348216563 100644 --- a/modules/nf-core/ngscheckmate/ncm/environment.yml +++ b/modules/nf-core/ngscheckmate/ncm/environment.yml @@ -1,5 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - bioconda::ngscheckmate=1.0.1 + - bioconda::bcftools=1.21 diff --git a/modules/nf-core/ngscheckmate/ncm/main.nf b/modules/nf-core/ngscheckmate/ncm/main.nf index d5500a257c..ffb64a86b5 100644 --- a/modules/nf-core/ngscheckmate/ncm/main.nf +++ b/modules/nf-core/ngscheckmate/ncm/main.nf @@ -3,8 +3,8 @@ process NGSCHECKMATE_NCM { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ngscheckmate:1.0.1--py27pl5321r40hdfd78af_1': - 'biocontainers/ngscheckmate:1.0.1--py27pl5321r40hdfd78af_1' }" + 'https://depot.galaxyproject.org/singularity/ngscheckmate:1.0.1--py312pl5321h577a1d6_4': + 'biocontainers/ngscheckmate:1.0.1--py312pl5321h577a1d6_4' }" input: tuple val(meta) , path(files) diff --git a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test b/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test index 1263be3583..9a2c17ebbd 100644 --- a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test +++ b/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test @@ -9,22 +9,10 @@ nextflow_process { tag "modules_nfcore" tag "ngscheckmate" tag "ngscheckmate/ncm" - tag "bedtools/makewindows" tag "bcftools/mpileup" setup { - run("BEDTOOLS_MAKEWINDOWS") { - script "../../../bedtools/makewindows/main.nf" - process { - """ - input[0] = [ [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - """ - } - } - run("BCFTOOLS_MPILEUP", alias: "BCFTOOLS_MPILEUP1") { script "../../../bcftools/mpileup/main.nf" process { @@ -67,6 +55,9 @@ nextflow_process { when { process { """ + bed_file = file('test_snp.bed') + bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" + input[0] = [ [ id: 'combined_bams' ], [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), @@ -75,7 +66,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam.bai', checkIfExists: true) ] ] - input[1] = BEDTOOLS_MAKEWINDOWS.out.bed + input[1] = Channel.of([ [id:'test_bed'], bed_file]) input[2] = [ [ id:'sarscov2' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] @@ -102,8 +93,11 @@ nextflow_process { when { process { """ + bed_file = file('test_snp.bed') + bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" + input[0] = BCFTOOLS_MPILEUP1.out.vcf.combine(BCFTOOLS_MPILEUP2.out.vcf.map{it[1]}).map{meta, one, two -> [meta, [one, two]]}.map{meta, stuff -> [meta, stuff.flatten()]} - input[1] = BEDTOOLS_MAKEWINDOWS.out.bed + input[1] = Channel.of([ [id:'test_bed'], bed_file]) input[2] = [ [ id:'sarscov2' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] @@ -116,7 +110,7 @@ nextflow_process { { assert process.success }, { assert snapshot( process.out.corr_matrix, - process.out.matched, + file(process.out.matched[0][1]).name, process.out.all, file(process.out.pdf[0][1]).name, process.out.versions @@ -141,7 +135,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam.bai', checkIfExists: true) ] ] - input[1] = BEDTOOLS_MAKEWINDOWS.out.bed + input[1] = [ [ id:'bed' ], []] input[2] = [ [ id:'sarscov2' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] @@ -166,7 +160,7 @@ nextflow_process { process { """ input[0] = BCFTOOLS_MPILEUP1.out.vcf.combine(BCFTOOLS_MPILEUP2.out.vcf.map{it[1]}) - input[1] = BEDTOOLS_MAKEWINDOWS.out.bed + input[1] = [ [ id:'bed' ], []] input[2] = [ [ id:'sarscov2' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] diff --git a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap b/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap index e78cecc8f5..46191dcaf0 100644 --- a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap +++ b/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap @@ -93,23 +93,16 @@ { "id": "test1" }, - "test1_output_corr_matrix.txt:md5,0c86bdad2721c470fe6be119f291c8e5" + "test1_output_corr_matrix.txt:md5,3a23347ff7071d5d8e273bfc29731d4a" ] ], + "test1_matched.txt", [ [ { "id": "test1" }, - "test1_matched.txt:md5,fd74956dcac279b6f58e82ea73e344f8" - ] - ], - [ - [ - { - "id": "test1" - }, - "test1_all.txt:md5,fd74956dcac279b6f58e82ea73e344f8" + "test1_all.txt:md5,7e6ca5eb3daf6f589ea20fa117269edf" ] ], "test1.pdf", @@ -118,10 +111,10 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nf-test": "0.9.2", + "nextflow": "24.10.4" }, - "timestamp": "2024-05-22T19:53:29.123160766" + "timestamp": "2025-03-05T15:40:36.013242151" }, "sarscov2 - bam": { "content": [ diff --git a/modules/nf-core/ngscheckmate/ncm/tests/tags.yml b/modules/nf-core/ngscheckmate/ncm/tests/tags.yml deleted file mode 100644 index f9f6044516..0000000000 --- a/modules/nf-core/ngscheckmate/ncm/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -ngscheckmate/ncm: - - "modules/nf-core/ngscheckmate/ncm/**" diff --git a/modules/nf-core/samblaster/environment.yml b/modules/nf-core/samblaster/environment.yml index fc8cd9e515..a24590a5e9 100644 --- a/modules/nf-core/samblaster/environment.yml +++ b/modules/nf-core/samblaster/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/samblaster/tests/tags.yml b/modules/nf-core/samblaster/tests/tags.yml deleted file mode 100644 index 3882ee54ff..0000000000 --- a/modules/nf-core/samblaster/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samblaster: - - "modules/nf-core/samblaster/**" diff --git a/modules/nf-core/samtools/bam2fq/tests/tags.yml b/modules/nf-core/samtools/bam2fq/tests/tags.yml deleted file mode 100644 index 2fbf4a1fd2..0000000000 --- a/modules/nf-core/samtools/bam2fq/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/bam2fq: - - "modules/nf-core/samtools/bam2fq/**" diff --git a/modules/nf-core/samtools/collatefastq/tests/tags.yml b/modules/nf-core/samtools/collatefastq/tests/tags.yml deleted file mode 100644 index 67380776a2..0000000000 --- a/modules/nf-core/samtools/collatefastq/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/collatefastq: - - "modules/nf-core/samtools/collatefastq/**" diff --git a/modules/nf-core/samtools/convert/main.nf b/modules/nf-core/samtools/convert/main.nf index cf9253d10f..9667e72d84 100644 --- a/modules/nf-core/samtools/convert/main.nf +++ b/modules/nf-core/samtools/convert/main.nf @@ -50,7 +50,7 @@ process SAMTOOLS_CONVERT { """ touch ${prefix}.${output_extension} - touch ${prefix}.${index_extension} + touch ${prefix}.${output_extension}.${index_extension} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/convert/tests/main.nf.test.snap b/modules/nf-core/samtools/convert/tests/main.nf.test.snap index a021254e8b..a7bff30d5c 100644 --- a/modules/nf-core/samtools/convert/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/convert/tests/main.nf.test.snap @@ -67,7 +67,7 @@ "id": "test", "single_end": false }, - "test.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "4": [ @@ -85,7 +85,7 @@ "id": "test", "single_end": false }, - "test.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "cram": [ @@ -103,10 +103,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-16T07:52:45.799885099" + "timestamp": "2025-03-17T17:05:45.33625491" }, "bam_to_cram_index": { "content": [ diff --git a/modules/nf-core/samtools/convert/tests/tags.yml b/modules/nf-core/samtools/convert/tests/tags.yml deleted file mode 100644 index 030d5eb5ea..0000000000 --- a/modules/nf-core/samtools/convert/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/convert: - - "modules/nf-core/samtools/convert/**" diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf index 28c0a81cf7..6de0095d86 100644 --- a/modules/nf-core/samtools/faidx/main.nf +++ b/modules/nf-core/samtools/faidx/main.nf @@ -10,9 +10,11 @@ process SAMTOOLS_FAIDX { input: tuple val(meta), path(fasta) tuple val(meta2), path(fai) + val get_sizes output: - tuple val(meta), path ("*.{fa,fasta}") , emit: fa , optional: true + tuple val(meta), path ("*.{fa,fasta}") , emit: fa, optional: true + tuple val(meta), path ("*.sizes") , emit: sizes, optional: true tuple val(meta), path ("*.fai") , emit: fai, optional: true tuple val(meta), path ("*.gzi") , emit: gzi, optional: true path "versions.yml" , emit: versions @@ -22,12 +24,15 @@ process SAMTOOLS_FAIDX { script: def args = task.ext.args ?: '' + def get_sizes_command = get_sizes ? "cut -f 1,2 ${fasta}.fai > ${fasta}.sizes" : '' """ samtools \\ faidx \\ $fasta \\ $args + ${get_sizes_command} + cat <<-END_VERSIONS > versions.yml "${task.process}": samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') @@ -37,9 +42,15 @@ process SAMTOOLS_FAIDX { stub: def match = (task.ext.args =~ /-o(?:utput)?\s(.*)\s?/).findAll() def fastacmd = match[0] ? "touch ${match[0][1]}" : '' + def get_sizes_command = get_sizes ? "touch ${fasta}.sizes" : '' """ ${fastacmd} touch ${fasta}.fai + if [[ "${fasta.extension}" == "gz" ]]; then + touch ${fasta}.gzi + fi + + ${get_sizes_command} cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml index 6721b2cb84..256a330a1c 100644 --- a/modules/nf-core/samtools/faidx/meta.yml +++ b/modules/nf-core/samtools/faidx/meta.yml @@ -1,9 +1,10 @@ name: samtools_faidx -description: Index FASTA file +description: Index FASTA file, and optionally generate a file of chromosome sizes keywords: - index - fasta - faidx + - chromosome tools: - samtools: description: | @@ -34,6 +35,10 @@ input: type: file description: FASTA index file pattern: "*.{fai}" + - - get_sizes: + type: boolean + description: use cut to get the sizes of the index (true) or not (false) + output: - fa: - meta: @@ -55,6 +60,16 @@ output: type: file description: FASTA index file pattern: "*.{fai}" + - sizes: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.sizes": + type: file + description: File containing chromosome lengths + pattern: "*.{sizes}" - gzi: - meta: type: map @@ -75,6 +90,5 @@ authors: - "@ewels" - "@phue" maintainers: - - "@drpatelh" - - "@ewels" + - "@maxulysse" - "@phue" diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test b/modules/nf-core/samtools/faidx/tests/main.nf.test index 17244ef2ee..64219b7d95 100644 --- a/modules/nf-core/samtools/faidx/tests/main.nf.test +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test @@ -16,8 +16,8 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[1] = [[],[]] + input[2] = false """ } } @@ -37,8 +37,8 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)] - input[1] = [[],[]] + input[2] = false """ } } @@ -60,9 +60,9 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[1] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + input[2] = false """ } } @@ -84,9 +84,9 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[1] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + input[2] = false """ } } @@ -106,8 +106,8 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[1] = [[],[]] + input[2] = false """ } } @@ -119,4 +119,101 @@ nextflow_process { ) } } + + test("test_samtools_faidx_get_sizes") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = [[],[]] + input[2] = true + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_get_sizes_bgzip") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) + ]) + input[1] = [[],[]] + input[2] = true + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_get_sizes - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = [[],[]] + input[2] = true + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_get_sizes_bgzip - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) + ]) + input[1] = [[],[]] + input[2] = true + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + } \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap index 1bbb3ec2b0..7372241482 100644 --- a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap @@ -6,6 +6,9 @@ ], "1": [ + + ], + "2": [ [ { "id": "test", @@ -14,10 +17,10 @@ "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" ] ], - "2": [ + "3": [ ], - "3": [ + "4": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" ], "fa": [ @@ -34,6 +37,9 @@ ], "gzi": [ + ], + "sizes": [ + ], "versions": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" @@ -41,10 +47,142 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.1" + }, + "timestamp": "2024-11-20T17:31:48.258623157" + }, + "test_samtools_faidx_get_sizes_bgzip - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,e3e4ba35a02020d173be8d1ee04eaebf" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gzi": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e3e4ba35a02020d173be8d1ee04eaebf" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.1" }, - "timestamp": "2024-09-16T07:57:47.450887871" + "timestamp": "2024-11-20T17:32:41.122428188" + }, + "test_samtools_faidx_get_sizes": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "3": [ + + ], + "4": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.1" + }, + "timestamp": "2024-11-20T17:34:02.353546697" }, "test_samtools_faidx_bgzip": { "content": [ @@ -53,6 +191,9 @@ ], "1": [ + + ], + "2": [ [ { "id": "test", @@ -61,7 +202,7 @@ "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" ] ], - "2": [ + "3": [ [ { "id": "test", @@ -70,7 +211,7 @@ "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" ] ], - "3": [ + "4": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" ], "fa": [ @@ -93,6 +234,9 @@ }, "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" ] + ], + "sizes": [ + ], "versions": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" @@ -100,10 +244,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.1" }, - "timestamp": "2024-09-16T07:58:04.804905659" + "timestamp": "2024-11-20T17:31:55.157487176" }, "test_samtools_faidx_fasta": { "content": [ @@ -124,6 +268,9 @@ ], "3": [ + + ], + "4": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" ], "fa": [ @@ -140,6 +287,9 @@ ], "gzi": [ + ], + "sizes": [ + ], "versions": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" @@ -147,10 +297,71 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.1" }, - "timestamp": "2024-09-16T07:58:23.831268154" + "timestamp": "2024-11-20T17:32:02.149455586" + }, + "test_samtools_faidx_get_sizes - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + "versions.yml:md5,e3e4ba35a02020d173be8d1ee04eaebf" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gzi": [ + + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e3e4ba35a02020d173be8d1ee04eaebf" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.1" + }, + "timestamp": "2024-11-20T17:32:34.29376776" }, "test_samtools_faidx_stub_fasta": { "content": [ @@ -171,6 +382,9 @@ ], "3": [ + + ], + "4": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" ], "fa": [ @@ -187,6 +401,9 @@ ], "gzi": [ + ], + "sizes": [ + ], "versions": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" @@ -194,10 +411,10 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.1" }, - "timestamp": "2024-09-16T07:58:35.600243706" + "timestamp": "2024-11-20T17:32:09.125065185" }, "test_samtools_faidx_stub_fai": { "content": [ @@ -206,6 +423,9 @@ ], "1": [ + + ], + "2": [ [ { "id": "test", @@ -214,10 +434,10 @@ "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" ] ], - "2": [ + "3": [ ], - "3": [ + "4": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" ], "fa": [ @@ -234,6 +454,80 @@ ], "gzi": [ + ], + "sizes": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.1" + }, + "timestamp": "2024-11-20T17:32:16.274287863" + }, + "test_samtools_faidx_get_sizes_bgzip": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "3": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "4": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] ], "versions": [ "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" @@ -241,9 +535,9 @@ } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.1" }, - "timestamp": "2024-09-16T07:58:54.705460167" + "timestamp": "2024-11-20T17:32:28.117654855" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/tags.yml b/modules/nf-core/samtools/faidx/tests/tags.yml deleted file mode 100644 index e4a839481d..0000000000 --- a/modules/nf-core/samtools/faidx/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/faidx: - - modules/nf-core/samtools/faidx/** diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml deleted file mode 100644 index e0f58a7a3f..0000000000 --- a/modules/nf-core/samtools/index/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/index: - - modules/nf-core/samtools/index/** diff --git a/modules/nf-core/samtools/merge/tests/tags.yml b/modules/nf-core/samtools/merge/tests/tags.yml deleted file mode 100644 index b869abcb81..0000000000 --- a/modules/nf-core/samtools/merge/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/merge: - - "modules/nf-core/samtools/merge/**" diff --git a/modules/nf-core/samtools/mpileup/tests/tags.yml b/modules/nf-core/samtools/mpileup/tests/tags.yml deleted file mode 100644 index 40332674a1..0000000000 --- a/modules/nf-core/samtools/mpileup/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/mpileup: - - "modules/nf-core/samtools/mpileup/**" diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf index 493525a9e0..4443948b72 100644 --- a/modules/nf-core/samtools/stats/main.nf +++ b/modules/nf-core/samtools/stats/main.nf @@ -19,7 +19,6 @@ process SAMTOOLS_STATS { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" def reference = fasta ? "--reference ${fasta}" : "" """ diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml deleted file mode 100644 index 7c28e30f3f..0000000000 --- a/modules/nf-core/samtools/stats/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/stats: - - modules/nf-core/samtools/stats/** diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml index 62054fc97a..8cae5712d5 100644 --- a/modules/nf-core/samtools/view/environment.yml +++ b/modules/nf-core/samtools/view/environment.yml @@ -4,5 +4,6 @@ channels: - conda-forge - bioconda dependencies: + # renovate: datasource=conda depName=bioconda/htslib - bioconda::htslib=1.21 - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index 37e05cec88..f43a4c6e72 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -11,6 +11,7 @@ process SAMTOOLS_VIEW { tuple val(meta), path(input), path(index) tuple val(meta2), path(fasta) path qname + val index_format output: tuple val(meta), path("${prefix}.bam"), emit: bam, optional: true @@ -20,7 +21,7 @@ process SAMTOOLS_VIEW { tuple val(meta), path("${prefix}.${file_type}.csi"), emit: csi, optional: true tuple val(meta), path("${prefix}.${file_type}.crai"), emit: crai, optional: true tuple val(meta), path("${prefix}.unselected.${file_type}"), emit: unselected, optional: true - tuple val(meta), path("${prefix}.unselected.${file_type}.{bai,csi,crsi}"), emit: unselected_index, optional: true + tuple val(meta), path("${prefix}.unselected.${file_type}.{csi,crai}"), emit: unselected_index, optional: true path "versions.yml", emit: versions when: @@ -35,8 +36,19 @@ process SAMTOOLS_VIEW { args.contains("--output-fmt bam") ? "bam" : args.contains("--output-fmt cram") ? "cram" : input.getExtension() + + output_file = index_format ? "${prefix}.${file_type}##idx##${prefix}.${file_type}.${index_format} --write-index" : "${prefix}.${file_type}" + // Can't choose index type of unselected file readnames = qname ? "--qname-file ${qname} --output-unselected ${prefix}.unselected.${file_type}": "" + if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + if (index_format) { + if (!index_format.matches('bai|csi|crai')) { + error "Index format not one of bai, csi, crai." + } else if (file_type == "sam") { + error "Indexing not compatible with SAM output" + } + } """ samtools \\ view \\ @@ -44,7 +56,7 @@ process SAMTOOLS_VIEW { ${reference} \\ ${readnames} \\ $args \\ - -o ${prefix}.${file_type} \\ + -o ${output_file} \\ $input \\ $args2 @@ -61,13 +73,27 @@ process SAMTOOLS_VIEW { args.contains("--output-fmt bam") ? "bam" : args.contains("--output-fmt cram") ? "cram" : input.getExtension() - if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" - - def index = args.contains("--write-index") ? "touch ${prefix}.${file_type}.csi" : "" + default_index_format = + file_type == "bam" ? "csi" : + file_type == "cram" ? "crai" : "" + index = index_format ? "touch ${prefix}.${file_type}.${index_format}" : args.contains("--write-index") ? "touch ${prefix}.${file_type}.${default_index_format}" : "" + unselected = qname ? "touch ${prefix}.unselected.${file_type}" : "" + // Can't choose index type of unselected file + unselected_index = qname && (args.contains("--write-index") || index_format) ? "touch ${prefix}.unselected.${file_type}.${default_index_format}" : "" + if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + if (index_format) { + if (!index_format.matches('bai|csi|crai')) { + error "Index format not one of bai, csi, crai." + } else if (file_type == "sam") { + error "Indexing not compatible with SAM output." + } + } """ touch ${prefix}.${file_type} ${index} + ${unselected} + ${unselected_index} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml index caa7b0150d..28c268a657 100644 --- a/modules/nf-core/samtools/view/meta.yml +++ b/modules/nf-core/samtools/view/meta.yml @@ -43,6 +43,10 @@ input: type: file description: Optional file with read names to output only select alignments pattern: "*.{txt,list}" + - - index_format: + type: string + description: Index format, used together with ext.args = '--write-index' + pattern: "bai|csi|crai" output: - bam: - meta: @@ -120,10 +124,10 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - - ${prefix}.unselected.${file_type}.{bai,csi,crsi}: + - ${prefix}.unselected.${file_type}.{csi,crai}: type: file description: index for the "unselected" file - pattern: "*.unselected.{bai,csi,crai}" + pattern: "*.unselected.{csi,crai}" - versions: - versions.yml: type: file diff --git a/modules/nf-core/samtools/view/tests/cram_index.config b/modules/nf-core/samtools/view/tests/cram_index.config new file mode 100644 index 0000000000..ed87c3349d --- /dev/null +++ b/modules/nf-core/samtools/view/tests/cram_index.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt cram --write-index" +} diff --git a/modules/nf-core/samtools/view/tests/main.nf.test b/modules/nf-core/samtools/view/tests/main.nf.test index 37b81a9163..d8551dd8c6 100644 --- a/modules/nf-core/samtools/view/tests/main.nf.test +++ b/modules/nf-core/samtools/view/tests/main.nf.test @@ -21,6 +21,7 @@ nextflow_process { ]) input[1] = [[],[]] input[2] = [] + input[3] = [] """ } } @@ -39,6 +40,135 @@ nextflow_process { } } + test("bam_csi_index") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = [] + input[3] = 'csi' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.csi[0][1]).name, + process.out.versions).match() + } + ) + } + } + + test("bam_bai_index") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = [] + input[3] = 'bai' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.bai[0][1]).name, + process.out.versions).match() } + ) + } + } + + test("bam_bai_index_unselected") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = Channel.of('testN:1') + .collectFile(name: 'selected_reads.txt') + input[3] = 'bai' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.bai[0][1]).name, + file(process.out.unselected[0][1]).name, + file(process.out.unselected_index[0][1]).name, + process.out.versions).match() + } + ) + } + } + + test("cram_crai_index_unselected") { + + config "./cram_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = Channel.of('testN:1') + .collectFile(name: 'selected_reads.txt') + input[3] = 'crai' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.cram[0][1]).name, + file(process.out.crai[0][1]).name, + file(process.out.unselected[0][1]).name, + file(process.out.unselected_index[0][1]).name, + process.out.versions).match() + } + ) + } + } + test("cram") { when { @@ -54,6 +184,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]) input[2] = [] + input[3] = [] """ } } @@ -89,6 +220,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]) input[2] = [] + input[3] = [] """ } } @@ -124,6 +256,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]) input[2] = [] + input[3] = [] """ } } @@ -159,6 +292,7 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]) input[2] = Channel.of("testN:2817", "testN:2814").collectFile(name: "readnames.list", newLine: true) + input[3] = [] """ } } @@ -194,6 +328,7 @@ nextflow_process { ]) input[1] = [[],[]] input[2] = [] + input[3] = [] """ } } @@ -211,4 +346,118 @@ nextflow_process { ) } } + + test("bam_csi_index - stub") { + + options "-stub" + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = [] + input[3] = 'csi' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("bam_bai_index - stub") { + + options "-stub" + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = [] + input[3] = 'bai' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("bam_bai_index_uselected - stub") { + + options "-stub" + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = Channel.of('testN:1') + .collectFile(name: 'selected_reads.txt') + input[3] = 'bai' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("cram_crai_index_unselected - stub") { + + options "-stub" + config "./cram_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = Channel.of('testN:1') + .collectFile(name: 'selected_reads.txt') + input[3] = 'crai' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/samtools/view/tests/main.nf.test.snap b/modules/nf-core/samtools/view/tests/main.nf.test.snap index 63849b037b..1cb793f270 100644 --- a/modules/nf-core/samtools/view/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/view/tests/main.nf.test.snap @@ -9,16 +9,6 @@ }, "timestamp": "2024-02-12T19:37:51.256068" }, - "cram_to_bam_index_csi": { - "content": [ - "test.bam.csi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" - }, - "timestamp": "2024-02-12T19:38:12.958617" - }, "bam_stub_bam": { "content": [ "test.bam" @@ -60,36 +50,32 @@ ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-09-16T09:26:24.461775464" + "timestamp": "2025-02-14T07:43:43.6526401" }, - "cram_to_bam_index_cram": { + "cram_to_bam_index_qname_csi": { "content": [ - [ - - ] + "test.bam.csi" ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:12.972288" + "timestamp": "2024-02-12T19:38:23.325496" }, - "cram_to_bam_sam": { + "cram_to_bam_index_qname_unselected_csi": { "content": [ - [ - - ] + "test.unselected.bam.csi" ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:04.999247" + "timestamp": "2024-02-12T19:38:23.328458" }, - "cram_to_bam_index_sam": { + "bam_csi": { "content": [ [ @@ -99,55 +85,182 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:12.976457" + "timestamp": "2024-02-12T19:37:51.262882" }, - "cram_crai": { + "cram_to_bam_index_bam": { "content": [ - [ - - ] + "test.bam" ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:56.497581" + "timestamp": "2024-02-12T19:38:12.95456" }, - "cram_csi": { + "cram_to_bam_index_versions": { "content": [ [ - + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-12T19:37:56.50038" + "timestamp": "2024-09-16T09:25:14.475388399" }, - "cram_to_bam_cram": { + "bam_csi_index": { "content": [ + "test.bam", + "test.bam.csi", [ - + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-02-12T19:38:04.992239" + "timestamp": "2025-02-14T07:45:19.718077276" }, - "cram_to_bam_index_qname_csi": { + "bam_versions": { "content": [ - "test.bam.csi" + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-02-13T16:13:00.739468586" + }, + "cram_crai_index_unselected - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ], + "bai": [ + + ], + "bam": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + [ + { + "id": "test", + "single_end": false + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "sam": [ + + ], + "unselected": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "unselected_index": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-02-14T07:47:20.903462221" + }, + "bam_crai": { + "content": [ + [ + + ] ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.325496" + "timestamp": "2024-02-12T19:37:51.259774" }, - "bam_stub_sam": { + "bam_cram": { "content": [ [ @@ -157,29 +270,33 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:32.079529" + "timestamp": "2024-02-12T19:37:51.261287" }, - "cram_cram": { + "cram_sam": { "content": [ - "test.cram" + [ + + ] ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:56.490286" + "timestamp": "2024-02-12T19:37:56.502625" }, - "cram_to_bam_index_qname_unselected_csi": { + "cram_versions": { "content": [ - "test.unselected.bam.csi" + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-02-12T19:38:23.328458" + "timestamp": "2025-02-13T16:33:28.319991831" }, - "bam_csi": { + "cram_to_bam_index_bai": { "content": [ [ @@ -189,9 +306,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:51.262882" + "timestamp": "2024-02-12T19:38:12.962863" }, - "cram_to_bam_crai": { + "cram_to_bam_index_qname_sam": { "content": [ [ @@ -201,65 +318,247 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:04.989247" + "timestamp": "2024-02-12T19:38:23.337634" }, - "cram_to_bam_index_crai": { + "bam_csi_index - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ], + "bai": [ + + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + + ], + "unselected": [ + + ], + "unselected_index": [ + + ], + "versions": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-02-14T07:46:52.477256747" + }, + "cram_to_bam_index_csi": { "content": [ - [ - - ] + "test.bam.csi" ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:12.967681" + "timestamp": "2024-02-12T19:38:12.958617" }, - "cram_to_bam_index_qname_versions": { + "bam_bai_index": { "content": [ + "test.bam", + "test.bam.bai", [ "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-09-16T09:25:51.953436682" + "timestamp": "2025-02-14T07:45:29.205677197" }, - "cram_to_bam_bam": { + "cram_to_bam_index_cram": { "content": [ - "test.bam" + [ + + ] ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:04.982361" + "timestamp": "2024-02-12T19:38:12.972288" }, - "cram_to_bam_index_bam": { + "bam_bai_index - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + + ], + "sam": [ + + ], + "unselected": [ + + ], + "unselected_index": [ + + ], + "versions": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-02-14T07:51:10.220507926" + }, + "cram_to_bam_sam": { "content": [ - "test.bam" + [ + + ] ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:12.95456" + "timestamp": "2024-02-12T19:38:04.999247" }, - "cram_to_bam_index_versions": { + "cram_to_bam_index_sam": { "content": [ [ - "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.8.4", + "nextflow": "23.04.3" }, - "timestamp": "2024-09-16T09:25:14.475388399" + "timestamp": "2024-02-12T19:38:12.976457" }, - "cram_to_bam_bai": { + "cram_crai": { "content": [ [ @@ -269,21 +568,21 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:04.98601" + "timestamp": "2024-02-12T19:37:56.497581" }, - "cram_to_bam_versions": { + "cram_csi": { "content": [ [ - "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.8.4", + "nextflow": "23.04.3" }, - "timestamp": "2024-09-16T09:24:49.673441798" + "timestamp": "2024-02-12T19:37:56.50038" }, - "cram_bam": { + "cram_to_bam_cram": { "content": [ [ @@ -293,9 +592,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:56.495512" + "timestamp": "2024-02-12T19:38:04.992239" }, - "bam_stub_cram": { + "bam_stub_sam": { "content": [ [ @@ -305,21 +604,19 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:32.076908" + "timestamp": "2024-02-12T19:38:32.079529" }, - "cram_to_bam_index_qname_bai": { + "cram_cram": { "content": [ - [ - - ] + "test.cram" ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.328458" + "timestamp": "2024-02-12T19:37:56.490286" }, - "cram_to_bam_index_qname_crai": { + "cram_to_bam_crai": { "content": [ [ @@ -329,9 +626,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.330789" + "timestamp": "2024-02-12T19:38:04.989247" }, - "cram_bai": { + "cram_to_bam_index_crai": { "content": [ [ @@ -341,63 +638,71 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:56.493129" + "timestamp": "2024-02-12T19:38:12.967681" }, - "bam_stub_crai": { + "cram_crai_index_unselected": { "content": [ + "test.cram", + "test.cram.crai", + "test.unselected.cram", + "test.unselected.cram.crai", [ - + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-02-12T19:38:32.074313" + "timestamp": "2025-02-14T07:45:48.461930073" }, - "cram_to_bam_index_qname_bam": { + "cram_to_bam_index_qname_versions": { "content": [ - "test.bam" + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-12T19:38:23.322874" + "timestamp": "2024-09-16T09:25:51.953436682" }, - "cram_to_bam_index_qname_unselected": { + "cram_to_bam_bam": { "content": [ - "test.unselected.bam" + "test.bam" ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.322874" + "timestamp": "2024-02-12T19:38:04.982361" }, - "cram_to_bam_index_qname_unselected_csi": { + "cram_to_bam_bai": { "content": [ - "test.unselected.bam.csi" + [ + + ] ], "meta": { "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.328458" + "timestamp": "2024-02-12T19:38:04.98601" }, - "bam_versions": { + "cram_to_bam_versions": { "content": [ [ "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.3" }, - "timestamp": "2024-09-16T09:23:27.151650338" + "timestamp": "2025-02-13T16:33:39.363718229" }, - "cram_to_bam_index_qname_cram": { + "cram_bam": { "content": [ [ @@ -407,9 +712,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.333248" + "timestamp": "2024-02-12T19:37:56.495512" }, - "bam_crai": { + "bam_stub_cram": { "content": [ [ @@ -419,9 +724,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:51.259774" + "timestamp": "2024-02-12T19:38:32.076908" }, - "bam_cram": { + "cram_to_bam_index_qname_bai": { "content": [ [ @@ -431,9 +736,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:51.261287" + "timestamp": "2024-02-12T19:38:23.328458" }, - "cram_to_bam_csi": { + "cram_to_bam_index_qname_crai": { "content": [ [ @@ -443,9 +748,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:04.995454" + "timestamp": "2024-02-12T19:38:23.330789" }, - "cram_sam": { + "cram_bai": { "content": [ [ @@ -455,23 +760,23 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:56.502625" + "timestamp": "2024-02-12T19:37:56.493129" }, - "cram_versions": { + "bam_stub_crai": { "content": [ [ - "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.8.4", + "nextflow": "23.04.3" }, - "timestamp": "2024-09-16T09:24:12.95416913" + "timestamp": "2024-02-12T19:38:32.074313" }, - "cram_to_bam_index_qname_unselected": { + "cram_to_bam_index_qname_bam": { "content": [ - "test.unselected.bam" + "test.bam" ], "meta": { "nf-test": "0.8.4", @@ -479,7 +784,23 @@ }, "timestamp": "2024-02-12T19:38:23.322874" }, - "bam_sam": { + "bam_bai_index_unselected": { + "content": [ + "test.bam", + "test.bam.bai", + "test.unselected.bam", + "test.unselected.bam.csi", + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-02-14T07:45:38.993014707" + }, + "cram_to_bam_index_qname_cram": { "content": [ [ @@ -489,9 +810,9 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:37:51.264651" + "timestamp": "2024-02-12T19:38:23.333248" }, - "cram_to_bam_index_bai": { + "cram_to_bam_csi": { "content": [ [ @@ -501,9 +822,132 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:12.962863" + "timestamp": "2024-02-12T19:38:04.995454" }, - "cram_to_bam_index_qname_sam": { + "bam_bai_index_uselected - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + + ], + "sam": [ + + ], + "unselected": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "unselected_index": [ + [ + { + "id": "test", + "single_end": false + }, + "test.unselected.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-02-14T07:51:24.947216832" + }, + "cram_to_bam_index_qname_unselected": { + "content": [ + "test.unselected.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.322874" + }, + "bam_sam": { "content": [ [ @@ -513,7 +957,7 @@ "nf-test": "0.8.4", "nextflow": "23.04.3" }, - "timestamp": "2024-02-12T19:38:23.337634" + "timestamp": "2024-02-12T19:37:51.264651" }, "bam_stub_csi": { "content": [ diff --git a/modules/nf-core/samtools/view/tests/tags.yml b/modules/nf-core/samtools/view/tests/tags.yml deleted file mode 100644 index 4fdf1dd12e..0000000000 --- a/modules/nf-core/samtools/view/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -samtools/view: - - "modules/nf-core/samtools/view/**" diff --git a/modules/nf-core/sentieon/applyvarcal/environment.yml b/modules/nf-core/sentieon/applyvarcal/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/applyvarcal/environment.yml +++ b/modules/nf-core/sentieon/applyvarcal/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/bwamem/environment.yml b/modules/nf-core/sentieon/bwamem/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/bwamem/environment.yml +++ b/modules/nf-core/sentieon/bwamem/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/bwamem/tests/tags.yml b/modules/nf-core/sentieon/bwamem/tests/tags.yml deleted file mode 100644 index fbc2bb3cc2..0000000000 --- a/modules/nf-core/sentieon/bwamem/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -sentieon/bwamem: - - "modules/nf-core/sentieon/bwamem/**" diff --git a/modules/nf-core/sentieon/dedup/environment.yml b/modules/nf-core/sentieon/dedup/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/dedup/environment.yml +++ b/modules/nf-core/sentieon/dedup/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/dnamodelapply/environment.yml b/modules/nf-core/sentieon/dnamodelapply/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/dnamodelapply/environment.yml +++ b/modules/nf-core/sentieon/dnamodelapply/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/dnascope/environment.yml b/modules/nf-core/sentieon/dnascope/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/dnascope/environment.yml +++ b/modules/nf-core/sentieon/dnascope/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/gvcftyper/environment.yml b/modules/nf-core/sentieon/gvcftyper/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/gvcftyper/environment.yml +++ b/modules/nf-core/sentieon/gvcftyper/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config b/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config index 1561a7c4d2..0b55bb5ec2 100644 --- a/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config +++ b/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config @@ -4,7 +4,7 @@ env { // NOTE This should only happen in GitHub actions or nf-core MegaTests SENTIEON_AUTH_MECH = "$SENTIEON_AUTH_MECH" SENTIEON_AUTH_DATA = secrets.SENTIEON_AUTH_DATA - // NOTE This is how pipepline users will test out Sentieon with a license file + // NOTE This is how pipeline users will test out Sentieon with a license file // nextflow secrets set SENTIEON_LICENSE_BASE64 \$(cat | base64 -w 0) } diff --git a/modules/nf-core/sentieon/haplotyper/environment.yml b/modules/nf-core/sentieon/haplotyper/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/haplotyper/environment.yml +++ b/modules/nf-core/sentieon/haplotyper/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/sentieon/haplotyper/tests/tags.yml b/modules/nf-core/sentieon/haplotyper/tests/tags.yml deleted file mode 100644 index 3178c146c0..0000000000 --- a/modules/nf-core/sentieon/haplotyper/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -sentieon/haplotyper: - - "modules/nf-core/sentieon/haplotyper/**" diff --git a/modules/nf-core/sentieon/varcal/environment.yml b/modules/nf-core/sentieon/varcal/environment.yml index d7abf668ea..6449d0dbb9 100644 --- a/modules/nf-core/sentieon/varcal/environment.yml +++ b/modules/nf-core/sentieon/varcal/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/snpeff/snpeff/tests/tags.yml b/modules/nf-core/snpeff/snpeff/tests/tags.yml deleted file mode 100644 index 427b588dfe..0000000000 --- a/modules/nf-core/snpeff/snpeff/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -snpeff/snpeff: - - "modules/nf-core/snpeff/snpeff/**" diff --git a/modules/nf-core/spring/decompress/environment.yml b/modules/nf-core/spring/decompress/environment.yml index abeb16b095..2e0329f7b4 100644 --- a/modules/nf-core/spring/decompress/environment.yml +++ b/modules/nf-core/spring/decompress/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/spring/decompress/test/tags.yml b/modules/nf-core/spring/decompress/test/tags.yml deleted file mode 100644 index 1fe70aec91..0000000000 --- a/modules/nf-core/spring/decompress/test/tags.yml +++ /dev/null @@ -1,3 +0,0 @@ -spring/decompress: - - modules/nf-core/spring/compress/** - - modules/nf-core/spring/decompress/** diff --git a/modules/nf-core/spring/decompress/test/main.nf.test b/modules/nf-core/spring/decompress/tests/main.nf.test similarity index 99% rename from modules/nf-core/spring/decompress/test/main.nf.test rename to modules/nf-core/spring/decompress/tests/main.nf.test index 9428a86bcf..c7ac2b1f3e 100644 --- a/modules/nf-core/spring/decompress/test/main.nf.test +++ b/modules/nf-core/spring/decompress/tests/main.nf.test @@ -4,12 +4,11 @@ nextflow_process { tag "modules_nfcore" tag "modules" tag "spring" + tag "spring/compress" tag "spring/decompress" script "../main.nf" process "SPRING_DECOMPRESS" - - test("Write-One-File") { setup { diff --git a/modules/nf-core/spring/decompress/test/main.nf.test.snap b/modules/nf-core/spring/decompress/tests/main.nf.test.snap similarity index 100% rename from modules/nf-core/spring/decompress/test/main.nf.test.snap rename to modules/nf-core/spring/decompress/tests/main.nf.test.snap diff --git a/modules/nf-core/spring/decompress/test/nextflow.config b/modules/nf-core/spring/decompress/tests/nextflow.config similarity index 100% rename from modules/nf-core/spring/decompress/test/nextflow.config rename to modules/nf-core/spring/decompress/tests/nextflow.config diff --git a/modules/nf-core/strelka/germline/environment.yml b/modules/nf-core/strelka/germline/environment.yml index 052c6baa5f..33edb70c4a 100644 --- a/modules/nf-core/strelka/germline/environment.yml +++ b/modules/nf-core/strelka/germline/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/strelka/somatic/environment.yml b/modules/nf-core/strelka/somatic/environment.yml index 052c6baa5f..33edb70c4a 100644 --- a/modules/nf-core/strelka/somatic/environment.yml +++ b/modules/nf-core/strelka/somatic/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/strelka/somatic/tests/tags.yml b/modules/nf-core/strelka/somatic/tests/tags.yml deleted file mode 100644 index 23d3f34173..0000000000 --- a/modules/nf-core/strelka/somatic/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -strelka/somatic: - - "modules/nf-core/strelka/somatic/**" diff --git a/modules/nf-core/svdb/merge/environment.yml b/modules/nf-core/svdb/merge/environment.yml index ab87ec70a1..dc587136eb 100644 --- a/modules/nf-core/svdb/merge/environment.yml +++ b/modules/nf-core/svdb/merge/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/svdb/merge/main.nf b/modules/nf-core/svdb/merge/main.nf index 5b19a29931..104f5ad799 100644 --- a/modules/nf-core/svdb/merge/main.nf +++ b/modules/nf-core/svdb/merge/main.nf @@ -1,6 +1,6 @@ process SVDB_MERGE { tag "$meta.id" - label 'process_medium' + label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/mulled-v2-375a758a4ca8c128fb9d38047a68a9f4322d2acd:b3615e06ef17566f2988a215ce9e10808c1d08bf-0': @@ -34,7 +34,7 @@ process SVDB_MERGE { def prio = "" if (input_priority) { if (vcfs.collect().size() > 1 && sort_inputs) { - // make vcf-prioprity pairs and sort on VCF name, so priority is also sorted the same + // make vcf-priority pairs and sort on VCF name, so priority is also sorted the same def pairs = vcfs.indices.collect { [vcfs[it], input_priority[it]] } pairs = pairs.sort { a, b -> a[0].name <=> b[0].name } vcfs = pairs.collect { it[0] } @@ -45,10 +45,10 @@ process SVDB_MERGE { // Build inputs prio = "--priority ${input_priority.join(',')}" - input = "" - for (int index = 0; index < vcfs.collect().size(); index++) { - input += "${vcfs[index]}:${priority[index]} " - } + input = vcfs + .withIndex() + .collect { vcf, index -> "${vcf}:${priority[index]}" } + .join(" ") } else { // if there's no priority input just sort the vcfs by name if possible @@ -59,7 +59,7 @@ process SVDB_MERGE { args2.contains("--output-type u") || args2.contains("-Ou") ? "bcf" : args2.contains("--output-type z") || args2.contains("-Oz") ? "vcf.gz" : args2.contains("--output-type v") || args2.contains("-Ov") ? "vcf" : - "vcf" + "vcf.gz" """ svdb \\ --merge \\ @@ -67,6 +67,7 @@ process SVDB_MERGE { $prio \\ --vcf $input |\\ bcftools view \\ + $args2 \\ --threads ${task.cpus} \\ --output ${prefix}.${extension} @@ -84,13 +85,13 @@ process SVDB_MERGE { args2.contains("--output-type u") || args2.contains("-Ou") ? "bcf" : args2.contains("--output-type z") || args2.contains("-Oz") ? "vcf.gz" : args2.contains("--output-type v") || args2.contains("-Ov") ? "vcf" : - "vcf" - def index = args2.contains("--write-index=tbi") || args2.contains("-W=tbi") ? "tbi" : + "vcf.gz" + def index_type = args2.contains("--write-index=tbi") || args2.contains("-W=tbi") ? "tbi" : args2.contains("--write-index=csi") || args2.contains("-W=csi") ? "csi" : args2.contains("--write-index") || args2.contains("-W") ? "csi" : "" def create_cmd = extension.endsWith(".gz") ? "echo '' | gzip >" : "touch" - def create_index = extension.endsWith(".gz") && index.matches("csi|tbi") ? "touch ${prefix}.${extension}.${index}" : "" + def create_index = extension.endsWith(".gz") && index_type.matches("csi|tbi") ? "touch ${prefix}.${extension}.${index_type}" : "" """ ${create_cmd} ${prefix}.${extension} ${create_index} diff --git a/modules/nf-core/svdb/merge/tests/tags.yml b/modules/nf-core/svdb/merge/tests/tags.yml deleted file mode 100644 index 8501d90729..0000000000 --- a/modules/nf-core/svdb/merge/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -svdb/merge: - - modules/nf-core/svdb/merge/** diff --git a/modules/nf-core/tabix/bgziptabix/environment.yml b/modules/nf-core/tabix/bgziptabix/environment.yml index 017c259da1..6221bb53a1 100644 --- a/modules/nf-core/tabix/bgziptabix/environment.yml +++ b/modules/nf-core/tabix/bgziptabix/environment.yml @@ -1,7 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::htslib=1.20 + - bioconda::htslib=1.21 - bioconda::tabix=1.11 diff --git a/modules/nf-core/tabix/bgziptabix/main.nf b/modules/nf-core/tabix/bgziptabix/main.nf index 22f37a7739..f295c7f2bb 100644 --- a/modules/nf-core/tabix/bgziptabix/main.nf +++ b/modules/nf-core/tabix/bgziptabix/main.nf @@ -4,8 +4,8 @@ process TABIX_BGZIPTABIX { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/htslib:1.20--h5efdd21_2' : - 'biocontainers/htslib:1.20--h5efdd21_2' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/92/92859404d861ae01afb87e2b789aebc71c0ab546397af890c7df74e4ee22c8dd/data' : + 'community.wave.seqera.io/library/htslib:1.21--ff8e28a189fbecaa' }" input: tuple val(meta), path(input) diff --git a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test index 4d4130dc07..cdb016e5de 100644 --- a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test +++ b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test @@ -1,7 +1,7 @@ nextflow_process { name "Test Process TABIX_BGZIPTABIX" - script "modules/nf-core/tabix/bgziptabix/main.nf" + script "../main.nf" process "TABIX_BGZIPTABIX" tag "modules" diff --git a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap index fb87799b20..5f81804535 100644 --- a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap +++ b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap @@ -15,7 +15,7 @@ ], "2": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ], "gz_csi": [ @@ -30,15 +30,15 @@ ] ], "versions": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T11:29:16.053817543" + "timestamp": "2025-03-26T13:52:30.53305451" }, "sarscov2_bed_csi": { "content": [ @@ -56,7 +56,7 @@ ] ], "2": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ], "gz_csi": [ [ @@ -71,15 +71,15 @@ ], "versions": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T11:29:27.667745444" + "timestamp": "2025-03-26T13:52:34.152301569" }, "csi_test": { "content": [ @@ -107,7 +107,7 @@ ], "2": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ], "gz_csi": [ @@ -122,15 +122,15 @@ ] ], "versions": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-25T14:45:18.533169949" + "timestamp": "2025-03-26T13:52:41.271812789" }, "csi_stub": { "content": [ @@ -178,7 +178,7 @@ ] ], "2": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ], "gz_csi": [ [ @@ -193,14 +193,14 @@ ], "versions": [ - "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" ] } ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-09-25T14:44:19.786135972" + "timestamp": "2025-03-26T13:52:37.709221651" } } \ No newline at end of file diff --git a/modules/nf-core/tabix/bgziptabix/tests/tags.yml b/modules/nf-core/tabix/bgziptabix/tests/tags.yml deleted file mode 100644 index 5052b4d708..0000000000 --- a/modules/nf-core/tabix/bgziptabix/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -tabix/bgziptabix: - - "modules/nf-core/tabix/bgziptabix/**" diff --git a/modules/nf-core/tabix/tabix/environment.yml b/modules/nf-core/tabix/tabix/environment.yml index fe48f5422a..6221bb53a1 100644 --- a/modules/nf-core/tabix/tabix/environment.yml +++ b/modules/nf-core/tabix/tabix/environment.yml @@ -5,5 +5,5 @@ channels: - bioconda dependencies: - - bioconda::htslib=1.20 + - bioconda::htslib=1.21 - bioconda::tabix=1.11 diff --git a/modules/nf-core/tabix/tabix/main.nf b/modules/nf-core/tabix/tabix/main.nf index 13acd670ea..325b8bbff8 100644 --- a/modules/nf-core/tabix/tabix/main.nf +++ b/modules/nf-core/tabix/tabix/main.nf @@ -4,8 +4,8 @@ process TABIX_TABIX { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/htslib:1.20--h5efdd21_2' : - 'biocontainers/htslib:1.20--h5efdd21_2' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/92/92859404d861ae01afb87e2b789aebc71c0ab546397af890c7df74e4ee22c8dd/data' : + 'community.wave.seqera.io/library/htslib:1.21--ff8e28a189fbecaa' }" input: tuple val(meta), path(tab) diff --git a/modules/nf-core/tabix/tabix/tests/main.nf.test b/modules/nf-core/tabix/tabix/tests/main.nf.test index 102b0d7bf3..e74afd926d 100644 --- a/modules/nf-core/tabix/tabix/tests/main.nf.test +++ b/modules/nf-core/tabix/tabix/tests/main.nf.test @@ -1,7 +1,7 @@ nextflow_process { name "Test Process TABIX_TABIX" - script "modules/nf-core/tabix/tabix/main.nf" + script "../main.nf" process "TABIX_TABIX" tag "modules" diff --git a/modules/nf-core/tabix/tabix/tests/main.nf.test.snap b/modules/nf-core/tabix/tabix/tests/main.nf.test.snap index c2b9ed0b80..67b8e3c2f9 100644 --- a/modules/nf-core/tabix/tabix/tests/main.nf.test.snap +++ b/modules/nf-core/tabix/tabix/tests/main.nf.test.snap @@ -14,7 +14,7 @@ ], "2": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ], "csi": [ @@ -28,16 +28,16 @@ ] ], "versions": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ] }, "genome.gff3.gz.tbi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T12:06:25.653807564" + "timestamp": "2025-03-26T13:52:48.638506004" }, "sarscov2_bedgz_tbi": { "content": [ @@ -54,7 +54,7 @@ ], "2": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ], "csi": [ @@ -68,16 +68,16 @@ ] ], "versions": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ] }, "test.bed.gz.tbi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T12:06:09.754082161" + "timestamp": "2025-03-26T13:52:44.910707349" }, "sarscov2_vcf_tbi": { "content": [ @@ -94,7 +94,7 @@ ], "2": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ], "csi": [ @@ -108,16 +108,16 @@ ] ], "versions": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ] }, "test.vcf.gz.tbi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T12:06:40.042648294" + "timestamp": "2025-03-26T13:52:52.405662623" }, "sarscov2_vcf_csi_stub": { "content": [ @@ -139,7 +139,7 @@ ] ], "2": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ], "csi": [ [ @@ -158,16 +158,16 @@ ] ], "versions": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ] }, "test.vcf.gz.csi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T12:07:08.700367261" + "timestamp": "2025-03-26T13:52:59.633992323" }, "sarscov2_vcf_csi": { "content": [ @@ -184,7 +184,7 @@ ] ], "2": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ], "csi": [ [ @@ -198,15 +198,15 @@ ], "versions": [ - "versions.yml:md5,07064637fb8a217174052be8e40234e2" + "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" ] }, "test.vcf.gz.csi" ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.2", + "nextflow": "24.10.5" }, - "timestamp": "2024-07-19T12:06:55.362067748" + "timestamp": "2025-03-26T13:52:56.083553332" } } \ No newline at end of file diff --git a/modules/nf-core/tabix/tabix/tests/tags.yml b/modules/nf-core/tabix/tabix/tests/tags.yml deleted file mode 100644 index 6eda065377..0000000000 --- a/modules/nf-core/tabix/tabix/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -tabix/tabix: - - "modules/nf-core/tabix/tabix/**" diff --git a/modules/nf-core/tiddit/sv/environment.yml b/modules/nf-core/tiddit/sv/environment.yml index 2fd01cfd4b..a33b14c85f 100644 --- a/modules/nf-core/tiddit/sv/environment.yml +++ b/modules/nf-core/tiddit/sv/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/tiddit/sv/tests/tags.yml b/modules/nf-core/tiddit/sv/tests/tags.yml deleted file mode 100644 index aac5351ecc..0000000000 --- a/modules/nf-core/tiddit/sv/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -tiddit/sv: - - "modules/nf-core/tiddit/sv/**" diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml index c7794856d8..9b926b1ffa 100644 --- a/modules/nf-core/untar/environment.yml +++ b/modules/nf-core/untar/environment.yml @@ -1,7 +1,12 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: + - conda-forge::coreutils=9.5 - conda-forge::grep=3.11 + - conda-forge::gzip=1.13 + - conda-forge::lbzip2=2.5 - conda-forge::sed=4.8 - conda-forge::tar=1.34 diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf index 9bd8f55461..e712ebe63a 100644 --- a/modules/nf-core/untar/main.nf +++ b/modules/nf-core/untar/main.nf @@ -1,46 +1,46 @@ process UNTAR { - tag "$archive" + tag "${archive}" label 'process_single' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : - 'nf-core/ubuntu:22.04' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/52/52ccce28d2ab928ab862e25aae26314d69c8e38bd41ca9431c67ef05221348aa/data' + : 'community.wave.seqera.io/library/coreutils_grep_gzip_lbzip2_pruned:838ba80435a629f8'}" input: tuple val(meta), path(archive) output: - tuple val(meta), path("$prefix"), emit: untar - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}"), emit: untar + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' + def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' - prefix = task.ext.prefix ?: ( meta.id ? "${meta.id}" : archive.baseName.toString().replaceFirst(/\.tar$/, "")) + prefix = task.ext.prefix ?: (meta.id ? "${meta.id}" : archive.baseName.toString().replaceFirst(/\.tar$/, "")) """ - mkdir $prefix + mkdir ${prefix} ## Ensures --strip-components only applied when top level of tar contents is a directory ## If just files or multiple directories, place all in prefix if [[ \$(tar -taf ${archive} | grep -o -P "^.*?\\/" | uniq | wc -l) -eq 1 ]]; then tar \\ - -C $prefix --strip-components 1 \\ + -C ${prefix} --strip-components 1 \\ -xavf \\ - $args \\ - $archive \\ - $args2 + ${args} \\ + ${archive} \\ + ${args2} else tar \\ - -C $prefix \\ + -C ${prefix} \\ -xavf \\ - $args \\ - $archive \\ - $args2 + ${args} \\ + ${archive} \\ + ${args2} fi cat <<-END_VERSIONS > versions.yml @@ -50,7 +50,7 @@ process UNTAR { """ stub: - prefix = task.ext.prefix ?: ( meta.id ? "${meta.id}" : archive.toString().replaceFirst(/\.[^\.]+(.gz)?$/, "")) + prefix = task.ext.prefix ?: (meta.id ? "${meta.id}" : archive.toString().replaceFirst(/\.[^\.]+(.gz)?$/, "")) """ mkdir ${prefix} ## Dry-run untaring the archive to get the files and place all in prefix diff --git a/modules/nf-core/untar/meta.yml b/modules/nf-core/untar/meta.yml index 290346b3fa..3a37bb35c5 100644 --- a/modules/nf-core/untar/meta.yml +++ b/modules/nf-core/untar/meta.yml @@ -28,9 +28,12 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - - $prefix: - type: directory - description: Directory containing contents of archive + pattern: "*/" + - ${prefix}: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] pattern: "*/" - versions: - versions.yml: diff --git a/modules/nf-core/untar/tests/tags.yml b/modules/nf-core/untar/tests/tags.yml deleted file mode 100644 index feb6f15c0c..0000000000 --- a/modules/nf-core/untar/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -untar: - - modules/nf-core/untar/** diff --git a/modules/nf-core/unzip/environment.yml b/modules/nf-core/unzip/environment.yml index e93c649f44..2461589539 100644 --- a/modules/nf-core/unzip/environment.yml +++ b/modules/nf-core/unzip/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/unzip/tests/tags.yml b/modules/nf-core/unzip/tests/tags.yml deleted file mode 100644 index 7f5647e120..0000000000 --- a/modules/nf-core/unzip/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -unzip: - - "modules/nf-core/unzip/**" diff --git a/modules/nf-core/vcftools/environment.yml b/modules/nf-core/vcftools/environment.yml index 7dcc752b86..ff0e9d03cd 100644 --- a/modules/nf-core/vcftools/environment.yml +++ b/modules/nf-core/vcftools/environment.yml @@ -1,3 +1,5 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda diff --git a/modules/nf-core/vcftools/main.nf b/modules/nf-core/vcftools/main.nf index 24e0fc3b0e..67bca9af0c 100644 --- a/modules/nf-core/vcftools/main.nf +++ b/modules/nf-core/vcftools/main.nf @@ -10,7 +10,7 @@ process VCFTOOLS { input: // Owing to the nature of vcftools we here provide solutions to working with optional bed files and optional // alternative variant files, for use with the 'diff' suite of tools. - // Other optional input files can be utilised in a similar way to below but we do not exhaustively itterate through all + // Other optional input files can be utilised in a similar way to below but we do not exhaustively iterate through all // possible options. Instead we leave that to the user. tuple val(meta), path(variant_file) path bed diff --git a/modules/nf-core/vcftools/meta.yml b/modules/nf-core/vcftools/meta.yml index b4c564ecaf..b9bae4df12 100644 --- a/modules/nf-core/vcftools/meta.yml +++ b/modules/nf-core/vcftools/meta.yml @@ -454,7 +454,7 @@ output: - "*.FORMAT": type: file description: Extracted information from the genotype fields in the VCF file - relating to a specfied FORMAT identifier (optional) + relating to a specified FORMAT identifier (optional) pattern: "*.FORMAT" - info: - meta: diff --git a/modules/nf-core/vcftools/tests/tags.yml b/modules/nf-core/vcftools/tests/tags.yml deleted file mode 100644 index f3afd43664..0000000000 --- a/modules/nf-core/vcftools/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -vcftools: - - "modules/nf-core/vcftools/**" diff --git a/subworkflows/nf-core/bam_ngscheckmate/main.nf b/subworkflows/nf-core/bam_ngscheckmate/main.nf index 629dbf25cd..d698dd3f24 100644 --- a/subworkflows/nf-core/bam_ngscheckmate/main.nf +++ b/subworkflows/nf-core/bam_ngscheckmate/main.nf @@ -11,10 +11,9 @@ workflow BAM_NGSCHECKMATE { main: ch_versions = Channel.empty() - - ch_input_bed = ch_input.combine(ch_snp_bed.collect()) + ch_input_bed = ch_input.combine(ch_snp_bed) // do something to combine the metas? - .map{ input_meta, input_file, bed_meta, bed_file -> + .map{ input_meta, input_file, _bed_meta, bed_file -> [input_meta, input_file, bed_file] } @@ -24,13 +23,13 @@ workflow BAM_NGSCHECKMATE { BCFTOOLS_MPILEUP .out .vcf - .map{meta, vcf -> vcf} // discard individual metas + .map{_meta, vcf -> vcf} // discard individual metas .collect() // group into one channel .map{files -> [files]} // make the channel into [vcf1, vcf2, ...] .set {ch_collected_vcfs} ch_snp_bed - .map{meta, bed -> meta} // use the snp_bed file meta as the meta for the merged channel + .map{meta, _bed -> meta} // use the snp_bed file meta as the meta for the merged channel .combine(ch_collected_vcfs) // add the vcf files after the meta, now looks like [meta, [vcf1, vcf2, ... ] ] .set {ch_vcfs} diff --git a/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test b/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test new file mode 100644 index 0000000000..8aabc9bfbf --- /dev/null +++ b/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test @@ -0,0 +1,147 @@ +nextflow_workflow { + + name "Test Subworkflow BAM_NGSCHECKMATE" + script "../main.nf" + workflow "BAM_NGSCHECKMATE" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/bam_ngscheckmate" + tag "samtools" + tag "samtools/sort" + tag "samtools/index" + tag "ngscheckmate/ncm" + tag "bcftools/mpileup" + + config "./nextflow.config" + + test("sarscov2 - bam") { + + when { + + workflow { + """ + + bed_file = file('test_snp.bed') + bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" + + input[0] = Channel.fromList([ + [ + [ id:'test1' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ], + [ + [ id:'test2' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ [id:'test_bed'], bed_file]) + input[2] = Channel.of([ + [ id:'sarscov2'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.corr_matrix, + file(workflow.out.matched[0][1]).name, + workflow.out.all, + workflow.out.vcf.collect {meta, vcf -> path(vcf).vcf.variantsMD5 }, + file(workflow.out.pdf[0][1]).name, + workflow.out.versions + ).match()} + ) + } + } + + test("sarscov2 - cram") { + + when { + + workflow { + """ + bed_file = file('test_snp.bed') + bed_file.text = "chr22\t1981\t1982\\nchr22\t2122\t2123\\nchr22\t3139\t3140\\nchr22\t3265\t3266\\nchr22\t3412\t3413" + + input[0] = Channel.fromList([[ + [ id:'test1' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ],[ + [ id:'test2' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ [id:'test_bed'], bed_file]) + input[2] = Channel.of([ + [ id:'homo_sapiens'], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.corr_matrix, + workflow.out.matched, + workflow.out.all, + workflow.out.vcf.collect {meta, vcf -> path(vcf).vcf.variantsMD5 }, + file(workflow.out.pdf[0][1]).name, + workflow.out.versions + ).match()} + ) + } + } + + test("sarscov2 - bam - stub") { + options "-stub" + when { + + workflow { + """ + + bed_file = file('test_snp.bed') + bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" + + input[0] = Channel.fromList([ + [ + [ id:'test1' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ], + [ + [ id:'test2' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ [id:'test_bed'], bed_file]) + input[2] = Channel.of([ + [ id:'sarscov2'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + file(workflow.out.corr_matrix[0][1]).name, + file(workflow.out.matched[0][1]).name, + file(workflow.out.all[0][1]).name, + // workflow.out.vcf.collect {meta, vcf -> path(vcf).vcf.variantsMD5 }, + file(workflow.out.pdf[0][1]).name, + workflow.out.versions + ).match()} + ) + } + } + +} diff --git a/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap b/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap new file mode 100644 index 0000000000..872274ec58 --- /dev/null +++ b/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap @@ -0,0 +1,99 @@ +{ + "sarscov2 - bam - stub": { + "content": [ + "test_bed_output_corr_matrix.txt", + "test_bed_matched.txt", + "test_bed_all.txt", + "test_bed.pdf", + [ + "versions.yml:md5,73d5516e0d2dd84537b11e5eabcbe3ab", + "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8", + "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T17:50:34.789565772" + }, + "sarscov2 - cram": { + "content": [ + [ + [ + { + "id": "test_bed" + }, + "test_bed_output_corr_matrix.txt:md5,640035b6c072a17ef24ae89845109763" + ] + ], + [ + [ + { + "id": "test_bed" + }, + "test_bed_matched.txt:md5,35339268c624c8bfda5d48d80ac6fbbc" + ] + ], + [ + [ + { + "id": "test_bed" + }, + "test_bed_all.txt:md5,35339268c624c8bfda5d48d80ac6fbbc" + ] + ], + [ + "d5b1e887b104cd33f18747abd377f47a", + "30feeb598a3730af169e3d14c56a05c2" + ], + "test_bed.pdf", + [ + "versions.yml:md5,73d5516e0d2dd84537b11e5eabcbe3ab", + "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8", + "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T16:46:55.771293323" + }, + "sarscov2 - bam": { + "content": [ + [ + [ + { + "id": "test_bed" + }, + "test_bed_output_corr_matrix.txt:md5,3a23347ff7071d5d8e273bfc29731d4a" + ] + ], + "test_bed_matched.txt", + [ + [ + { + "id": "test_bed" + }, + "test_bed_all.txt:md5,7e6ca5eb3daf6f589ea20fa117269edf" + ] + ], + [ + "9341ed6b9cca02d6b0b822308f4a48c6", + "3d6ba59b24dc0a699d9bd5a78bc76869" + ], + "test_bed.pdf", + [ + "versions.yml:md5,73d5516e0d2dd84537b11e5eabcbe3ab", + "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8", + "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.5" + }, + "timestamp": "2025-04-01T17:45:22.458317234" + } +} diff --git a/subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config b/subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config new file mode 100644 index 0000000000..7871837f5c --- /dev/null +++ b/subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config @@ -0,0 +1,9 @@ +process { + withName: ".*BAM_NGSCHECKMATE:BCFTOOLS_MPILEUP" { + ext.args2 = '--no-version --ploidy 1 -c' + ext.args3 = '--no-version' + } + withName: ".*BAM_NGSCHECKMATE:NGSCHECKMATE_NCM" { + ext.args = '-V' + } +} From c606e76ec8f8a398ab492c0edf99881059036c1e Mon Sep 17 00:00:00 2001 From: maxulysse Date: Tue, 29 Apr 2025 13:59:27 +0200 Subject: [PATCH 02/38] do not copy the tests --- modules/nf-core/ascat/tests/main.nf.test | 131 - modules/nf-core/ascat/tests/main.nf.test.snap | 373 --- modules/nf-core/ascat/tests/nextflow.config | 12 - .../bcftools/annotate/tests/bcf.config | 4 - .../bcftools/annotate/tests/main.nf.test | 374 --- .../bcftools/annotate/tests/main.nf.test.snap | 409 --- .../bcftools/annotate/tests/vcf.config | 4 - .../annotate/tests/vcf_gz_index.config | 4 - .../annotate/tests/vcf_gz_index_csi.config | 4 - .../annotate/tests/vcf_gz_index_tbi.config | 4 - .../bcftools/concat/tests/main.nf.test | 316 -- .../bcftools/concat/tests/main.nf.test.snap | 395 --- .../bcftools/concat/tests/nextflow.config | 3 - .../bcftools/concat/tests/vcf_gz_index.config | 4 - .../concat/tests/vcf_gz_index_csi.config | 4 - .../concat/tests/vcf_gz_index_tbi.config | 4 - .../bcftools/mpileup/tests/main.nf.test | 208 -- .../bcftools/mpileup/tests/main.nf.test.snap | 274 -- .../bcftools/mpileup/tests/nextflow.config | 4 - .../nf-core/bcftools/norm/tests/main.nf.test | 563 ---- .../bcftools/norm/tests/main.nf.test.snap | 758 ----- .../bcftools/norm/tests/nextflow.bcf.config | 4 - .../norm/tests/nextflow.bcf_gz.config | 4 - .../bcftools/norm/tests/nextflow.config | 4 - .../bcftools/norm/tests/nextflow.vcf.config | 4 - .../norm/tests/nextflow.vcf_gz.config | 4 - modules/nf-core/bcftools/norm/tests/tags.yml | 2 - .../bcftools/norm/tests/vcf_gz_index.config | 4 - .../norm/tests/vcf_gz_index_csi.config | 4 - .../norm/tests/vcf_gz_index_tbi.config | 4 - .../nf-core/bcftools/sort/tests/main.nf.test | 222 -- .../bcftools/sort/tests/main.nf.test.snap | 350 --- .../bcftools/sort/tests/vcf_gz_index.config | 4 - .../sort/tests/vcf_gz_index_csi.config | 4 - .../sort/tests/vcf_gz_index_tbi.config | 4 - .../nf-core/bcftools/stats/tests/main.nf.test | 182 -- .../bcftools/stats/tests/main.nf.test.snap | 180 -- modules/nf-core/bwa/index/tests/main.nf.test | 33 - .../nf-core/bwa/index/tests/main.nf.test.snap | 47 - modules/nf-core/bwa/mem/tests/main.nf.test | 260 -- .../nf-core/bwa/mem/tests/main.nf.test.snap | 271 -- .../nf-core/bwamem2/index/tests/main.nf.test | 31 - .../bwamem2/index/tests/main.nf.test.snap | 47 - .../nf-core/bwamem2/mem/tests/main.nf.test | 179 -- .../bwamem2/mem/tests/main.nf.test.snap | 129 - modules/nf-core/cat/cat/tests/main.nf.test | 191 -- .../nf-core/cat/cat/tests/main.nf.test.snap | 147 - .../cat/tests/nextflow_unzipped_zipped.config | 6 - .../cat/tests/nextflow_zipped_unzipped.config | 8 - modules/nf-core/cat/fastq/tests/main.nf.test | 334 --- .../nf-core/cat/fastq/tests/main.nf.test.snap | 416 --- .../cnvkit/antitarget/tests/main.nf.test | 58 - .../cnvkit/antitarget/tests/main.nf.test.snap | 68 - .../cnvkit/batch/tests/batch_hybrid.config | 6 - .../cnvkit/batch/tests/batch_pon.config | 6 - .../batch/tests/batch_tumouronly.config | 6 - .../cnvkit/batch/tests/batch_wgs.config | 6 - .../nf-core/cnvkit/batch/tests/main.nf.test | 289 -- .../cnvkit/batch/tests/main.nf.test.snap | 121 - .../nf-core/cnvkit/call/tests/main.nf.test | 83 - .../cnvkit/call/tests/main.nf.test.snap | 107 - .../nf-core/cnvkit/export/tests/main.nf.test | 191 -- .../cnvkit/export/tests/main.nf.test.snap | 247 -- .../cnvkit/export/tests/nextflow.config | 5 - .../cnvkit/genemetrics/tests/main.nf.test | 59 - .../genemetrics/tests/main.nf.test.snap | 72 - .../cnvkit/reference/tests/main.nf.test | 56 - .../cnvkit/reference/tests/main.nf.test.snap | 48 - .../assesssignificance/tests/main.nf.test | 159 - .../tests/main.nf.test.snap | 51 - .../assesssignificance/tests/nextflow.config | 23 - .../controlfreec/freec/tests/main.nf.test | 163 - .../freec/tests/main.nf.test.snap | 203 -- .../controlfreec/freec/tests/nextflow.config | 23 - .../controlfreec/freec2bed/tests/main.nf.test | 158 - .../freec2bed/tests/main.nf.test.snap | 61 - .../freec2bed/tests/nextflow.config | 23 - .../freec2circos/tests/main.nf.test | 158 - .../freec2circos/tests/main.nf.test.snap | 61 - .../freec2circos/tests/nextflow.config | 23 - .../makegraph2/tests/main.nf.test | 161 - .../makegraph2/tests/main.nf.test.snap | 79 - .../makegraph2/tests/nextflow.config | 23 - .../rundeepvariant/tests/main.nf.test | 166 -- .../rundeepvariant/tests/main.nf.test.snap | 358 --- .../tests/nextflow-intervals.config | 8 - .../nextflow-non-autosomal-calling.config | 8 - .../rundeepvariant/tests/nextflow.config | 8 - .../nf-core/dragmap/align/tests/main.nf.test | 285 -- .../dragmap/align/tests/main.nf.test.snap | 238 -- .../dragmap/hashtable/tests/main.nf.test | 66 - .../dragmap/hashtable/tests/main.nf.test.snap | 62 - .../ensemblvep/download/tests/main.nf.test | 60 - .../download/tests/main.nf.test.snap | 322 -- .../ensemblvep/download/tests/nextflow.config | 12 - .../nf-core/ensemblvep/vep/tests/main.nf.test | 117 - .../ensemblvep/vep/tests/main.nf.test.snap | 28 - .../ensemblvep/vep/tests/nextflow.config | 12 - .../ensemblvep/vep/tests/tab.gz.config | 5 - .../nf-core/ensemblvep/vep/tests/vcf.config | 5 - modules/nf-core/fastp/tests/main.nf.test | 576 ---- modules/nf-core/fastp/tests/main.nf.test.snap | 1331 --------- .../fastp/tests/nextflow.interleaved.config | 5 - .../fastp/tests/nextflow.save_failed.config | 5 - modules/nf-core/fastqc/tests/main.nf.test | 309 -- .../nf-core/fastqc/tests/main.nf.test.snap | 392 --- .../tests/main.nf.test | 72 - .../tests/main.nf.test.snap | 68 - .../tests/sort.config | 6 - .../nf-core/fgbio/fastqtobam/tests/bam.config | 3 - .../fgbio/fastqtobam/tests/cram.config | 3 - .../fastqtobam/tests/custom_sample.config | 3 - .../fgbio/fastqtobam/tests/main.nf.test | 218 -- .../fgbio/fastqtobam/tests/main.nf.test.snap | 114 - .../nf-core/fgbio/fastqtobam/tests/umi.config | 3 - .../fgbio/groupreadsbyumi/tests/main.nf.test | 60 - .../groupreadsbyumi/tests/main.nf.test.snap | 108 - modules/nf-core/freebayes/tests/main.nf.test | 190 -- .../nf-core/freebayes/tests/main.nf.test.snap | 122 - .../gatk4/applybqsr/tests/main.nf.test | 154 - .../gatk4/applybqsr/tests/main.nf.test.snap | 180 -- .../applyvqsr/tests/allelspecificity.config | 5 - .../gatk4/applyvqsr/tests/main.nf.test | 106 - .../gatk4/applyvqsr/tests/main.nf.test.snap | 95 - .../tests/no-allelspecificity.config | 5 - .../gatk4/baserecalibrator/tests/main.nf.test | 250 -- .../baserecalibrator/tests/main.nf.test.snap | 266 -- .../calculatecontamination/tests/main.nf.test | 106 - .../tests/main.nf.test.snap | 127 - .../tests/nextflow.config | 5 - .../gatk4/cnnscorevariants/tests/main.nf.test | 77 - .../cnnscorevariants/tests/main.nf.test.snap | 65 - .../tests/main.nf.test | 56 - .../tests/main.nf.test.snap | 68 - .../tests/main.nf.test | 113 - .../tests/main.nf.test.snap | 41 - .../filtermutectcalls/tests/main.nf.test | 176 -- .../filtermutectcalls/tests/main.nf.test.snap | 140 - .../filtermutectcalls/tests/nextflow.config | 5 - .../filtervarianttranches/tests/main.nf.test | 78 - .../tests/main.nf.test.snap | 65 - .../tests/nextflow.config | 6 - .../gatherbqsrreports/tests/main.nf.test | 60 - .../gatherbqsrreports/tests/main.nf.test.snap | 72 - .../gatherpileupsummaries/tests/main.nf.test | 62 - .../tests/main.nf.test.snap | 72 - .../tests/nextflow.config | 5 - .../gatk4/genomicsdbimport/tests/main.nf.test | 160 - .../genomicsdbimport/tests/main.nf.test.snap | 98 - .../genomicsdbimport/tests/nextflow.config | 2 - .../gatk4/genotypegvcfs/tests/main.nf.test | 285 -- .../genotypegvcfs/tests/main.nf.test.snap | 191 -- .../getpileupsummaries/tests/main.nf.test | 104 - .../tests/main.nf.test.snap | 101 - .../gatk4/haplotypecaller/tests/main.nf.test | 154 - .../haplotypecaller/tests/main.nf.test.snap | 58 - .../intervallisttobed/tests/main.nf.test | 58 - .../intervallisttobed/tests/main.nf.test.snap | 72 - .../tests/main.nf.test | 38 - .../tests/main.nf.test.snap | 21 - .../tests/nextflow.config | 5 - .../gatk4/markduplicates/tests/bam.config | 8 - .../gatk4/markduplicates/tests/cram.config | 8 - .../gatk4/markduplicates/tests/main.nf.test | 126 - .../markduplicates/tests/main.nf.test.snap | 160 - .../gatk4/mergemutectstats/tests/main.nf.test | 57 - .../mergemutectstats/tests/main.nf.test.snap | 59 - .../gatk4/mergevcfs/tests/main.nf.test | 90 - .../gatk4/mergevcfs/tests/main.nf.test.snap | 44 - .../nf-core/gatk4/mutect2/tests/main.nf.test | 375 --- .../gatk4/mutect2/tests/main.nf.test.snap | 265 -- .../gatk4/mutect2/tests/nextflow.config | 5 - .../gatk4/variantrecalibrator/tests/AS.config | 7 - .../variantrecalibrator/tests/main.nf.test | 167 -- .../tests/main.nf.test.snap | 133 - .../variantrecalibrator/tests/noAS.config | 8 - .../gatk4spark/applybqsr/tests/main.nf.test | 197 -- .../applybqsr/tests/main.nf.test.snap | 296 -- .../applybqsr/tests/nextflow.config | 1 - .../baserecalibrator/tests/main.nf.test | 268 -- .../baserecalibrator/tests/main.nf.test.snap | 306 -- .../baserecalibrator/tests/nextflow.config | 2 - .../markduplicates/tests/bam.config | 5 - .../markduplicates/tests/cram.config | 5 - .../markduplicates/tests/main.nf.test | 263 -- .../markduplicates/tests/main.nf.test.snap | 486 --- .../markduplicates/tests/metrics.config | 6 - .../markduplicates/tests/nextflow.config | 1 - modules/nf-core/gawk/tests/main.nf.test | 198 -- modules/nf-core/gawk/tests/main.nf.test.snap | 200 -- modules/nf-core/gawk/tests/nextflow.config | 6 - .../goleft/indexcov/tests/main.nf.test | 131 - .../goleft/indexcov/tests/main.nf.test.snap | 205 -- .../lofreq/callparallel/tests/main.nf.test | 109 - .../callparallel/tests/main.nf.test.snap | 93 - .../nf-core/manta/germline/tests/main.nf.test | 162 - .../manta/germline/tests/main.nf.test.snap | 139 - .../manta/germline/tests/nextflow.config | 5 - .../nf-core/manta/somatic/tests/main.nf.test | 121 - .../manta/somatic/tests/main.nf.test.snap | 179 -- .../manta/tumoronly/tests/main.nf.test | 121 - .../manta/tumoronly/tests/main.nf.test.snap | 123 - modules/nf-core/mosdepth/tests/main.nf.test | 246 -- .../nf-core/mosdepth/tests/main.nf.test.snap | 1386 --------- .../nf-core/mosdepth/tests/quantized.config | 3 - .../nf-core/mosdepth/tests/threshold.config | 3 - modules/nf-core/mosdepth/tests/window.config | 3 - .../msisensorpro/scan/tests/main.nf.test | 58 - .../msisensorpro/scan/tests/main.nf.test.snap | 72 - modules/nf-core/multiqc/tests/main.nf.test | 92 - .../nf-core/multiqc/tests/main.nf.test.snap | 41 - modules/nf-core/multiqc/tests/nextflow.config | 5 - modules/nf-core/muse/call/tests/main.nf.test | 81 - .../nf-core/muse/call/tests/main.nf.test.snap | 83 - modules/nf-core/muse/sump/tests/main.nf.test | 82 - .../nf-core/muse/sump/tests/main.nf.test.snap | 71 - .../nf-core/muse/sump/tests/nextflow.config | 8 - .../nf-core/ngscheckmate/ncm/tests/bam.config | 5 - .../ngscheckmate/ncm/tests/main.nf.test | 180 -- .../ngscheckmate/ncm/tests/main.nf.test.snap | 221 -- .../ngscheckmate/ncm/tests/nextflow.config | 15 - .../nf-core/ngscheckmate/ncm/tests/vcf.config | 5 - modules/nf-core/samblaster/tests/main.nf.test | 62 - .../samblaster/tests/main.nf.test.snap | 51 - .../nf-core/samblaster/tests/nextflow.config | 6 - .../samtools/bam2fq/tests/main.nf.test | 67 - .../samtools/bam2fq/tests/main.nf.test.snap | 75 - .../samtools/bam2fq/tests/nextflow.config | 3 - .../samtools/collatefastq/tests/main.nf.test | 242 -- .../collatefastq/tests/main.nf.test.snap | 194 -- .../samtools/convert/tests/main.nf.test | 107 - .../samtools/convert/tests/main.nf.test.snap | 131 - .../nf-core/samtools/faidx/tests/main.nf.test | 219 -- .../samtools/faidx/tests/main.nf.test.snap | 543 ---- .../samtools/faidx/tests/nextflow.config | 7 - .../samtools/faidx/tests/nextflow2.config | 6 - .../samtools/index/tests/csi.nextflow.config | 7 - .../nf-core/samtools/index/tests/main.nf.test | 140 - .../samtools/index/tests/main.nf.test.snap | 250 -- .../nf-core/samtools/merge/tests/index.config | 3 - .../nf-core/samtools/merge/tests/main.nf.test | 137 - .../samtools/merge/tests/main.nf.test.snap | 228 -- .../samtools/mpileup/tests/main.nf.test | 59 - .../samtools/mpileup/tests/main.nf.test.snap | 62 - .../nf-core/samtools/stats/tests/main.nf.test | 113 - .../samtools/stats/tests/main.nf.test.snap | 142 - .../nf-core/samtools/view/tests/bam.config | 3 - .../samtools/view/tests/bam_index.config | 3 - .../samtools/view/tests/cram_index.config | 3 - .../nf-core/samtools/view/tests/main.nf.test | 463 --- .../samtools/view/tests/main.nf.test.snap | 972 ------ .../sentieon/bwamem/tests/main.nf.test | 262 -- .../sentieon/bwamem/tests/main.nf.test.snap | 187 -- .../sentieon/bwamem/tests/nextflow.config | 15 - .../bwamem/tests/nextflow_out_cram.config | 16 - .../nf-core/sentieon/dedup/tests/main.nf.test | 90 - .../sentieon/dedup/tests/main.nf.test.snap | 359 --- .../sentieon/dedup/tests/nextflow.config | 9 - .../dedup/tests/nextflow_rmdup.config | 15 - .../sentieon/gvcftyper/tests/main.nf.test | 212 -- .../gvcftyper/tests/main.nf.test.snap | 121 - .../sentieon/gvcftyper/tests/nextflow.config | 15 - .../sentieon/haplotyper/tests/main.nf.test | 327 -- .../haplotyper/tests/main.nf.test.snap | 187 -- .../sentieon/haplotyper/tests/nextflow.config | 16 - .../snpeff/download/tests/main.nf.test | 51 - .../snpeff/download/tests/main.nf.test.snap | 100 - .../nf-core/snpeff/snpeff/tests/main.nf.test | 87 - .../snpeff/snpeff/tests/main.nf.test.snap | 112 - .../snpeff/snpeff/tests/nextflow.config | 3 - .../spring/decompress/tests/main.nf.test | 154 - .../spring/decompress/tests/main.nf.test.snap | 218 -- .../spring/decompress/tests/nextflow.config | 5 - .../strelka/germline/tests/main.nf.test | 94 - .../strelka/germline/tests/main.nf.test.snap | 107 - .../strelka/germline/tests/nextflow.config | 5 - .../strelka/somatic/tests/main.nf.test | 106 - .../strelka/somatic/tests/main.nf.test.snap | 107 - .../strelka/somatic/tests/nextflow.config | 5 - modules/nf-core/svdb/merge/tests/main.nf.test | 360 --- .../svdb/merge/tests/main.nf.test.snap | 294 -- .../nf-core/svdb/merge/tests/nextflow.config | 6 - .../tabix/bgziptabix/tests/main.nf.test | 123 - .../tabix/bgziptabix/tests/main.nf.test.snap | 206 -- .../tabix/bgziptabix/tests/tabix_csi.config | 5 - .../tabix/bgziptabix/tests/tabix_tbi.config | 5 - .../nf-core/tabix/tabix/tests/main.nf.test | 136 - .../tabix/tabix/tests/main.nf.test.snap | 212 -- .../tabix/tabix/tests/tabix_bed.config | 5 - .../tabix/tabix/tests/tabix_gff.config | 5 - .../tabix/tabix/tests/tabix_vcf_csi.config | 5 - .../tabix/tabix/tests/tabix_vcf_tbi.config | 5 - modules/nf-core/tiddit/sv/tests/main.nf.test | 193 -- .../nf-core/tiddit/sv/tests/main.nf.test.snap | 99 - .../nf-core/tiddit/sv/tests/nextflow.config | 5 - modules/nf-core/untar/tests/main.nf.test | 85 - modules/nf-core/untar/tests/main.nf.test.snap | 158 - modules/nf-core/unzip/tests/main.nf.test | 54 - modules/nf-core/unzip/tests/main.nf.test.snap | 76 - modules/nf-core/vcftools/tests/base.config | 5 - modules/nf-core/vcftools/tests/bed.config | 5 - modules/nf-core/vcftools/tests/main.nf.test | 151 - .../nf-core/vcftools/tests/main.nf.test.snap | 2623 ----------------- .../bam_ngscheckmate/tests/main.nf.test | 147 - .../bam_ngscheckmate/tests/main.nf.test.snap | 99 - .../bam_ngscheckmate/tests/nextflow.config | 9 - .../tests/main.function.nf.test | 54 - .../tests/main.function.nf.test.snap | 20 - .../tests/main.workflow.nf.test | 111 - .../tests/nextflow.config | 9 - .../utils_nextflow_pipeline/tests/tags.yml | 2 - .../tests/main.function.nf.test | 134 - .../tests/main.function.nf.test.snap | 166 -- .../tests/main.workflow.nf.test | 29 - .../tests/main.workflow.nf.test.snap | 19 - .../tests/nextflow.config | 9 - .../utils_nfcore_pipeline/tests/tags.yml | 2 - .../utils_nfschema_plugin/tests/main.nf.test | 117 - .../tests/nextflow.config | 8 - .../tests/nextflow_schema.json | 96 - 320 files changed, 39818 deletions(-) delete mode 100644 modules/nf-core/ascat/tests/main.nf.test delete mode 100644 modules/nf-core/ascat/tests/main.nf.test.snap delete mode 100644 modules/nf-core/ascat/tests/nextflow.config delete mode 100644 modules/nf-core/bcftools/annotate/tests/bcf.config delete mode 100644 modules/nf-core/bcftools/annotate/tests/main.nf.test delete mode 100644 modules/nf-core/bcftools/annotate/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bcftools/annotate/tests/vcf.config delete mode 100644 modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config delete mode 100644 modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config delete mode 100644 modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config delete mode 100644 modules/nf-core/bcftools/concat/tests/main.nf.test delete mode 100644 modules/nf-core/bcftools/concat/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bcftools/concat/tests/nextflow.config delete mode 100644 modules/nf-core/bcftools/concat/tests/vcf_gz_index.config delete mode 100644 modules/nf-core/bcftools/concat/tests/vcf_gz_index_csi.config delete mode 100644 modules/nf-core/bcftools/concat/tests/vcf_gz_index_tbi.config delete mode 100644 modules/nf-core/bcftools/mpileup/tests/main.nf.test delete mode 100644 modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bcftools/mpileup/tests/nextflow.config delete mode 100644 modules/nf-core/bcftools/norm/tests/main.nf.test delete mode 100644 modules/nf-core/bcftools/norm/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bcftools/norm/tests/nextflow.bcf.config delete mode 100644 modules/nf-core/bcftools/norm/tests/nextflow.bcf_gz.config delete mode 100644 modules/nf-core/bcftools/norm/tests/nextflow.config delete mode 100644 modules/nf-core/bcftools/norm/tests/nextflow.vcf.config delete mode 100644 modules/nf-core/bcftools/norm/tests/nextflow.vcf_gz.config delete mode 100644 modules/nf-core/bcftools/norm/tests/tags.yml delete mode 100644 modules/nf-core/bcftools/norm/tests/vcf_gz_index.config delete mode 100644 modules/nf-core/bcftools/norm/tests/vcf_gz_index_csi.config delete mode 100644 modules/nf-core/bcftools/norm/tests/vcf_gz_index_tbi.config delete mode 100644 modules/nf-core/bcftools/sort/tests/main.nf.test delete mode 100644 modules/nf-core/bcftools/sort/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bcftools/sort/tests/vcf_gz_index.config delete mode 100644 modules/nf-core/bcftools/sort/tests/vcf_gz_index_csi.config delete mode 100644 modules/nf-core/bcftools/sort/tests/vcf_gz_index_tbi.config delete mode 100644 modules/nf-core/bcftools/stats/tests/main.nf.test delete mode 100644 modules/nf-core/bcftools/stats/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bwa/index/tests/main.nf.test delete mode 100644 modules/nf-core/bwa/index/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bwa/mem/tests/main.nf.test delete mode 100644 modules/nf-core/bwa/mem/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bwamem2/index/tests/main.nf.test delete mode 100644 modules/nf-core/bwamem2/index/tests/main.nf.test.snap delete mode 100644 modules/nf-core/bwamem2/mem/tests/main.nf.test delete mode 100644 modules/nf-core/bwamem2/mem/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cat/cat/tests/main.nf.test delete mode 100644 modules/nf-core/cat/cat/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config delete mode 100644 modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config delete mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test delete mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cnvkit/antitarget/tests/main.nf.test delete mode 100644 modules/nf-core/cnvkit/antitarget/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cnvkit/batch/tests/batch_hybrid.config delete mode 100644 modules/nf-core/cnvkit/batch/tests/batch_pon.config delete mode 100644 modules/nf-core/cnvkit/batch/tests/batch_tumouronly.config delete mode 100644 modules/nf-core/cnvkit/batch/tests/batch_wgs.config delete mode 100644 modules/nf-core/cnvkit/batch/tests/main.nf.test delete mode 100644 modules/nf-core/cnvkit/batch/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cnvkit/call/tests/main.nf.test delete mode 100644 modules/nf-core/cnvkit/call/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cnvkit/export/tests/main.nf.test delete mode 100644 modules/nf-core/cnvkit/export/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cnvkit/export/tests/nextflow.config delete mode 100644 modules/nf-core/cnvkit/genemetrics/tests/main.nf.test delete mode 100644 modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap delete mode 100644 modules/nf-core/cnvkit/reference/tests/main.nf.test delete mode 100644 modules/nf-core/cnvkit/reference/tests/main.nf.test.snap delete mode 100644 modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test delete mode 100644 modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test.snap delete mode 100644 modules/nf-core/controlfreec/assesssignificance/tests/nextflow.config delete mode 100644 modules/nf-core/controlfreec/freec/tests/main.nf.test delete mode 100644 modules/nf-core/controlfreec/freec/tests/main.nf.test.snap delete mode 100644 modules/nf-core/controlfreec/freec/tests/nextflow.config delete mode 100644 modules/nf-core/controlfreec/freec2bed/tests/main.nf.test delete mode 100644 modules/nf-core/controlfreec/freec2bed/tests/main.nf.test.snap delete mode 100644 modules/nf-core/controlfreec/freec2bed/tests/nextflow.config delete mode 100644 modules/nf-core/controlfreec/freec2circos/tests/main.nf.test delete mode 100644 modules/nf-core/controlfreec/freec2circos/tests/main.nf.test.snap delete mode 100644 modules/nf-core/controlfreec/freec2circos/tests/nextflow.config delete mode 100644 modules/nf-core/controlfreec/makegraph2/tests/main.nf.test delete mode 100644 modules/nf-core/controlfreec/makegraph2/tests/main.nf.test.snap delete mode 100644 modules/nf-core/controlfreec/makegraph2/tests/nextflow.config delete mode 100644 modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test delete mode 100644 modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap delete mode 100644 modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config delete mode 100644 modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config delete mode 100644 modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config delete mode 100644 modules/nf-core/dragmap/align/tests/main.nf.test delete mode 100644 modules/nf-core/dragmap/align/tests/main.nf.test.snap delete mode 100644 modules/nf-core/dragmap/hashtable/tests/main.nf.test delete mode 100644 modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap delete mode 100644 modules/nf-core/ensemblvep/download/tests/main.nf.test delete mode 100644 modules/nf-core/ensemblvep/download/tests/main.nf.test.snap delete mode 100644 modules/nf-core/ensemblvep/download/tests/nextflow.config delete mode 100644 modules/nf-core/ensemblvep/vep/tests/main.nf.test delete mode 100644 modules/nf-core/ensemblvep/vep/tests/main.nf.test.snap delete mode 100644 modules/nf-core/ensemblvep/vep/tests/nextflow.config delete mode 100644 modules/nf-core/ensemblvep/vep/tests/tab.gz.config delete mode 100644 modules/nf-core/ensemblvep/vep/tests/vcf.config delete mode 100644 modules/nf-core/fastp/tests/main.nf.test delete mode 100644 modules/nf-core/fastp/tests/main.nf.test.snap delete mode 100644 modules/nf-core/fastp/tests/nextflow.interleaved.config delete mode 100644 modules/nf-core/fastp/tests/nextflow.save_failed.config delete mode 100644 modules/nf-core/fastqc/tests/main.nf.test delete mode 100644 modules/nf-core/fastqc/tests/main.nf.test.snap delete mode 100644 modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test delete mode 100644 modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap delete mode 100644 modules/nf-core/fgbio/callmolecularconsensusreads/tests/sort.config delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/bam.config delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/cram.config delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/custom_sample.config delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/main.nf.test delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap delete mode 100644 modules/nf-core/fgbio/fastqtobam/tests/umi.config delete mode 100644 modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test delete mode 100644 modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap delete mode 100644 modules/nf-core/freebayes/tests/main.nf.test delete mode 100644 modules/nf-core/freebayes/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/applybqsr/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/applyvqsr/tests/allelspecificity.config delete mode 100644 modules/nf-core/gatk4/applyvqsr/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/applyvqsr/tests/no-allelspecificity.config delete mode 100644 modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/calculatecontamination/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/filtermutectcalls/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/gatherpileupsummaries/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/genomicsdbimport/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/learnreadorientationmodel/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/markduplicates/tests/bam.config delete mode 100644 modules/nf-core/gatk4/markduplicates/tests/cram.config delete mode 100644 modules/nf-core/gatk4/markduplicates/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/markduplicates/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/mergevcfs/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/mutect2/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/mutect2/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/AS.config delete mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config delete mode 100644 modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4spark/applybqsr/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/bam.config delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/cram.config delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/metrics.config delete mode 100644 modules/nf-core/gatk4spark/markduplicates/tests/nextflow.config delete mode 100644 modules/nf-core/gawk/tests/main.nf.test delete mode 100644 modules/nf-core/gawk/tests/main.nf.test.snap delete mode 100644 modules/nf-core/gawk/tests/nextflow.config delete mode 100644 modules/nf-core/goleft/indexcov/tests/main.nf.test delete mode 100644 modules/nf-core/goleft/indexcov/tests/main.nf.test.snap delete mode 100644 modules/nf-core/lofreq/callparallel/tests/main.nf.test delete mode 100644 modules/nf-core/lofreq/callparallel/tests/main.nf.test.snap delete mode 100644 modules/nf-core/manta/germline/tests/main.nf.test delete mode 100644 modules/nf-core/manta/germline/tests/main.nf.test.snap delete mode 100644 modules/nf-core/manta/germline/tests/nextflow.config delete mode 100644 modules/nf-core/manta/somatic/tests/main.nf.test delete mode 100644 modules/nf-core/manta/somatic/tests/main.nf.test.snap delete mode 100644 modules/nf-core/manta/tumoronly/tests/main.nf.test delete mode 100644 modules/nf-core/manta/tumoronly/tests/main.nf.test.snap delete mode 100644 modules/nf-core/mosdepth/tests/main.nf.test delete mode 100644 modules/nf-core/mosdepth/tests/main.nf.test.snap delete mode 100644 modules/nf-core/mosdepth/tests/quantized.config delete mode 100644 modules/nf-core/mosdepth/tests/threshold.config delete mode 100644 modules/nf-core/mosdepth/tests/window.config delete mode 100644 modules/nf-core/msisensorpro/scan/tests/main.nf.test delete mode 100644 modules/nf-core/msisensorpro/scan/tests/main.nf.test.snap delete mode 100644 modules/nf-core/multiqc/tests/main.nf.test delete mode 100644 modules/nf-core/multiqc/tests/main.nf.test.snap delete mode 100644 modules/nf-core/multiqc/tests/nextflow.config delete mode 100644 modules/nf-core/muse/call/tests/main.nf.test delete mode 100644 modules/nf-core/muse/call/tests/main.nf.test.snap delete mode 100644 modules/nf-core/muse/sump/tests/main.nf.test delete mode 100644 modules/nf-core/muse/sump/tests/main.nf.test.snap delete mode 100644 modules/nf-core/muse/sump/tests/nextflow.config delete mode 100644 modules/nf-core/ngscheckmate/ncm/tests/bam.config delete mode 100644 modules/nf-core/ngscheckmate/ncm/tests/main.nf.test delete mode 100644 modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap delete mode 100644 modules/nf-core/ngscheckmate/ncm/tests/nextflow.config delete mode 100644 modules/nf-core/ngscheckmate/ncm/tests/vcf.config delete mode 100644 modules/nf-core/samblaster/tests/main.nf.test delete mode 100644 modules/nf-core/samblaster/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samblaster/tests/nextflow.config delete mode 100644 modules/nf-core/samtools/bam2fq/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/bam2fq/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/bam2fq/tests/nextflow.config delete mode 100644 modules/nf-core/samtools/collatefastq/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/collatefastq/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/convert/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/convert/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/faidx/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/faidx/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/faidx/tests/nextflow.config delete mode 100644 modules/nf-core/samtools/faidx/tests/nextflow2.config delete mode 100644 modules/nf-core/samtools/index/tests/csi.nextflow.config delete mode 100644 modules/nf-core/samtools/index/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/index/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/merge/tests/index.config delete mode 100644 modules/nf-core/samtools/merge/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/merge/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/mpileup/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/mpileup/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test.snap delete mode 100644 modules/nf-core/samtools/view/tests/bam.config delete mode 100644 modules/nf-core/samtools/view/tests/bam_index.config delete mode 100644 modules/nf-core/samtools/view/tests/cram_index.config delete mode 100644 modules/nf-core/samtools/view/tests/main.nf.test delete mode 100644 modules/nf-core/samtools/view/tests/main.nf.test.snap delete mode 100644 modules/nf-core/sentieon/bwamem/tests/main.nf.test delete mode 100644 modules/nf-core/sentieon/bwamem/tests/main.nf.test.snap delete mode 100644 modules/nf-core/sentieon/bwamem/tests/nextflow.config delete mode 100644 modules/nf-core/sentieon/bwamem/tests/nextflow_out_cram.config delete mode 100644 modules/nf-core/sentieon/dedup/tests/main.nf.test delete mode 100644 modules/nf-core/sentieon/dedup/tests/main.nf.test.snap delete mode 100644 modules/nf-core/sentieon/dedup/tests/nextflow.config delete mode 100644 modules/nf-core/sentieon/dedup/tests/nextflow_rmdup.config delete mode 100644 modules/nf-core/sentieon/gvcftyper/tests/main.nf.test delete mode 100644 modules/nf-core/sentieon/gvcftyper/tests/main.nf.test.snap delete mode 100644 modules/nf-core/sentieon/gvcftyper/tests/nextflow.config delete mode 100644 modules/nf-core/sentieon/haplotyper/tests/main.nf.test delete mode 100644 modules/nf-core/sentieon/haplotyper/tests/main.nf.test.snap delete mode 100644 modules/nf-core/sentieon/haplotyper/tests/nextflow.config delete mode 100644 modules/nf-core/snpeff/download/tests/main.nf.test delete mode 100644 modules/nf-core/snpeff/download/tests/main.nf.test.snap delete mode 100644 modules/nf-core/snpeff/snpeff/tests/main.nf.test delete mode 100644 modules/nf-core/snpeff/snpeff/tests/main.nf.test.snap delete mode 100644 modules/nf-core/snpeff/snpeff/tests/nextflow.config delete mode 100644 modules/nf-core/spring/decompress/tests/main.nf.test delete mode 100644 modules/nf-core/spring/decompress/tests/main.nf.test.snap delete mode 100644 modules/nf-core/spring/decompress/tests/nextflow.config delete mode 100644 modules/nf-core/strelka/germline/tests/main.nf.test delete mode 100644 modules/nf-core/strelka/germline/tests/main.nf.test.snap delete mode 100644 modules/nf-core/strelka/germline/tests/nextflow.config delete mode 100644 modules/nf-core/strelka/somatic/tests/main.nf.test delete mode 100644 modules/nf-core/strelka/somatic/tests/main.nf.test.snap delete mode 100644 modules/nf-core/strelka/somatic/tests/nextflow.config delete mode 100644 modules/nf-core/svdb/merge/tests/main.nf.test delete mode 100644 modules/nf-core/svdb/merge/tests/main.nf.test.snap delete mode 100644 modules/nf-core/svdb/merge/tests/nextflow.config delete mode 100644 modules/nf-core/tabix/bgziptabix/tests/main.nf.test delete mode 100644 modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap delete mode 100644 modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config delete mode 100644 modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config delete mode 100644 modules/nf-core/tabix/tabix/tests/main.nf.test delete mode 100644 modules/nf-core/tabix/tabix/tests/main.nf.test.snap delete mode 100644 modules/nf-core/tabix/tabix/tests/tabix_bed.config delete mode 100644 modules/nf-core/tabix/tabix/tests/tabix_gff.config delete mode 100644 modules/nf-core/tabix/tabix/tests/tabix_vcf_csi.config delete mode 100644 modules/nf-core/tabix/tabix/tests/tabix_vcf_tbi.config delete mode 100644 modules/nf-core/tiddit/sv/tests/main.nf.test delete mode 100644 modules/nf-core/tiddit/sv/tests/main.nf.test.snap delete mode 100644 modules/nf-core/tiddit/sv/tests/nextflow.config delete mode 100644 modules/nf-core/untar/tests/main.nf.test delete mode 100644 modules/nf-core/untar/tests/main.nf.test.snap delete mode 100644 modules/nf-core/unzip/tests/main.nf.test delete mode 100644 modules/nf-core/unzip/tests/main.nf.test.snap delete mode 100644 modules/nf-core/vcftools/tests/base.config delete mode 100644 modules/nf-core/vcftools/tests/bed.config delete mode 100644 modules/nf-core/vcftools/tests/main.nf.test delete mode 100644 modules/nf-core/vcftools/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test delete mode 100644 subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap delete mode 100644 subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config delete mode 100644 subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test delete mode 100644 subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap delete mode 100644 subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test delete mode 100644 subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config delete mode 100644 subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml delete mode 100644 subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test delete mode 100644 subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap delete mode 100644 subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test delete mode 100644 subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap delete mode 100644 subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config delete mode 100644 subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml delete mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test delete mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config delete mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json diff --git a/modules/nf-core/ascat/tests/main.nf.test b/modules/nf-core/ascat/tests/main.nf.test deleted file mode 100644 index bba4608623..0000000000 --- a/modules/nf-core/ascat/tests/main.nf.test +++ /dev/null @@ -1,131 +0,0 @@ -nextflow_process { - - name "Test Process ASCAT" - script "../main.nf" - process "ASCAT" - - tag "modules" - tag "modules_nfcore" - tag "ascat" - - test("human - bam - GC") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id: 'test', single_end:false ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.markduplicates.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.markduplicates.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.markduplicates.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.markduplicates.sorted.bam.bai', checkIfExists: true) - ] - input[1] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_alleles_hg38_chr21.txt', checkIfExists: true)] - input[2] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_loci_hg38_chr21.txt', checkIfExists: true)] - input[3] = [] - input[4] = [] - input[5] = [] - input[6] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out.allelefreqs, - process.out.bafs, - process.out.cnvs, - // Logrs Tumour has a float margin discrepancy in conda due to - // log and mean transformation - process.out.logrs.collect{it[1].collect{file(it).name}}, - process.out.metrics, - // This discrepancy affect the png generated - process.out.png.collect{it[1].collect{file(it).name}}, - process.out.purityploidy, - process.out.segments, - process.out.versions - ).match() } - ) - } - } - - test("human - cram - GC - RT") { - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id: 'test', single_end:false ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.markduplicates.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.markduplicates.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.markduplicates.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.markduplicates.sorted.cram.crai', checkIfExists: true) - ] - input[1] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_alleles_hg38_chr21.txt', checkIfExists: true)] - input[2] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/G1000_loci_hg38_chr21.txt', checkIfExists: true)] - input[3] = [] - input[4] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)] - input[5] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/GC_G1000_hg38_21.txt', checkIfExists: true)] - input[6] = [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/ascat/RT_G1000_hg38_21.txt', checkIfExists: true)] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out.allelefreqs, - process.out.bafs, - process.out.cnvs, - // Logrs Tumour has a float margin discrepancy in conda due to - // log and mean transformation - process.out.logrs.collect{it[1].collect{file(it).name}}, - process.out.metrics, - // This discrepancy affect the png generated - process.out.png.collect{it[1].collect{file(it).name}}, - process.out.purityploidy, - process.out.segments, - process.out.versions - ).match() } - ) - } - } - - test("human - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id: 'test', single_end:false ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam.bai', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - input[3] = [] - input[4] = [] - input[5] = [] - input[6] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} \ No newline at end of file diff --git a/modules/nf-core/ascat/tests/main.nf.test.snap b/modules/nf-core/ascat/tests/main.nf.test.snap deleted file mode 100644 index 3f9406d8e5..0000000000 --- a/modules/nf-core/ascat/tests/main.nf.test.snap +++ /dev/null @@ -1,373 +0,0 @@ -{ - "human - bam - GC": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.normal_alleleFrequencies_chr21.txt:md5,627382ea8ab013d2fb3307a4f9abb058", - "test.tumour_alleleFrequencies_chr21.txt:md5,79000d7e2f57c3492204a19649d327b1" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.tumour_normalBAF.txt:md5,bee93180f7346edc1ead76f2ac150290", - "test.tumour_tumourBAF.txt:md5,33bab5381edd65675458e72a492c4ef1" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.cnvs.txt:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - [ - [ - "test.tumour_normalLogR.txt", - "test.tumour_tumourLogR.txt" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.metrics.txt:md5,6e473be3fb2226d493e48a73df2f4501" - ] - ], - [ - [ - "test.before_correction.test.tumour.germline.png", - "test.before_correction.test.tumour.tumour.png", - "test.tumour.ASPCF.png", - "test.tumour.sunrise.png" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.purityploidy.txt:md5,f1484c2b120834d3db8774ad02a038b9" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.segments.txt:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - [ - "versions.yml:md5,686336a6e5781e5e76ce026a4d868593" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-05T18:38:00.684889439" - }, - "human - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.normal_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.normal_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.tumour_normalBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_tumourBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cnvs.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.tumour_normalLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_tumourLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": false - }, - "test.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.after_correction.gc_rt.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.after_correction.gc_rt.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.before_correction.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.before_correction.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour.ASPCF.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour.sunrise.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": false - }, - "test.purityploidy.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": false - }, - "test.segments.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "8": [ - "versions.yml:md5,77b5e99ea58d2555e05b761bac9fc0cb" - ], - "allelefreqs": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.normal_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.normal_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_alleleFrequencies_chr21.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_alleleFrequencies_chr22.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "bafs": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.tumour_normalBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_tumourBAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "cnvs": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cnvs.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "logrs": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.tumour_normalLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour_tumourLogR.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "metrics": [ - [ - { - "id": "test", - "single_end": false - }, - "test.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "png": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.after_correction.gc_rt.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.after_correction.gc_rt.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.before_correction.test.tumour.germline.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.before_correction.test.tumour.tumour.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour.ASPCF.png:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.tumour.sunrise.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "purityploidy": [ - [ - { - "id": "test", - "single_end": false - }, - "test.purityploidy.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "segments": [ - [ - { - "id": "test", - "single_end": false - }, - "test.segments.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,77b5e99ea58d2555e05b761bac9fc0cb" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-05T18:15:58.006828602" - }, - "human - cram - GC - RT": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.normal_alleleFrequencies_chr21.txt:md5,627382ea8ab013d2fb3307a4f9abb058", - "test.tumour_alleleFrequencies_chr21.txt:md5,79000d7e2f57c3492204a19649d327b1" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.tumour_normalBAF.txt:md5,bee93180f7346edc1ead76f2ac150290", - "test.tumour_tumourBAF.txt:md5,33bab5381edd65675458e72a492c4ef1" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.cnvs.txt:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - [ - [ - "test.tumour_normalLogR.txt", - "test.tumour_tumourLogR.txt" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.metrics.txt:md5,3502b78584e5251db0fcbd71ed134480" - ] - ], - [ - [ - "test.after_correction_gc_rt.test.tumour.germline.png", - "test.after_correction_gc_rt.test.tumour.tumour.png", - "test.before_correction.test.tumour.germline.png", - "test.before_correction.test.tumour.tumour.png", - "test.tumour.ASPCF.png", - "test.tumour.sunrise.png" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.purityploidy.txt:md5,f1484c2b120834d3db8774ad02a038b9" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.segments.txt:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - [ - "versions.yml:md5,686336a6e5781e5e76ce026a4d868593" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-05T22:15:35.851834147" - } -} \ No newline at end of file diff --git a/modules/nf-core/ascat/tests/nextflow.config b/modules/nf-core/ascat/tests/nextflow.config deleted file mode 100644 index 3ce7124280..0000000000 --- a/modules/nf-core/ascat/tests/nextflow.config +++ /dev/null @@ -1,12 +0,0 @@ -process { - withName: ASCAT { - ext.args = [ - gender : 'XY', - genomeVersion : 'hg19', - minCounts : '1', - min_base_qual : '1', - min_map_qual : '1', - chrom_names : 'c("21")' - ] - } -} diff --git a/modules/nf-core/bcftools/annotate/tests/bcf.config b/modules/nf-core/bcftools/annotate/tests/bcf.config deleted file mode 100644 index 79d26779da..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/bcf.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = "-x ID,INFO/DP,FORMAT/DP --output-type u" - ext.prefix = { "${meta.id}_ann" } -} diff --git a/modules/nf-core/bcftools/annotate/tests/main.nf.test b/modules/nf-core/bcftools/annotate/tests/main.nf.test deleted file mode 100644 index fd6d2cd37f..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/main.nf.test +++ /dev/null @@ -1,374 +0,0 @@ -nextflow_process { - - name "Test Process BCFTOOLS_ANNOTATE" - script "../main.nf" - process "BCFTOOLS_ANNOTATE" - - tag "modules" - tag "modules_nfcore" - tag "bcftools" - tag "bcftools/annotate" - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_output") { - - config "./vcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name }}, - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - [vcf, [], annotation, annotation_tbi], [], [] - vcf_output") { - - config "./vcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name }}, - process.out.versions - ).match() } - ) - } - - } - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index") { - - config "./vcf_gz_index.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi") { - - config "./vcf_gz_index_csi.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi") { - - config "./vcf_gz_index_tbi.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - - test("sarscov2 - [vcf, [], annotation, annotation_tbi], header, [] - bcf_output") { - - config "./bcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = Channel.of( - '##INFO=', - '##INFO=' - ).collectFile(name:"headers.vcf", newLine:true) - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name }}, - process.out.versions - ).match("bcf") } - ) - } - - } - - test("sarscov2 - [vcf, [], annotation, annotation_tbi], header, rename_chrs - vcf_gz_index") { - - config "./vcf_gz_index.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = Channel.of( - '##INFO=', - '##INFO=' - ).collectFile(name:"headers.vcf", newLine:true) - input[2] = Channel.of('MT192765.1 renamed').collectFile(name:"rename.txt", newLine:true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).LinesGzip.contains("##contig=")}, - { assert snapshot( - process.out.vcf.collect { it.collect { it instanceof Map ? it : file(it).name }}, - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - stub") { - - config "./vcf.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index - stub") { - - config "./vcf_gz_index.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match()}, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi - stub") { - - config "./vcf_gz_index_csi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi - stub") { - - config "./vcf_gz_index_tbi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap b/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap deleted file mode 100644 index 63e0d9d5a4..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/main.nf.test.snap +++ /dev/null @@ -1,409 +0,0 @@ -{ - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.tbi" - ] - ], - [ - - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:30.265471036" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:48.340271359" - }, - "bcf": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_ann.bcf" - ] - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:37.270860052" - }, - "sarscov2 - [vcf, [], annotation, annotation_tbi], [], [] - vcf_output": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:12.451788461" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ], - "csi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:52.305248991" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ], - "csi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:59.210314307" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi" - ] - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:19.532491092" - }, - "sarscov2 - [vcf, [], annotation, annotation_tbi], header, rename_chrs - vcf_gz_index": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:44.331095545" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_output": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:08.604415962" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_csi": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz" - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.csi" - ] - ], - [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:55:23.309288135" - }, - "sarscov2 - [vcf, tbi, annotation, annotation_tbi], [], [] - vcf_gz_index_tbi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6f2d10eb553ef65b43a9bd4844c6aa35" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T12:56:06.054536287" - } -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/annotate/tests/vcf.config b/modules/nf-core/bcftools/annotate/tests/vcf.config deleted file mode 100644 index 611868d55c..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/vcf.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = "-x ID,INFO/DP,FORMAT/DP --output-type z" - ext.prefix = { "${meta.id}_vcf" } -} diff --git a/modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config b/modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config deleted file mode 100644 index 2fd9a225f0..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = "--output-type z --write-index --no-version" - ext.prefix = { "${meta.id}_vcf" } -} diff --git a/modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config b/modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config deleted file mode 100644 index 512c1dfb05..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = "--output-type z --write-index=csi --no-version" - ext.prefix = { "${meta.id}_vcf" } -} diff --git a/modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config b/modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config deleted file mode 100644 index 7feb5ebbed..0000000000 --- a/modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = "--output-type z --write-index=tbi --no-version" - ext.prefix = { "${meta.id}_vcf" } -} diff --git a/modules/nf-core/bcftools/concat/tests/main.nf.test b/modules/nf-core/bcftools/concat/tests/main.nf.test deleted file mode 100644 index cb4642b29c..0000000000 --- a/modules/nf-core/bcftools/concat/tests/main.nf.test +++ /dev/null @@ -1,316 +0,0 @@ -nextflow_process { - - name "Test Process BCFTOOLS_CONCAT" - script "../main.nf" - process "BCFTOOLS_CONCAT" - - tag "modules" - tag "modules_nfcore" - tag "bcftools" - tag "bcftools/concat" - - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]]") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index") { - - config "./vcf_gz_index.config" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi") { - - config "./vcf_gz_index_csi.config" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi") { - - config "./vcf_gz_index_tbi.config" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - - - test("homo_sapiens - [[vcf1, vcf2], []]") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - stub") { - - config "./nextflow.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index - stub") { - - config "./vcf_gz_index.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi - stub") { - - config "./vcf_gz_index_csi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi - stub") { - - config "./vcf_gz_index_tbi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test3' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - - -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/concat/tests/main.nf.test.snap b/modules/nf-core/bcftools/concat/tests/main.nf.test.snap deleted file mode 100644 index fc3630e1d1..0000000000 --- a/modules/nf-core/bcftools/concat/tests/main.nf.test.snap +++ /dev/null @@ -1,395 +0,0 @@ -{ - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi": { - "content": [ - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi" - ] - ], - [ - - ], - [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:07:59.602632725" - }, - "homo_sapiens - [[vcf1, vcf2], []]": { - "content": [ - { - "0": [ - [ - { - "id": "test3" - }, - "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test3" - }, - "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - "versions": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:08:10.612937747" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test3" - }, - "test3.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test3" - }, - "test3.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:08:14.560167356" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ], - "csi": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:08:21.582631265" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi": { - "content": [ - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - [ - - ], - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:08:06.771571575" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]]": { - "content": [ - { - "0": [ - [ - { - "id": "test3" - }, - "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test3" - }, - "test3.vcf:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - "versions": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:07:47.748357665" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index": { - "content": [ - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,5f6796c3ae109a1a5b87353954693f5a" - ] - ], - [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi" - ] - ], - [ - - ], - [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:07:55.303850698" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_tbi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:08:32.675839006" - }, - "homo_sapiens - [[vcf1, vcf2], [tbi1, tbi2]] - vcf_gz_index_csi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ], - "csi": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test3" - }, - "test3_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6640b543bdeba692970e302474aaee22" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:08:25.698924757" - } -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/concat/tests/nextflow.config b/modules/nf-core/bcftools/concat/tests/nextflow.config deleted file mode 100644 index f3e1e98c63..0000000000 --- a/modules/nf-core/bcftools/concat/tests/nextflow.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = "--no-version" -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/concat/tests/vcf_gz_index.config b/modules/nf-core/bcftools/concat/tests/vcf_gz_index.config deleted file mode 100644 index 7dd696ee26..0000000000 --- a/modules/nf-core/bcftools/concat/tests/vcf_gz_index.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index --no-version" -} diff --git a/modules/nf-core/bcftools/concat/tests/vcf_gz_index_csi.config b/modules/nf-core/bcftools/concat/tests/vcf_gz_index_csi.config deleted file mode 100644 index aebffb6fb7..0000000000 --- a/modules/nf-core/bcftools/concat/tests/vcf_gz_index_csi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index=csi --no-version" -} diff --git a/modules/nf-core/bcftools/concat/tests/vcf_gz_index_tbi.config b/modules/nf-core/bcftools/concat/tests/vcf_gz_index_tbi.config deleted file mode 100644 index b192ae7d19..0000000000 --- a/modules/nf-core/bcftools/concat/tests/vcf_gz_index_tbi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index=tbi --no-version" -} diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test b/modules/nf-core/bcftools/mpileup/tests/main.nf.test deleted file mode 100644 index 665a349fc8..0000000000 --- a/modules/nf-core/bcftools/mpileup/tests/main.nf.test +++ /dev/null @@ -1,208 +0,0 @@ -nextflow_process { - - name "Test Process BCFTOOLS_MPILEUP" - script "../main.nf" - process "BCFTOOLS_MPILEUP" - - tag "modules" - tag "modules_nfcore" - tag "bcftools" - tag "bcftools/mpileup" - - config "./nextflow.config" - - test("sarscov2 - [bam, []], fasta, false") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'sarscov2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.vcf[0][1]).name).match("bam_fasta_false.vcf.gz") }, - { assert snapshot(file(process.out.tbi[0][1]).name).match("bam_fasta_false.vcf.gz.tbi") }, - { assert snapshot(file(process.out.stats[0][1]).name).match("bam_fasta_false.bcftools_stats.txt") }, - { assert snapshot(process.out.versions).match("bam_fasta_false_versions") } - ) - } - - } - - test("sarscov2 - [bam, []], fasta, false stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'sarscov2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.vcf[0][1]).name).match("bam_fasta_false_stub.vcf.gz") }, - { assert snapshot(file(process.out.tbi[0][1]).name).match("bam_fasta_false_stub.vcf.gz.tbi") }, - { assert snapshot(file(process.out.stats[0][1]).name).match("bam_fasta_false_stub.bcftools_stats.txt") }, - { assert snapshot(process.out.versions).match("bam_fasta_false_stub_versions") } - ) - } - - } - - test("sarscov2 - [bam, []], fasta, true") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'sarscov2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.vcf[0][1]).name).match("bam_bed_fasta_true_stub.vcf.gz") }, - { assert snapshot(file(process.out.tbi[0][1]).name).match("bam_bed_fasta_true_stub.vcf.gz.tbi") }, - { assert snapshot(file(process.out.stats[0][1]).name).match("bam_bed_fasta_true_stub.bcftools_stats.txt") }, - { assert snapshot(file(process.out.mpileup[0][1]).name).match("bam_bed_fasta_true_stub.mpileup.gz") }, - { assert snapshot(process.out.versions).match("bam_bed_fasta_true_stub_versions") } - ) - } - - } - - test("sarscov2 - [bam, []], fasta, true stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'sarscov2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.vcf[0][1]).name).match("bam_bed_fasta_true.vcf.gz") }, - { assert snapshot(file(process.out.tbi[0][1]).name).match("bam_bed_fasta_true.vcf.gz.tbi") }, - { assert snapshot(file(process.out.stats[0][1]).name).match("bam_bed_fasta_true.bcftools_stats.txt") }, - { assert snapshot(file(process.out.mpileup[0][1]).name).match("bam_bed_fasta_true.mpileup.gz") }, - { assert snapshot(process.out.versions).match("bam_bed_fasta_true_versions") } - ) - } - - } - - test("sarscov2 - [bam, bed], fasta, false") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = [ - [ id:'sarscov2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.vcf[0][1]).name).match("bam_bed_fasta_false.vcf.gz") }, - { assert snapshot(file(process.out.tbi[0][1]).name).match("bam_bed_fasta_false.vcf.gz.tbi") }, - { assert snapshot(file(process.out.stats[0][1]).name).match("bam_bed_fasta_false.bcftools_stats.txt") }, - { assert snapshot(process.out.versions).match("bam_bed_fasta_false_versions") } - ) - } - - } - - test("sarscov2 - [bam, bed], fasta, false stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = [ - [ id:'sarscov2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.vcf[0][1]).name).match("bam_bed_fasta_false_stub.vcf.gz") }, - { assert snapshot(file(process.out.tbi[0][1]).name).match("bam_bed_fasta_false_stub.vcf.gz.tbi") }, - { assert snapshot(file(process.out.stats[0][1]).name).match("bam_bed_fasta_false_stub.bcftools_stats.txt") }, - { assert snapshot(process.out.versions).match("bam_bed_fasta_false_stub_versions") } - ) - } - - } - -} diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap deleted file mode 100644 index 08c87e2f81..0000000000 --- a/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap +++ /dev/null @@ -1,274 +0,0 @@ -{ - "bam_bed_fasta_true.vcf.gz.tbi": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:45:32.654601222" - }, - "bam_bed_fasta_false_stub.vcf.gz": { - "content": [ - "test.vcf.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:46:19.532461322" - }, - "bam_fasta_false_stub.vcf.gz.tbi": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:44:44.944919263" - }, - "bam_bed_fasta_false_stub.bcftools_stats.txt": { - "content": [ - "test.bcftools_stats.txt" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:37:57.844573" - }, - "bam_bed_fasta_true_stub.mpileup.gz": { - "content": [ - "test.mpileup.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:37:39.462382" - }, - "bam_bed_fasta_true.vcf.gz": { - "content": [ - "test.vcf.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:45:32.596363535" - }, - "bam_bed_fasta_true_stub.vcf.gz": { - "content": [ - "test.vcf.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:45:10.034842649" - }, - "bam_fasta_false_versions": { - "content": [ - [ - "versions.yml:md5,489c9d000145be40205442e6c1be70a5" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:44:46.083414473" - }, - "bam_fasta_false_stub.bcftools_stats.txt": { - "content": [ - "test.bcftools_stats.txt" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:39:15.746204" - }, - "bam_bed_fasta_false_versions": { - "content": [ - [ - "versions.yml:md5,489c9d000145be40205442e6c1be70a5" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:45:06.213311379" - }, - "bam_bed_fasta_false.vcf.gz": { - "content": [ - "test.vcf.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:45:57.39416797" - }, - "bam_bed_fasta_true_versions": { - "content": [ - [ - "versions.yml:md5,489c9d000145be40205442e6c1be70a5" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:45:01.634976363" - }, - "bam_fasta_false.vcf.gz": { - "content": [ - "test.vcf.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:44:21.337711533" - }, - "bam_fasta_false.bcftools_stats.txt": { - "content": [ - "test.bcftools_stats.txt" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:39:10.123726" - }, - "bam_bed_fasta_false.bcftools_stats.txt": { - "content": [ - "test.bcftools_stats.txt" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:37:51.761517" - }, - "bam_bed_fasta_false_stub.vcf.gz.tbi": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:46:19.593445488" - }, - "bam_bed_fasta_false.vcf.gz.tbi": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:45:57.444615176" - }, - "bam_fasta_false_stub.vcf.gz": { - "content": [ - "test.vcf.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:44:44.888373837" - }, - "bam_bed_fasta_true_stub.bcftools_stats.txt": { - "content": [ - "test.bcftools_stats.txt" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:37:39.453121" - }, - "bam_fasta_false.vcf.gz.tbi": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:44:21.401424919" - }, - "bam_fasta_false_stub_versions": { - "content": [ - [ - "versions.yml:md5,489c9d000145be40205442e6c1be70a5" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:44:50.214889195" - }, - "bam_bed_fasta_true.bcftools_stats.txt": { - "content": [ - "test.bcftools_stats.txt" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:37:45.18304" - }, - "bam_bed_fasta_true_stub.vcf.gz.tbi": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-03T11:45:10.101920455" - }, - "bam_bed_fasta_false_stub_versions": { - "content": [ - [ - "versions.yml:md5,489c9d000145be40205442e6c1be70a5" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:45:10.356826049" - }, - "bam_bed_fasta_true.mpileup.gz": { - "content": [ - "test.mpileup.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-04-22T18:37:45.192888" - }, - "bam_bed_fasta_true_stub_versions": { - "content": [ - [ - "versions.yml:md5,489c9d000145be40205442e6c1be70a5" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T13:44:57.520283217" - } -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/mpileup/tests/nextflow.config b/modules/nf-core/bcftools/mpileup/tests/nextflow.config deleted file mode 100644 index a7ba19fe62..0000000000 --- a/modules/nf-core/bcftools/mpileup/tests/nextflow.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args2 = '--no-version --ploidy 1 --multiallelic-caller' - ext.args3 = '--no-version' -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/norm/tests/main.nf.test b/modules/nf-core/bcftools/norm/tests/main.nf.test deleted file mode 100644 index dbc4150237..0000000000 --- a/modules/nf-core/bcftools/norm/tests/main.nf.test +++ /dev/null @@ -1,563 +0,0 @@ -nextflow_process { - - name "Test Process BCFTOOLS_NORM" - script "../main.nf" - process "BCFTOOLS_NORM" - - tag "modules" - tag "modules_nfcore" - tag "bcftools" - tag "bcftools/norm" - - test("sarscov2 - [ vcf, [] ], fasta") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - vcf_gz_index") { - - config "./vcf_gz_index.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } } - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_csi") { - - config "./vcf_gz_index_csi.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } } - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_tbi") { - - config "./vcf_gz_index_tbi.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } } - ).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - vcf output") { - - config "./nextflow.vcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - vcf_gz output") { - - config "./nextflow.vcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - bcf output") { - - config "./nextflow.bcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - bcf_gz output") { - - config "./nextflow.bcf_gz.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - stub") { - - config "./nextflow.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta -stub") { - - config "./nextflow.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - vcf output -stub") { - - config "./nextflow.vcf.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - vcf_gz output - stub") { - - config "./nextflow.vcf.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - bcf output - stub") { - - config "./nextflow.bcf.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, tbi ], fasta - bcf_gz output - stub") { - - config "./nextflow.bcf_gz.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true) - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - vcf_gz_index - stub") { - - config "./vcf_gz_index.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_csi - stub") { - - config "./vcf_gz_index_csi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_tbi - stub") { - - config "./vcf_gz_index_tbi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - - -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/norm/tests/main.nf.test.snap b/modules/nf-core/bcftools/norm/tests/main.nf.test.snap deleted file mode 100644 index 3be52116a9..0000000000 --- a/modules/nf-core/bcftools/norm/tests/main.nf.test.snap +++ /dev/null @@ -1,758 +0,0 @@ -{ - "sarscov2 - [ vcf, tbi ], fasta - vcf_gz output - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:38:42.639095032" - }, - "sarscov2 - [ vcf, [] ], fasta - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:38:05.448449893" - }, - "sarscov2 - [ vcf, tbi ], fasta - vcf output": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:37:12.741719961" - }, - "sarscov2 - [ vcf, [] ], fasta - vcf_gz_index - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:39:22.875147941" - }, - "sarscov2 - [ vcf, tbi ], fasta - vcf_gz output": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-05T08:15:23.38765384" - }, - "sarscov2 - [ vcf, [] ], fasta": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:36:21.519977754" - }, - "sarscov2 - [ vcf, tbi ], fasta - vcf output -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:38:27.8230994" - }, - "sarscov2 - [ vcf, tbi ], fasta - bcf_gz output": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.bcf:md5,f35545c26a788b5eb697d9c0490339d9" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.bcf:md5,f35545c26a788b5eb697d9c0490339d9" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:37:53.942403192" - }, - "sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_csi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-05T13:56:05.3799488" - }, - "sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_tbi": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-05T13:53:28.356741947" - }, - "sarscov2 - [ vcf, tbi ], fasta": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:36:58.39445154" - }, - "sarscov2 - [ vcf, tbi ], fasta -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:38:16.259516142" - }, - "sarscov2 - [ vcf, tbi ], fasta - bcf_gz output - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.bcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.bcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:39:10.503208929" - }, - "sarscov2 - [ vcf, [] ], fasta - vcf_gz_index": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-05T07:52:58.381931979" - }, - "sarscov2 - [ vcf, tbi ], fasta - bcf output - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.bcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.bcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:38:59.121377258" - }, - "sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_tbi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-05T13:56:16.404380471" - }, - "sarscov2 - [ vcf, [] ], fasta - vcf_gz_index_csi": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,63e5adbaf3dd94550e9e3d7935dd28db" - ] - ], - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-05T13:53:09.808834237" - }, - "sarscov2 - [ vcf, tbi ], fasta - bcf output": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_norm.bcf.gz:md5,638c3c25bdd495c90ecbccb69ee77f07" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_norm.bcf.gz:md5,638c3c25bdd495c90ecbccb69ee77f07" - ] - ], - "versions": [ - "versions.yml:md5,ff760495922469e56d0fc3372773000d" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-04T14:37:42.141945244" - } -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/norm/tests/nextflow.bcf.config b/modules/nf-core/bcftools/norm/tests/nextflow.bcf.config deleted file mode 100644 index b79af86817..0000000000 --- a/modules/nf-core/bcftools/norm/tests/nextflow.bcf.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = '-m -any --output-type b --no-version' - ext.prefix = "test_norm" -} diff --git a/modules/nf-core/bcftools/norm/tests/nextflow.bcf_gz.config b/modules/nf-core/bcftools/norm/tests/nextflow.bcf_gz.config deleted file mode 100644 index f36f397c2c..0000000000 --- a/modules/nf-core/bcftools/norm/tests/nextflow.bcf_gz.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = '-m -any --output-type u --no-version' - ext.prefix = "test_norm" -} diff --git a/modules/nf-core/bcftools/norm/tests/nextflow.config b/modules/nf-core/bcftools/norm/tests/nextflow.config deleted file mode 100644 index 510803b407..0000000000 --- a/modules/nf-core/bcftools/norm/tests/nextflow.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = '-m -any --no-version' - ext.prefix = "test_norm" -} diff --git a/modules/nf-core/bcftools/norm/tests/nextflow.vcf.config b/modules/nf-core/bcftools/norm/tests/nextflow.vcf.config deleted file mode 100644 index 10bf93e320..0000000000 --- a/modules/nf-core/bcftools/norm/tests/nextflow.vcf.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = '-m -any --output-type v --no-version' - ext.prefix = "test_norm" -} diff --git a/modules/nf-core/bcftools/norm/tests/nextflow.vcf_gz.config b/modules/nf-core/bcftools/norm/tests/nextflow.vcf_gz.config deleted file mode 100644 index b31dd2de22..0000000000 --- a/modules/nf-core/bcftools/norm/tests/nextflow.vcf_gz.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.args = '-m -any --output-type z ---no-version' - ext.prefix = "test_norm" -} diff --git a/modules/nf-core/bcftools/norm/tests/tags.yml b/modules/nf-core/bcftools/norm/tests/tags.yml deleted file mode 100644 index f6f5e35616..0000000000 --- a/modules/nf-core/bcftools/norm/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -bcftools/norm: - - "modules/nf-core/bcftools/norm/**" diff --git a/modules/nf-core/bcftools/norm/tests/vcf_gz_index.config b/modules/nf-core/bcftools/norm/tests/vcf_gz_index.config deleted file mode 100644 index 7dd696ee26..0000000000 --- a/modules/nf-core/bcftools/norm/tests/vcf_gz_index.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index --no-version" -} diff --git a/modules/nf-core/bcftools/norm/tests/vcf_gz_index_csi.config b/modules/nf-core/bcftools/norm/tests/vcf_gz_index_csi.config deleted file mode 100644 index aebffb6fb7..0000000000 --- a/modules/nf-core/bcftools/norm/tests/vcf_gz_index_csi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index=csi --no-version" -} diff --git a/modules/nf-core/bcftools/norm/tests/vcf_gz_index_tbi.config b/modules/nf-core/bcftools/norm/tests/vcf_gz_index_tbi.config deleted file mode 100644 index b192ae7d19..0000000000 --- a/modules/nf-core/bcftools/norm/tests/vcf_gz_index_tbi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index=tbi --no-version" -} diff --git a/modules/nf-core/bcftools/sort/tests/main.nf.test b/modules/nf-core/bcftools/sort/tests/main.nf.test deleted file mode 100644 index b9bdd76a09..0000000000 --- a/modules/nf-core/bcftools/sort/tests/main.nf.test +++ /dev/null @@ -1,222 +0,0 @@ -nextflow_process { - - name "Test Process BCFTOOLS_SORT" - script "../main.nf" - process "BCFTOOLS_SORT" - - tag "modules" - tag "modules_nfcore" - tag "bcftools" - tag "bcftools/sort" - - test("sarscov2 - vcf") { - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match("vcf") } - ) - } - - } - - test("sarscov2 - vcf_gz_index") { - - config "./vcf_gz_index.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - vcf_gz_index_csi") { - - config "./vcf_gz_index_csi.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - vcf_gz_index_tbi") { - - config "./vcf_gz_index_tbi.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.tbi.collect { it.collect { it instanceof Map ? it : file(it).name } }, - process.out.versions - ).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } - - test("sarscov2 - vcf - stub") { - options "-stub" - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - vcf_gz_index - stub") { - - config "./vcf_gz_index.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - vcf_gz_index_csi - stub") { - - config "./vcf_gz_index_csi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.csi[0][1].endsWith(".csi") } - ) - } - - } - - test("sarscov2 - vcf_gz_index_tbi - stub") { - - config "./vcf_gz_index_tbi.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert process.out.tbi[0][1].endsWith(".tbi") } - ) - } - - } -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/sort/tests/main.nf.test.snap b/modules/nf-core/bcftools/sort/tests/main.nf.test.snap deleted file mode 100644 index f092dbf591..0000000000 --- a/modules/nf-core/bcftools/sort/tests/main.nf.test.snap +++ /dev/null @@ -1,350 +0,0 @@ -{ - "sarscov2 - vcf_gz_index_tbi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:26.694501734" - }, - "vcf": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,8e722884ffb75155212a3fc053918766" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,8e722884ffb75155212a3fc053918766" - ] - ], - "versions": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:10:49.218451505" - }, - "sarscov2 - vcf_gz_index": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,8e722884ffb75155212a3fc053918766" - ] - ], - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi" - ] - ], - [ - - ], - [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:10:56.259159613" - }, - "sarscov2 - vcf_gz_index_csi": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,8e722884ffb75155212a3fc053918766" - ] - ], - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi" - ] - ], - [ - - ], - [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:00.358141543" - }, - "sarscov2 - vcf_gz_index - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ], - "csi": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:18.590986384" - }, - "sarscov2 - vcf_gz_index_csi - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ], - "csi": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:22.65765844" - }, - "sarscov2 - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:11.501401617" - }, - "sarscov2 - vcf_gz_index_tbi": { - "content": [ - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz:md5,8e722884ffb75155212a3fc053918766" - ] - ], - [ - - ], - [ - [ - { - "id": "test" - }, - "test_vcf.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,54b077078de3c204fb81688af4aae489" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:07.401740499" - } -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/sort/tests/vcf_gz_index.config b/modules/nf-core/bcftools/sort/tests/vcf_gz_index.config deleted file mode 100644 index aacd13464a..0000000000 --- a/modules/nf-core/bcftools/sort/tests/vcf_gz_index.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index" -} diff --git a/modules/nf-core/bcftools/sort/tests/vcf_gz_index_csi.config b/modules/nf-core/bcftools/sort/tests/vcf_gz_index_csi.config deleted file mode 100644 index 640eb0ba56..0000000000 --- a/modules/nf-core/bcftools/sort/tests/vcf_gz_index_csi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index=csi" -} diff --git a/modules/nf-core/bcftools/sort/tests/vcf_gz_index_tbi.config b/modules/nf-core/bcftools/sort/tests/vcf_gz_index_tbi.config deleted file mode 100644 index 589a50c65d..0000000000 --- a/modules/nf-core/bcftools/sort/tests/vcf_gz_index_tbi.config +++ /dev/null @@ -1,4 +0,0 @@ -process { - ext.prefix = { "${meta.id}_vcf" } - ext.args = "--output-type z --write-index=tbi" -} diff --git a/modules/nf-core/bcftools/stats/tests/main.nf.test b/modules/nf-core/bcftools/stats/tests/main.nf.test deleted file mode 100644 index be618b0b17..0000000000 --- a/modules/nf-core/bcftools/stats/tests/main.nf.test +++ /dev/null @@ -1,182 +0,0 @@ -nextflow_process { - - name "Test Process BCFTOOLS_STATS" - script "../main.nf" - process "BCFTOOLS_STATS" - - tag "modules" - tag "modules_nfcore" - tag "bcftools" - tag "bcftools/stats" - - test("sarscov2 - vcf_gz") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - []] - input[1] = [ [], [] ] - input[2] = [ [], [] ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions") }, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0..5]).match() }, - ) - } - - } - - test("sarscov2 - vcf_gz - regions") { - - when { - process { - """ - input[0] = [ [ id:'regions_test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)] - input[1] = [ [id:'regions_test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test3.vcf.gz', checkIfExists: true) ] - input[2] = [ [], [] ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("regions_versions") }, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0..5]).match() }, - ) - } - - } - - test("sarscov2 - vcf_gz - targets") { - - when { - process { - """ - input[0] = [ [ id:'targets_test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] ] - input[1] = [ [], [] ] - input[2] = [ [id:'targets_test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.targets.tsv.gz', checkIfExists: true) - ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("targets_versions") }, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0..5]).match() }, - ) - } - - } - - test("sarscov2 - vcf_gz - exons") { - - when { - process { - """ - input[0] = [ [ id:'exon_test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] ] - input[1] = [ [], [] ] - input[2] = [ [], [] ] - input[3] = [ [], [] ] - input[4] = [ [id: "exon_test"], - file(params.modules_testdata_base_path + 'delete_me/bcftools/stats/exons.tsv.gz', checkIfExists: true) ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("exon_versions") }, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0..5]).match() }, - ) - } - - } - - test("sarscov2 - vcf_gz - reference") { - - when { - process { - """ - input[0] = [ [ id:'ref_test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - [] ] - input[1] = [ [], [] ] - input[2] = [ [], [] ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [id: 'ref_test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("ref_versions") }, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0..5]).match() }, - ) - } - - } - - - test("sarscov2 - vcf_gz - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - []] - input[1] = [ [], [] ] - input[2] = [ [], [] ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} \ No newline at end of file diff --git a/modules/nf-core/bcftools/stats/tests/main.nf.test.snap b/modules/nf-core/bcftools/stats/tests/main.nf.test.snap deleted file mode 100644 index c771a055b9..0000000000 --- a/modules/nf-core/bcftools/stats/tests/main.nf.test.snap +++ /dev/null @@ -1,180 +0,0 @@ -{ - "sarscov2 - vcf_gz - reference": { - "content": [ - [ - "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", - "# The command line was:\tbcftools stats --fasta-ref genome.fasta test.vcf.gz", - "#", - "# Definition of sets:", - "# ID\t[2]id\t[3]tab-separated file names", - "ID\t0\ttest.vcf.gz" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:12:00.636338532" - }, - "sarscov2 - vcf_gz - exons": { - "content": [ - [ - "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", - "# The command line was:\tbcftools stats --exons exons.tsv.gz test.vcf.gz", - "#", - "# Definition of sets:", - "# ID\t[2]id\t[3]tab-separated file names", - "ID\t0\ttest.vcf.gz" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:56.472662944" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:38.17663878" - }, - "sarscov2 - vcf_gz - targets": { - "content": [ - [ - "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", - "# The command line was:\tbcftools stats --targets-file test2.targets.tsv.gz test.vcf.gz", - "#", - "# Definition of sets:", - "# ID\t[2]id\t[3]tab-separated file names", - "ID\t0\ttest.vcf.gz" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:49.263021261" - }, - "regions_versions": { - "content": [ - [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:45.263363932" - }, - "targets_versions": { - "content": [ - [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:49.260150422" - }, - "sarscov2 - vcf_gz - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bcftools_stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ], - "stats": [ - [ - { - "id": "test" - }, - "test.bcftools_stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:12:07.469893476" - }, - "exon_versions": { - "content": [ - [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:56.46980859" - }, - "ref_versions": { - "content": [ - [ - "versions.yml:md5,d8ba64d31cb19c789af4726840d8f5f4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:12:00.633746007" - }, - "sarscov2 - vcf_gz": { - "content": [ - [ - "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", - "# The command line was:\tbcftools stats test.vcf.gz", - "#", - "# Definition of sets:", - "# ID\t[2]id\t[3]tab-separated file names", - "ID\t0\ttest.vcf.gz" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:38.184907984" - }, - "sarscov2 - vcf_gz - regions": { - "content": [ - [ - "# This file was produced by bcftools stats (1.21+htslib-1.21) and can be plotted using plot-vcfstats.", - "# The command line was:\tbcftools stats --regions-file test3.vcf.gz test.vcf.gz", - "#", - "# Definition of sets:", - "# ID\t[2]id\t[3]tab-separated file names", - "ID\t0\ttest.vcf.gz" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T14:11:45.266296334" - } -} \ No newline at end of file diff --git a/modules/nf-core/bwa/index/tests/main.nf.test b/modules/nf-core/bwa/index/tests/main.nf.test deleted file mode 100644 index af33e73ca1..0000000000 --- a/modules/nf-core/bwa/index/tests/main.nf.test +++ /dev/null @@ -1,33 +0,0 @@ -nextflow_process { - - name "Test Process BWA_INDEX" - tag "modules_nfcore" - tag "modules" - tag "bwa" - tag "bwa/index" - script "../main.nf" - process "BWA_INDEX" - - test("BWA index") { - - when { - process { - """ - input[0] = [ - [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/bwa/index/tests/main.nf.test.snap b/modules/nf-core/bwa/index/tests/main.nf.test.snap deleted file mode 100644 index 7c8f046578..0000000000 --- a/modules/nf-core/bwa/index/tests/main.nf.test.snap +++ /dev/null @@ -1,47 +0,0 @@ -{ - "BWA index": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - [ - "genome.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", - "genome.ann:md5,c32e11f6c859f166c7525a9c1d583567", - "genome.bwt:md5,0469c30a1e239dd08f68afe66fde99da", - "genome.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66", - "genome.sa:md5,ab3952cabf026b48cd3eb5bccbb636d1" - ] - ] - ], - "1": [ - "versions.yml:md5,a64462ac7dfb21f4ade9b02e7f65c5bb" - ], - "index": [ - [ - { - "id": "test" - }, - [ - "genome.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", - "genome.ann:md5,c32e11f6c859f166c7525a9c1d583567", - "genome.bwt:md5,0469c30a1e239dd08f68afe66fde99da", - "genome.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66", - "genome.sa:md5,ab3952cabf026b48cd3eb5bccbb636d1" - ] - ] - ], - "versions": [ - "versions.yml:md5,a64462ac7dfb21f4ade9b02e7f65c5bb" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-05-16T11:40:09.925307" - } -} \ No newline at end of file diff --git a/modules/nf-core/bwa/mem/tests/main.nf.test b/modules/nf-core/bwa/mem/tests/main.nf.test deleted file mode 100644 index 5de2c2f453..0000000000 --- a/modules/nf-core/bwa/mem/tests/main.nf.test +++ /dev/null @@ -1,260 +0,0 @@ -nextflow_process { - - name "Test Process BWA_MEM" - tag "modules_nfcore" - tag "modules" - tag "bwa" - tag "bwa/mem" - tag "bwa/index" - script "../main.nf" - process "BWA_MEM" - - setup { - run("BWA_INDEX") { - script "../../index/main.nf" - process { - """ - input[0] = [ - [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - test("Single-End") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.cram, - process.out.csi, - process.out.crai, - process.out.versions, - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5() - ).match() - } - ) - } - - } - - test("Single-End Sort") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.cram, - process.out.csi, - process.out.crai, - process.out.versions, - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5() - ).match() - } - ) - } - - } - - test("Paired-End") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.cram, - process.out.csi, - process.out.crai, - process.out.versions, - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5() - ).match() - } - ) - } - - } - - test("Paired-End Sort") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.cram, - process.out.csi, - process.out.crai, - process.out.versions, - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5() - ).match() - } - ) - } - - } - - test("Paired-End - no fasta") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[:],[]] - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.cram, - process.out.csi, - process.out.crai, - process.out.versions, - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5() - ).match() - } - ) - } - - } - - test("Single-end - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Paired-end - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = BWA_INDEX.out.index - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/bwa/mem/tests/main.nf.test.snap b/modules/nf-core/bwa/mem/tests/main.nf.test.snap deleted file mode 100644 index 3aaefdda39..0000000000 --- a/modules/nf-core/bwa/mem/tests/main.nf.test.snap +++ /dev/null @@ -1,271 +0,0 @@ -{ - "Single-End": { - "content": [ - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "53df0e7b72f1f85fb28af5fec435246", - "798439cbd7fd81cbcc5078022dc5479d" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:36:00.831642964" - }, - "Single-End Sort": { - "content": [ - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "5eca502b75fefc26e8000908bf0bb3a3", - "94fcf617f5b994584c4e8d4044e16b4f" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:36:16.025706238" - }, - "Paired-End": { - "content": [ - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "fec2aafbba4637767bc4e202c71aee58", - "57aeef88ed701a8ebc8e2f0a381b2a6" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:36:27.309924644" - }, - "Paired-End Sort": { - "content": [ - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "d5ad8844218280969c1f9349bd62d057", - "af8628d9df18b2d3d4f6fd47ef2bb872" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:36:45.448624985" - }, - "Single-end - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "bam": [ - [ - { - "id": "test", - "single_end": true - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "crai": [ - [ - { - "id": "test", - "single_end": true - }, - "test.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - - ], - "csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:37:16.211123969" - }, - "Paired-End - no fasta": { - "content": [ - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "fec2aafbba4637767bc4e202c71aee58", - "57aeef88ed701a8ebc8e2f0a381b2a6" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:36:56.592159657" - }, - "Paired-end - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "crai": [ - [ - { - "id": "test", - "single_end": false - }, - "test.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - - ], - "csi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,c60680eba0f00e791c0d5a0a6e9d665f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T08:37:32.177177506" - } -} \ No newline at end of file diff --git a/modules/nf-core/bwamem2/index/tests/main.nf.test b/modules/nf-core/bwamem2/index/tests/main.nf.test deleted file mode 100644 index dbf11132c7..0000000000 --- a/modules/nf-core/bwamem2/index/tests/main.nf.test +++ /dev/null @@ -1,31 +0,0 @@ -nextflow_process { - - name "Test Process BWAMEM2_INDEX" - tag "modules_nfcore" - tag "modules" - tag "bwamem2" - tag "bwamem2/index" - script "../main.nf" - process "BWAMEM2_INDEX" - - test("BWAMEM2 index") { - - when { - process { - """ - input[0] = [ - [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/bwamem2/index/tests/main.nf.test.snap b/modules/nf-core/bwamem2/index/tests/main.nf.test.snap deleted file mode 100644 index 69b268ee46..0000000000 --- a/modules/nf-core/bwamem2/index/tests/main.nf.test.snap +++ /dev/null @@ -1,47 +0,0 @@ -{ - "BWAMEM2 index": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - [ - "genome.fasta.0123:md5,b02870de80106104abcb03cd9463e7d8", - "genome.fasta.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", - "genome.fasta.ann:md5,c32e11f6c859f166c7525a9c1d583567", - "genome.fasta.bwt.2bit.64:md5,d097a1b82dee375d41a1ea69895a9216", - "genome.fasta.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66" - ] - ] - ], - "1": [ - "versions.yml:md5,9ffd13d12e7108ed15c58566bc4717d6" - ], - "index": [ - [ - { - "id": "test" - }, - [ - "genome.fasta.0123:md5,b02870de80106104abcb03cd9463e7d8", - "genome.fasta.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", - "genome.fasta.ann:md5,c32e11f6c859f166c7525a9c1d583567", - "genome.fasta.bwt.2bit.64:md5,d097a1b82dee375d41a1ea69895a9216", - "genome.fasta.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66" - ] - ] - ], - "versions": [ - "versions.yml:md5,9ffd13d12e7108ed15c58566bc4717d6" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.02.0" - }, - "timestamp": "2024-03-18T12:59:39.132616" - } -} \ No newline at end of file diff --git a/modules/nf-core/bwamem2/mem/tests/main.nf.test b/modules/nf-core/bwamem2/mem/tests/main.nf.test deleted file mode 100644 index 9e0ab14aec..0000000000 --- a/modules/nf-core/bwamem2/mem/tests/main.nf.test +++ /dev/null @@ -1,179 +0,0 @@ -nextflow_process { - - name "Test Process BWAMEM2_MEM" - script "../main.nf" - process "BWAMEM2_MEM" - - tag "modules" - tag "modules_nfcore" - tag "bwamem2" - tag "bwamem2/mem" - tag "bwamem2/index" - - setup { - run("BWAMEM2_INDEX") { - script "../../index/main.nf" - process { - """ - input[0] = Channel.of([ - [:], // meta map - [file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - ]) - """ - } - } - } - - test("sarscov2 - fastq, index, fasta, false") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] - ]) - input[1] = BWAMEM2_INDEX.out.index - input[2] = Channel.of([[:], [file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]]) - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5(), - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - fastq, index, fasta, true") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] - ]) - input[1] = BWAMEM2_INDEX.out.index - input[2] = Channel.of([[:], [file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]]) - input[3] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5(), - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - [fastq1, fastq2], index, fasta, false") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ]) - input[1] = BWAMEM2_INDEX.out.index - input[2] = Channel.of([[:], [file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]]) - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5(), - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - [fastq1, fastq2], index, fasta, true") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ]) - input[1] = BWAMEM2_INDEX.out.index - input[2] = Channel.of([[:], [file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]]) - input[3] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5(), - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - [fastq1, fastq2], index, fasta, true - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ]) - input[1] = BWAMEM2_INDEX.out.index - input[2] = Channel.of([[:], [file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]]) - input[3] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap b/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap deleted file mode 100644 index ec90701f33..0000000000 --- a/modules/nf-core/bwamem2/mem/tests/main.nf.test.snap +++ /dev/null @@ -1,129 +0,0 @@ -{ - "sarscov2 - [fastq1, fastq2], index, fasta, false": { - "content": [ - "9505760d66e1d5a5d34ab79a98228c6", - "57aeef88ed701a8ebc8e2f0a381b2a6", - [ - "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T10:57:52.782442426" - }, - "sarscov2 - [fastq1, fastq2], index, fasta, true - stub": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": false - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "5": [ - "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "crai": [ - - ], - "cram": [ - - ], - "csi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "sam": [ - - ], - "versions": [ - "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T10:58:37.140104324" - }, - "sarscov2 - [fastq1, fastq2], index, fasta, true": { - "content": [ - "e0c38d5772ca5f4d5d9999f4477e933c", - "af8628d9df18b2d3d4f6fd47ef2bb872", - [ - "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T10:58:19.047052261" - }, - "sarscov2 - fastq, index, fasta, false": { - "content": [ - "58d05395bbb819e929885bde415947ae", - "798439cbd7fd81cbcc5078022dc5479d", - [ - "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T10:56:53.456559296" - }, - "sarscov2 - fastq, index, fasta, true": { - "content": [ - "276189f6f003f99a87664e74fad2893d", - "94fcf617f5b994584c4e8d4044e16b4f", - [ - "versions.yml:md5,ca1b1dcf82b92fb0751816fca16a477a" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-27T10:57:21.949711746" - } -} \ No newline at end of file diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test deleted file mode 100644 index 9cb1617883..0000000000 --- a/modules/nf-core/cat/cat/tests/main.nf.test +++ /dev/null @@ -1,191 +0,0 @@ -nextflow_process { - - name "Test Process CAT_CAT" - script "../main.nf" - process "CAT_CAT" - tag "modules" - tag "modules_nfcore" - tag "cat" - tag "cat/cat" - - test("test_cat_name_conflict") { - when { - params { - outdir = "${outputDir}" - } - process { - """ - input[0] = - [ - [ id:'genome', single_end:true ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) - ] - ] - """ - } - } - then { - assertAll( - { assert !process.success }, - { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("test_cat_unzipped_unzipped") { - when { - params { - outdir = "${outputDir}" - } - process { - """ - input[0] = - [ - [ id:'test', single_end:true ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) - ] - ] - """ - } - } - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - - test("test_cat_zipped_zipped") { - when { - params { - outdir = "${outputDir}" - } - process { - """ - input[0] = - [ - [ id:'test', single_end:true ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/alignment/last/contigs.genome.maf.gz', checkIfExists: true) - ] - ] - """ - } - } - then { - def lines = path(process.out.file_out.get(0).get(1)).linesGzip - assertAll( - { assert process.success }, - { assert snapshot( - lines[0..5], - lines.size(), - process.out.versions - ).match() - } - ) - } - } - - test("test_cat_zipped_unzipped") { - config './nextflow_zipped_unzipped.config' - - when { - params { - outdir = "${outputDir}" - } - process { - """ - input[0] = - [ - [ id:'test', single_end:true ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/alignment/last/contigs.genome.maf.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cat_unzipped_zipped") { - config './nextflow_unzipped_zipped.config' - when { - params { - outdir = "${outputDir}" - } - process { - """ - input[0] = - [ - [ id:'test', single_end:true ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) - ] - ] - """ - } - } - then { - def lines = path(process.out.file_out.get(0).get(1)).linesGzip - assertAll( - { assert process.success }, - { assert snapshot( - lines[0..5], - lines.size(), - process.out.versions - ).match() - } - ) - } - } - - test("test_cat_one_file_unzipped_zipped") { - config './nextflow_unzipped_zipped.config' - when { - params { - outdir = "${outputDir}" - } - process { - """ - input[0] = - [ - [ id:'test', single_end:true ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - ] - """ - } - } - then { - def lines = path(process.out.file_out.get(0).get(1)).linesGzip - assertAll( - { assert process.success }, - { assert snapshot( - lines[0..5], - lines.size(), - process.out.versions - ).match() - } - ) - } - } -} diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap deleted file mode 100644 index b7623ee650..0000000000 --- a/modules/nf-core/cat/cat/tests/main.nf.test.snap +++ /dev/null @@ -1,147 +0,0 @@ -{ - "test_cat_unzipped_unzipped": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2" - ] - ], - "1": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ], - "file_out": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2" - ] - ], - "versions": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2023-10-16T14:32:18.500464399" - }, - "test_cat_zipped_unzipped": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9" - ] - ], - "1": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ], - "file_out": [ - [ - { - "id": "test", - "single_end": true - }, - "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9" - ] - ], - "versions": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2023-10-16T14:32:49.642741302" - }, - "test_cat_zipped_zipped": { - "content": [ - [ - "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab", - "MT192765.1\tGenbank\tgene\t259\t21548\t.\t+\t.\tParent=unknown_transcript_1", - "MT192765.1\tGenbank\tCDS\t259\t13461\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", - "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", - "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1", - "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1" - ], - 78, - [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:51:46.802978" - }, - "test_cat_name_conflict": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:51:29.45394" - }, - "test_cat_one_file_unzipped_zipped": { - "content": [ - [ - ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", - "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", - "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", - "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", - "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", - "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" - ], - 374, - [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:52:02.774016" - }, - "test_cat_unzipped_zipped": { - "content": [ - [ - ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", - "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", - "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", - "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", - "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", - "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" - ], - 375, - [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:51:57.581523" - } -} \ No newline at end of file diff --git a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config deleted file mode 100644 index ec26b0fdc6..0000000000 --- a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config +++ /dev/null @@ -1,6 +0,0 @@ - -process { - withName: CAT_CAT { - ext.prefix = 'cat.txt.gz' - } -} diff --git a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config deleted file mode 100644 index fbc79783d5..0000000000 --- a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config +++ /dev/null @@ -1,8 +0,0 @@ - -process { - - withName: CAT_CAT { - ext.prefix = 'cat.txt' - } - -} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test deleted file mode 100644 index 013c1d0f49..0000000000 --- a/modules/nf-core/cat/fastq/tests/main.nf.test +++ /dev/null @@ -1,334 +0,0 @@ -nextflow_process { - - name "Test Process CAT_FASTQ" - script "../main.nf" - process "CAT_FASTQ" - tag "modules" - tag "modules_nfcore" - tag "cat" - tag "cat/fastq" - - test("test_cat_fastq_single_end") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_paired_end") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_single_end_same_name") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_paired_end_same_name") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_single_end_single_file") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_single_end - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_paired_end - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_single_end_same_name - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_paired_end_same_name - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_single_end_single_file - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_cat_fastq_single_end_no_files") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [] - ]) - """ - } - } - - then { - assertAll( - { assert process.failed }, - { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } - ) - } - } - - test("test_cat_fastq_paired_end_no_files") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [] - ]) - """ - } - } - - then { - assertAll( - { assert process.failed }, - { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } - ) - } - } - - test("test_cat_fastq_single_end_no_files - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [] - ]) - """ - } - } - - then { - assertAll( - { assert process.failed }, - { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } - ) - } - } - - test("test_cat_fastq_paired_end_no_files - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [] - ]) - """ - } - } - - then { - assertAll( - { assert process.failed }, - { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } - ) - } - } -} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap deleted file mode 100644 index ee5ab36476..0000000000 --- a/modules/nf-core/cat/fastq/tests/main.nf.test.snap +++ /dev/null @@ -1,416 +0,0 @@ -{ - "test_cat_fastq_paired_end_no_files - stub": { - "content": [ - " Could not find any FASTQ file pairs to concatenate in the process input" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:14:51.248685461" - }, - "test_cat_fastq_single_end_single_file": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:24:04.902821069" - }, - "test_cat_fastq_paired_end_same_name": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", - "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" - ] - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", - "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" - ] - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:23:57.476357974" - }, - "test_cat_fastq_paired_end_same_name - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:24:34.615815265" - }, - "test_cat_fastq_single_end": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:23:32.489874386" - }, - "test_cat_fastq_single_end_same_name": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:23:49.184759506" - }, - "test_cat_fastq_single_end - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:24:12.857293744" - }, - "test_cat_fastq_paired_end_no_files": { - "content": [ - " Could not find any FASTQ file pairs to concatenate in the process input" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:14:40.806088747" - }, - "test_cat_fastq_single_end_no_files - stub": { - "content": [ - " Could not find any FASTQ files to concatenate in the process input" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:14:45.852365218" - }, - "test_cat_fastq_single_end_same_name - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:24:27.816080065" - }, - "test_cat_fastq_paired_end": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", - "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" - ] - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", - "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" - ] - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:23:41.739469187" - }, - "test_cat_fastq_single_end_no_files": { - "content": [ - " Could not find any FASTQ files to concatenate in the process input" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:14:35.695192409" - }, - "test_cat_fastq_paired_end - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:24:21.178950408" - }, - "test_cat_fastq_single_end_single_file - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-25T17:24:40.851404993" - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/antitarget/tests/main.nf.test b/modules/nf-core/cnvkit/antitarget/tests/main.nf.test deleted file mode 100644 index 84f3818007..0000000000 --- a/modules/nf-core/cnvkit/antitarget/tests/main.nf.test +++ /dev/null @@ -1,58 +0,0 @@ -nextflow_process { - - name "Test Process CNVKIT_ANTITARGET" - script "../main.nf" - process "CNVKIT_ANTITARGET" - - tag "modules" - tag "modules_nfcore" - tag "cnvkit" - tag "cnvkit/antitarget" - - test("human - bed") { - - when { - process { - """ - input[0] = [ - [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("human - bed - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/cnvkit/antitarget/tests/main.nf.test.snap b/modules/nf-core/cnvkit/antitarget/tests/main.nf.test.snap deleted file mode 100644 index 57bccf9f99..0000000000 --- a/modules/nf-core/cnvkit/antitarget/tests/main.nf.test.snap +++ /dev/null @@ -1,68 +0,0 @@ -{ - "human - bed - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.antitarget.bed:md5,3d4d20f9f23b39970865d29ef239d20b" - ] - ], - "1": [ - "versions.yml:md5,b5e73ea85743cedc68ca6ef8006e5030" - ], - "bed": [ - [ - { - "id": "test" - }, - "test.antitarget.bed:md5,3d4d20f9f23b39970865d29ef239d20b" - ] - ], - "versions": [ - "versions.yml:md5,b5e73ea85743cedc68ca6ef8006e5030" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-13T13:58:45.758206" - }, - "human - bed": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.antitarget.bed:md5,3d4d20f9f23b39970865d29ef239d20b" - ] - ], - "1": [ - "versions.yml:md5,b5e73ea85743cedc68ca6ef8006e5030" - ], - "bed": [ - [ - { - "id": "test" - }, - "test.antitarget.bed:md5,3d4d20f9f23b39970865d29ef239d20b" - ] - ], - "versions": [ - "versions.yml:md5,b5e73ea85743cedc68ca6ef8006e5030" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-06-10T10:32:33.936192" - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/batch/tests/batch_hybrid.config b/modules/nf-core/cnvkit/batch/tests/batch_hybrid.config deleted file mode 100644 index 07a21b1a73..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/batch_hybrid.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - - withName: CNVKIT_BATCH { - ext.args = '--output-reference reference.cnn' - } -} diff --git a/modules/nf-core/cnvkit/batch/tests/batch_pon.config b/modules/nf-core/cnvkit/batch/tests/batch_pon.config deleted file mode 100644 index 3897370788..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/batch_pon.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - - withName: CNVKIT_BATCH { - ext.args = '--method wgs --output-reference panel_of_normals.cnn' - } -} diff --git a/modules/nf-core/cnvkit/batch/tests/batch_tumouronly.config b/modules/nf-core/cnvkit/batch/tests/batch_tumouronly.config deleted file mode 100644 index 91074ff0be..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/batch_tumouronly.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - - withName: CNVKIT_BATCH { - ext.args = '--method wgs' - } -} diff --git a/modules/nf-core/cnvkit/batch/tests/batch_wgs.config b/modules/nf-core/cnvkit/batch/tests/batch_wgs.config deleted file mode 100644 index 48fc879535..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/batch_wgs.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - - withName: CNVKIT_BATCH { - ext.args = '--output-reference reference.cnn --method wgs' - } -} diff --git a/modules/nf-core/cnvkit/batch/tests/main.nf.test b/modules/nf-core/cnvkit/batch/tests/main.nf.test deleted file mode 100644 index f191a4b952..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/main.nf.test +++ /dev/null @@ -1,289 +0,0 @@ -nextflow_process { - - name "Test Process CNVKIT_BATCH" - script "../main.nf" - process "CNVKIT_BATCH" - - tag "modules" - tag "modules_nfcore" - tag "cnvkit" - tag "cnvkit/batch" - - test("cnvkit batch hybrid mode - bam") { - - config "./batch_hybrid.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true) - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],[]] - input[3] = [[:],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/baits.bed', checkIfExists: true)] - input[4] = [[:],[]] - input[5] = false - """ - } - } - - then { - println process.out.bed[0][1] - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("cnvkit batch wgs - bam") { - - config "./batch_wgs.config" - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],[]] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("cnvkit batch wgs - cram") { - - config "./batch_wgs.config" - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("cnvkit batch tumouronly mode - bam") { - - config "./batch_tumouronly.config" - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true), - [] - ] - input[1] = [[:],[]] - input[2] = [[:],[]] - input[3] = [[:],[]] - input[4] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/reference_chr21.cnn', checkIfExists: true)] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("cnvkit batch tumouronly mode - cram") { - - config "./batch_tumouronly.config" - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - [] - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],[]] - input[3] = [[:],[]] - input[4] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/reference_chr21.cnn', checkIfExists: true)] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("cnvkit batch germline mode - cram") { - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true) - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)] - input[2] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true)] - input[4] = [[:],[]] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - - test("cnvkit batch germline hybrid mode - bam") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true) - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],[]] - input[3] = [[:],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/baits.bed', checkIfExists: true)] - input[4] = [[:],[]] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - - test("cnvkit batch pon mode - bam") { - - config "./batch_pon.config" - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - [], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) - ] - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],[]] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - - test("cnvkit batch - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true) - ] - input[1] = [[:],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = [[:],[]] - input[3] = [[:],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/baits.bed', checkIfExists: true)] - input[4] = [[:],[]] - input[5] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.bed, - process.out.versions - ).match() - } - ) - } - - } - -} diff --git a/modules/nf-core/cnvkit/batch/tests/main.nf.test.snap b/modules/nf-core/cnvkit/batch/tests/main.nf.test.snap deleted file mode 100644 index 205d43f8d0..0000000000 --- a/modules/nf-core/cnvkit/batch/tests/main.nf.test.snap +++ /dev/null @@ -1,121 +0,0 @@ -{ - "cnvkit batch tumouronly mode - bam": { - "content": [ - [ - "versions.yml:md5,5737e02065ca6359586a4078708c73e6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:07:07.53837" - }, - "cnvkit batch tumouronly mode - cram": { - "content": [ - [ - "versions.yml:md5,0310a792526148b05f434944a1167835" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:07:48.900117" - }, - "cnvkit batch - bam - stub": { - "content": [ - [ - [ - { - "id": "test" - }, - [ - "baits.antitarget.bed:md5,d41d8cd98f00b204e9800998ecf8427e", - "baits.target.bed:md5,26d25ff2d6c45b6d92169b3559c6acdb" - ] - ] - ], - [ - "versions.yml:md5,5737e02065ca6359586a4078708c73e6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:09:40.098703" - }, - "cnvkit batch wgs - bam": { - "content": [ - [ - "versions.yml:md5,5737e02065ca6359586a4078708c73e6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:06:25.023798" - }, - "cnvkit batch germline hybrid mode - bam": { - "content": [ - [ - "versions.yml:md5,5737e02065ca6359586a4078708c73e6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:09:19.191221" - }, - "cnvkit batch hybrid mode - bam": { - "content": [ - [ - "versions.yml:md5,5737e02065ca6359586a4078708c73e6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:06:10.438545" - }, - "cnvkit batch wgs - cram": { - "content": [ - [ - "versions.yml:md5,0310a792526148b05f434944a1167835" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:06:39.492881" - }, - "cnvkit batch pon mode - bam": { - "content": [ - [ - "versions.yml:md5,5737e02065ca6359586a4078708c73e6" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:09:29.636924" - }, - "cnvkit batch germline mode - cram": { - "content": [ - [ - "versions.yml:md5,0310a792526148b05f434944a1167835" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-07T10:09:07.307311" - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/call/tests/main.nf.test b/modules/nf-core/cnvkit/call/tests/main.nf.test deleted file mode 100644 index b2435e50dd..0000000000 --- a/modules/nf-core/cnvkit/call/tests/main.nf.test +++ /dev/null @@ -1,83 +0,0 @@ - -nextflow_process { - - name "Test Process CNVKIT_CALL" - script "../main.nf" - process "CNVKIT_CALL" - - tag "modules" - tag "modules_nfcore" - tag "cnvkit" - tag "cnvkit/call" - - test("test-cnvkit-call") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true), - [] - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-cnvkit-call-with-vcf") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-cnvkit-call-with-vcf-stub") { - options '-stub' - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/cnvkit/call/tests/main.nf.test.snap b/modules/nf-core/cnvkit/call/tests/main.nf.test.snap deleted file mode 100644 index d78d39b0b0..0000000000 --- a/modules/nf-core/cnvkit/call/tests/main.nf.test.snap +++ /dev/null @@ -1,107 +0,0 @@ -{ - "test-cnvkit-call": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cns:md5,6cff57a91d0376d5d3df6cf669935a82" - ] - ], - "1": [ - "versions.yml:md5,f47253e21b991f72a741d6b5c9a351a5" - ], - "cns": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cns:md5,6cff57a91d0376d5d3df6cf669935a82" - ] - ], - "versions": [ - "versions.yml:md5,f47253e21b991f72a741d6b5c9a351a5" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:17:47.974482513" - }, - "test-cnvkit-call-with-vcf": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cns:md5,c9a2bac6fd2980071a499c0ede0d6274" - ] - ], - "1": [ - "versions.yml:md5,f47253e21b991f72a741d6b5c9a351a5" - ], - "cns": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cns:md5,c9a2bac6fd2980071a499c0ede0d6274" - ] - ], - "versions": [ - "versions.yml:md5,f47253e21b991f72a741d6b5c9a351a5" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:18:06.750975881" - }, - "test-cnvkit-call-with-vcf-stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cns:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,f47253e21b991f72a741d6b5c9a351a5" - ], - "cns": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cns:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,f47253e21b991f72a741d6b5c9a351a5" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-05T22:24:56.743954" - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/export/tests/main.nf.test b/modules/nf-core/cnvkit/export/tests/main.nf.test deleted file mode 100644 index 604649287a..0000000000 --- a/modules/nf-core/cnvkit/export/tests/main.nf.test +++ /dev/null @@ -1,191 +0,0 @@ - -nextflow_process { - - name "Test Process CNVKIT_EXPORT" - script "../main.nf" - process "CNVKIT_EXPORT" - - tag "modules" - tag "modules_nfcore" - tag "cnvkit" - tag "cnvkit/export" - - config "./nextflow.config" - - test("test_cnvkit_export_bed") { - - when { - params { - cnvkit_export_args = "bed -i test --show all" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cnr', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cnvkit_export_vcf") { - - when { - params { - cnvkit_export_args = "vcf -i test" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cnvkit_export_cdt") { - - when { - params { - cnvkit_export_args = "cdt" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cnvkit_export_jtv") { - - when { - params { - cnvkit_export_args = "jtv" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cnvkit_export_seg") { - - when { - params { - cnvkit_export_args = "seg" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cnvkit_export_theta") { - - when { - params { - cnvkit_export_args = "theta" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("test_cnvkit_export_bed - stub") { - options "-stub" - - when { - params { - cnvkit_export_args = "bed -i test" - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/cnvkit/export/tests/main.nf.test.snap b/modules/nf-core/cnvkit/export/tests/main.nf.test.snap deleted file mode 100644 index 5ccf775912..0000000000 --- a/modules/nf-core/cnvkit/export/tests/main.nf.test.snap +++ /dev/null @@ -1,247 +0,0 @@ -{ - "test_cnvkit_export_jtv": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.jtv:md5,cfffd19614115461f25676943b9aba39" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.jtv:md5,cfffd19614115461f25676943b9aba39" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:14:35.903562642" - }, - "test_cnvkit_export_theta": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.theta:md5,8e914fbdb2ffb89a86c511ac482fcf4c" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.theta:md5,8e914fbdb2ffb89a86c511ac482fcf4c" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:15:10.840376238" - }, - "test_cnvkit_export_bed": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,9aed33259897ab550ac9663ce0bbe52c" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,9aed33259897ab550ac9663ce0bbe52c" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:49:08.660743128" - }, - "test_cnvkit_export_bed - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.1" - }, - "timestamp": "2024-12-16T15:14:16.424362905" - }, - "test_cnvkit_export_cdt": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cdt:md5,af9a62a55f9c8f9e0662f5817ead5a11" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cdt:md5,af9a62a55f9c8f9e0662f5817ead5a11" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:14:20.296270798" - }, - "test_cnvkit_export_seg": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.seg:md5,bdcc95c5dd0ad0882b5fde5f478fb09a" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.seg:md5,bdcc95c5dd0ad0882b5fde5f478fb09a" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:14:52.372709238" - }, - "test_cnvkit_export_vcf": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.vcf:md5,0a0b4a00192be12f67bb895888026f00" - ] - ], - "1": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.vcf:md5,0a0b4a00192be12f67bb895888026f00" - ] - ], - "versions": [ - "versions.yml:md5,27d7726ff40cbade06ae393c3600e06f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:51:27.269813231" - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/export/tests/nextflow.config b/modules/nf-core/cnvkit/export/tests/nextflow.config deleted file mode 100644 index 0ca33b46e3..0000000000 --- a/modules/nf-core/cnvkit/export/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: 'CNVKIT_EXPORT' { - ext.args = { params.cnvkit_export_args } - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test b/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test deleted file mode 100644 index 2a24cbab03..0000000000 --- a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test +++ /dev/null @@ -1,59 +0,0 @@ - -nextflow_process { - - name "Test Process CNVKIT_GENEMETRICS" - script "../main.nf" - process "CNVKIT_GENEMETRICS" - - tag "modules" - tag "modules_nfcore" - tag "cnvkit" - tag "cnvkit/genemetrics" - - test("test-cnvkit-genemetrics-with-cns") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cnr', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cns', checkIfExists: true) - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-cnvkit-genemetrics-without-cns") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cnr/test2.paired_end.sorted.cnr', checkIfExists: true), - [] - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap b/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap deleted file mode 100644 index 07ce458992..0000000000 --- a/modules/nf-core/cnvkit/genemetrics/tests/main.nf.test.snap +++ /dev/null @@ -1,72 +0,0 @@ -{ - "test-cnvkit-genemetrics-without-cns": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" - ] - ], - "1": [ - "versions.yml:md5,d3f23da560774564afa9c69e2d171e5f" - ], - "tsv": [ - [ - { - "id": "test", - "single_end": false - }, - "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" - ] - ], - "versions": [ - "versions.yml:md5,d3f23da560774564afa9c69e2d171e5f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:21:17.917810184" - }, - "test-cnvkit-genemetrics-with-cns": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" - ] - ], - "1": [ - "versions.yml:md5,d3f23da560774564afa9c69e2d171e5f" - ], - "tsv": [ - [ - { - "id": "test", - "single_end": false - }, - "test.tsv:md5,5ec3555520f502f00f551ae7900a3824" - ] - ], - "versions": [ - "versions.yml:md5,d3f23da560774564afa9c69e2d171e5f" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2024-12-18T17:21:03.855092906" - } -} \ No newline at end of file diff --git a/modules/nf-core/cnvkit/reference/tests/main.nf.test b/modules/nf-core/cnvkit/reference/tests/main.nf.test deleted file mode 100644 index f03dd231f3..0000000000 --- a/modules/nf-core/cnvkit/reference/tests/main.nf.test +++ /dev/null @@ -1,56 +0,0 @@ -nextflow_process { - - name "Test Process CNVKIT_REFERENCE" - script "../main.nf" - process "CNVKIT_REFERENCE" - - tag "modules" - tag "modules_nfcore" - tag "cnvkit" - tag "cnvkit/reference" - - test("human - [fasta, bed]") { - - when { - process { - """ - input[0] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.antitarget.bed', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("human - [fasta, bed] - stub") { - - options "-stub" - - when { - process { - """ - input[0] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.antitarget.bed', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/cnvkit/reference/tests/main.nf.test.snap b/modules/nf-core/cnvkit/reference/tests/main.nf.test.snap deleted file mode 100644 index eb5dee671d..0000000000 --- a/modules/nf-core/cnvkit/reference/tests/main.nf.test.snap +++ /dev/null @@ -1,48 +0,0 @@ -{ - "human - [fasta, bed]": { - "content": [ - { - "0": [ - "multi_intervals.reference.cnn:md5,7c4a7902f5ab101b1f9d6038d331b3d9" - ], - "1": [ - "versions.yml:md5,85ff8911567b4e1245b883541ad3cc1e" - ], - "cnn": [ - "multi_intervals.reference.cnn:md5,7c4a7902f5ab101b1f9d6038d331b3d9" - ], - "versions": [ - "versions.yml:md5,85ff8911567b4e1245b883541ad3cc1e" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-06-10T10:25:05.273892" - }, - "human - [fasta, bed] - stub": { - "content": [ - { - "0": [ - "multi_intervals.reference.cnn:md5,7c4a7902f5ab101b1f9d6038d331b3d9" - ], - "1": [ - "versions.yml:md5,85ff8911567b4e1245b883541ad3cc1e" - ], - "cnn": [ - "multi_intervals.reference.cnn:md5,7c4a7902f5ab101b1f9d6038d331b3d9" - ], - "versions": [ - "versions.yml:md5,85ff8911567b4e1245b883541ad3cc1e" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-13T14:00:30.095718" - } -} \ No newline at end of file diff --git a/modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test b/modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test deleted file mode 100644 index b44e3b36ab..0000000000 --- a/modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test +++ /dev/null @@ -1,159 +0,0 @@ -nextflow_process { - - name "Test Process CONTROLFREEC_ASSESSSIGNIFICANCE" - script "../main.nf" - process "CONTROLFREEC_ASSESSSIGNIFICANCE" - - tag "modules" - tag "modules_nfcore" - tag "controlfreec" - tag "controlfreec/assesssignificance" - tag "controlfreec/freec" - tag "untar" - - setup { - - run("UNTAR") { - script "../../../../nf-core/untar/main.nf" - process { - """ - input[0] = [ [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz', checkIfExists: true) - ] - """ - } - } - - run("CONTROLFREEC_FREEC") { - script "../../../../nf-core/controlfreec/freec/main.nf" - process { - """ - input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test.mpileup.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - [],[],[],[] - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // snp_position - input[3] = [] - // known_snps - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // known_snps_tbi - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // chr_directory - input[6] = UNTAR.out.untar.map{ it[1] } - // mappability - input[7] = [] - // target_bed - input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // gccontent_profile - input[9] = [] - """ - } - } - - } - - test("human - freec_ratio") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.CNV.join(CONTROLFREEC_FREEC.out.ratio) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.p_value_txt.get(0).get(1)).readLines().contains("chr start end copy number status genotype uncertainty WilcoxonRankSumTestPvalue KolmogorovSmirnovPvalue") }, - { assert snapshot(process.out.versions).match("version") } - ) - } - - } - - // test("human - freec_ratio - single") { - - // config "./nextflow.config" - - // setup { - - // run("CONTROLFREEC_FREEC") { - // script "../../../../nf-core/controlfreec/freec/main.nf" - // process { - // """ - // input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - // [], - // file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - // [],[],[],[] - // ] - // // fasta - // input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // // fai - // input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // // snp_position - // input[3] = [] - // // known_snps - // input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // // known_snps_tbi - // input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // // chr_directory - // input[6] = UNTAR.out.untar.map{ it[1] } - // // mappability - // input[7] = [] - // // target_bed - // input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // // gccontent_profile - // input[9] = [] - // """ - // } - // } - - // } - - // when { - // process { - // """ - // input[0] = CONTROLFREEC_FREEC.out.CNV.join(CONTROLFREEC_FREEC.out.ratio) - // """ - // } - // } - - // then { - // assertAll( - // { assert process.success }, - // { assert snapshot(process.out).match() } - // ) - // } - - // } - - test("human - freec_ratio - stub") { - - options "-stub" - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.CNV.join(CONTROLFREEC_FREEC.out.ratio) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test.snap b/modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test.snap deleted file mode 100644 index ab354908ec..0000000000 --- a/modules/nf-core/controlfreec/assesssignificance/tests/main.nf.test.snap +++ /dev/null @@ -1,51 +0,0 @@ -{ - "human - freec_ratio - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test.p.value.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,81750d0b4c0e563bd392720d09ae024f" - ], - "p_value_txt": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test.p.value.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,81750d0b4c0e563bd392720d09ae024f" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-26T16:24:34.84551" - }, - "version": { - "content": [ - [ - "versions.yml:md5,81750d0b4c0e563bd392720d09ae024f" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-26T17:23:22.833417" - } -} \ No newline at end of file diff --git a/modules/nf-core/controlfreec/assesssignificance/tests/nextflow.config b/modules/nf-core/controlfreec/assesssignificance/tests/nextflow.config deleted file mode 100644 index ca9c22369c..0000000000 --- a/modules/nf-core/controlfreec/assesssignificance/tests/nextflow.config +++ /dev/null @@ -1,23 +0,0 @@ -process { - withName:CONTROLFREEC_FREEC{ - ext.args = { [ - "sample":[ - inputformat: 'pileup', - mateorientation: 'FR' - ], - "general" :[ - bedgraphoutput: "TRUE", - noisydata: "TRUE", - minexpectedgc: "0", - readcountthreshold: "1", - sex: meta.sex, - window: "10", - ], - "control":[ - inputformat: "pileup", - mateorientation: "FR" - ] - ] - } - } -} diff --git a/modules/nf-core/controlfreec/freec/tests/main.nf.test b/modules/nf-core/controlfreec/freec/tests/main.nf.test deleted file mode 100644 index 8e38becdfd..0000000000 --- a/modules/nf-core/controlfreec/freec/tests/main.nf.test +++ /dev/null @@ -1,163 +0,0 @@ -nextflow_process { - - name "Test Process CONTROLFREEC_FREEC" - script "../main.nf" - process "CONTROLFREEC_FREEC" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "controlfreec" - tag "controlfreec/freec" - tag "untar" - - setup { - - run("UNTAR") { - script "../../../../nf-core/untar/main.nf" - process { - """ - input[0] = [ [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz', checkIfExists: true) - ] - """ - } - } - - } - - test("human - mpileup") { - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test.mpileup.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - [],[],[],[] - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // snp_position - input[3] = [] - // known_snps - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // known_snps_tbi - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // chr_directory - input[6] = UNTAR.out.untar.map{ it[1] } - // mappability - input[7] = [] - // target_bed - input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // gccontent_profile - input[9] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - // not asserting optional outputs [bedgraph, control_cpn, gcprofile_cpn] - { assert snapshot( - // match file names - file(process.out.sample_cpn.get(0).get(1)).name, - file(process.out.CNV.get(0).get(1)).name, - // match first line - path(process.out.BAF.get(0).get(1)).readLines()[0], - path(process.out.ratio.get(0).get(1)).readLines()[0], - path(process.out.config.get(0).get(1)).readLines()[0], - path(process.out.info.get(0).get(1)).readLines()[0], - process.out.versions - ).match() } - ) - } - - } - - // test("human - mpileup - single") { - - // when { - // process { - // """ - // input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - // [], - // file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - // [],[],[],[] - // ] - // // fasta - // input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // // fai - // input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // // snp_position - // input[3] = [] - // // known_snps - // input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // // known_snps_tbi - // input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // // chr_directory - // input[6] = UNTAR.out.untar.map{ it[1] } - // // mappability - // input[7] = [] - // // target_bed - // input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // // gccontent_profile - // input[9] = [] - // """ - // } - // } - - // then { - // assertAll( - // { assert process.success }, - // { assert snapshot(process.out).match() } - // ) - // } - - // } - - test("human - mpileup - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test.mpileup.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - [],[],[],[] - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // snp_position - input[3] = [] - // known_snps - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // known_snps_tbi - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // chr_directory - input[6] = UNTAR.out.untar.map{ it[1] } - // mappability - input[7] = [] - // target_bed - input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // gccontent_profile - input[9] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/controlfreec/freec/tests/main.nf.test.snap b/modules/nf-core/controlfreec/freec/tests/main.nf.test.snap deleted file mode 100644 index eb0c468ae6..0000000000 --- a/modules/nf-core/controlfreec/freec/tests/main.nf.test.snap +++ /dev/null @@ -1,203 +0,0 @@ -{ - "human - mpileup - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_ratio.BedGraph:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_sample.cpn:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "GC_profile.test.cpn:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_BAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_CNVs:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_info.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_ratio.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "8": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "config.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "9": [ - "versions.yml:md5,e704fc0e6d1ac333dc419498fa128769" - ], - "BAF": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_BAF.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "CNV": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_CNVs:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "bedgraph": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_ratio.BedGraph:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "config": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "config.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "control_cpn": [ - - ], - "gcprofile_cpn": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "GC_profile.test.cpn:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "info": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_info.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "ratio": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_ratio.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "sample_cpn": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test_sample.cpn:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e704fc0e6d1ac333dc419498fa128769" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-09T10:41:07.003311" - }, - "human - mpileup": { - "content": [ - "test2.mpileup.gz_sample.cpn", - "test2.mpileup.gz_CNVs", - "Chromosome\tPosition\tBAF\tFittedA\tFittedB\tA\tB\tuncertainty", - "Chromosome\tStart\tRatio\tMedianRatio\tCopyNumber\tBAF\testimatedBAF\tGenotype\tUncertaintyOfGT", - "[general]", - "Program_Version\tv11.6", - [ - "versions.yml:md5,e704fc0e6d1ac333dc419498fa128769" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-09T10:40:42.538035" - } -} \ No newline at end of file diff --git a/modules/nf-core/controlfreec/freec/tests/nextflow.config b/modules/nf-core/controlfreec/freec/tests/nextflow.config deleted file mode 100644 index ca9c22369c..0000000000 --- a/modules/nf-core/controlfreec/freec/tests/nextflow.config +++ /dev/null @@ -1,23 +0,0 @@ -process { - withName:CONTROLFREEC_FREEC{ - ext.args = { [ - "sample":[ - inputformat: 'pileup', - mateorientation: 'FR' - ], - "general" :[ - bedgraphoutput: "TRUE", - noisydata: "TRUE", - minexpectedgc: "0", - readcountthreshold: "1", - sex: meta.sex, - window: "10", - ], - "control":[ - inputformat: "pileup", - mateorientation: "FR" - ] - ] - } - } -} diff --git a/modules/nf-core/controlfreec/freec2bed/tests/main.nf.test b/modules/nf-core/controlfreec/freec2bed/tests/main.nf.test deleted file mode 100644 index a2ad4b2f95..0000000000 --- a/modules/nf-core/controlfreec/freec2bed/tests/main.nf.test +++ /dev/null @@ -1,158 +0,0 @@ -nextflow_process { - - name "Test Process CONTROLFREEC_FREEC2BED" - script "../main.nf" - process "CONTROLFREEC_FREEC2BED" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "controlfreec" - tag "controlfreec/freec2bed" - tag "controlfreec/freec" - tag "untar" - - setup { - - run("UNTAR") { - script "../../../../nf-core/untar/main.nf" - process { - """ - input[0] = [ [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz', checkIfExists: true) - ] - """ - } - } - - run("CONTROLFREEC_FREEC") { - script "../../../../nf-core/controlfreec/freec/main.nf" - process { - """ - input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test.mpileup.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - [],[],[],[] - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // snp_position - input[3] = [] - // known_snps - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // known_snps_tbi - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // chr_directory - input[6] = UNTAR.out.untar.map{ it[1] } - // mappability - input[7] = [] - // target_bed - input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // gccontent_profile - input[9] = [] - """ - } - } - - } - - test("human - freec_ratio") { - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.ratio - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(path(process.out.bed.get(0).get(1)).readLines()[0]).match() }, - { assert snapshot(process.out.versions).match("version") } - ) - } - - } -// test("human - freec_ratio - single") { - -// config "./nextflow.config" - -// setup { - -// run("CONTROLFREEC_FREEC") { -// script "../../../../nf-core/controlfreec/freec/main.nf" -// process { -// """ -// input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map -// [], -// file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), -// [],[],[],[] -// ] -// // fasta -// input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) -// // fai -// input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) -// // snp_position -// input[3] = [] -// // known_snps -// input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) -// // known_snps_tbi -// input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) -// // chr_directory -// input[6] = UNTAR.out.untar.map{ it[1] } -// // mappability -// input[7] = [] -// // target_bed -// input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) -// // gccontent_profile -// input[9] = [] -// """ -// } -// } - -// } - -// when { -// process { -// """ -// input[0] = CONTROLFREEC_FREEC.out.ratio -// """ -// } -// } - -// then { -// assertAll( -// { assert process.success }, -// { assert snapshot(process.out).match() } -// ) -// } - -// } - - test("human - freec_ratio - stub") { - - options "-stub" - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.ratio - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} - diff --git a/modules/nf-core/controlfreec/freec2bed/tests/main.nf.test.snap b/modules/nf-core/controlfreec/freec2bed/tests/main.nf.test.snap deleted file mode 100644 index 654221f538..0000000000 --- a/modules/nf-core/controlfreec/freec2bed/tests/main.nf.test.snap +++ /dev/null @@ -1,61 +0,0 @@ -{ - "human - freec_ratio - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,89c8c39d2cb3353505c30c1e0b0cf507" - ], - "bed": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,89c8c39d2cb3353505c30c1e0b0cf507" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-28T13:36:39.937132" - }, - "human - freec_ratio": { - "content": [ - "chr21 5011211 6115911 1.758106" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-28T13:39:44.568689" - }, - "version": { - "content": [ - [ - "versions.yml:md5,89c8c39d2cb3353505c30c1e0b0cf507" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-28T13:35:55.158307" - } -} \ No newline at end of file diff --git a/modules/nf-core/controlfreec/freec2bed/tests/nextflow.config b/modules/nf-core/controlfreec/freec2bed/tests/nextflow.config deleted file mode 100644 index ca9c22369c..0000000000 --- a/modules/nf-core/controlfreec/freec2bed/tests/nextflow.config +++ /dev/null @@ -1,23 +0,0 @@ -process { - withName:CONTROLFREEC_FREEC{ - ext.args = { [ - "sample":[ - inputformat: 'pileup', - mateorientation: 'FR' - ], - "general" :[ - bedgraphoutput: "TRUE", - noisydata: "TRUE", - minexpectedgc: "0", - readcountthreshold: "1", - sex: meta.sex, - window: "10", - ], - "control":[ - inputformat: "pileup", - mateorientation: "FR" - ] - ] - } - } -} diff --git a/modules/nf-core/controlfreec/freec2circos/tests/main.nf.test b/modules/nf-core/controlfreec/freec2circos/tests/main.nf.test deleted file mode 100644 index 2eb5936ad9..0000000000 --- a/modules/nf-core/controlfreec/freec2circos/tests/main.nf.test +++ /dev/null @@ -1,158 +0,0 @@ -nextflow_process { - - name "Test Process CONTROLFREEC_FREEC2CIRCOS" - script "../main.nf" - process "CONTROLFREEC_FREEC2CIRCOS" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "controlfreec" - tag "controlfreec/freec2circos" - tag "controlfreec/freec" - tag "untar" - - setup { - - run("UNTAR") { - script "../../../../nf-core/untar/main.nf" - process { - """ - input[0] = [ [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz', checkIfExists: true) - ] - """ - } - } - - run("CONTROLFREEC_FREEC") { - script "../../../../nf-core/controlfreec/freec/main.nf" - process { - """ - input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test.mpileup.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - [],[],[],[] - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // snp_position - input[3] = [] - // known_snps - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // known_snps_tbi - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // chr_directory - input[6] = UNTAR.out.untar.map{ it[1] } - // mappability - input[7] = [] - // target_bed - input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // gccontent_profile - input[9] = [] - """ - } - } - - } - - test("human - freec_ratio") { - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.ratio - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(path(process.out.circos.get(0).get(1)).readLines()[0]).match() }, - { assert snapshot(process.out.versions).match("version") } - ) - } - - } - - // test("human - freec_ratio - single") { - - // config "./nextflow.config" - - // setup { - - // run("CONTROLFREEC_FREEC") { - // script "../../../../nf-core/controlfreec/freec/main.nf" - // process { - // """ - // input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - // [], - // file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - // [],[],[],[] - // ] - // // fasta - // input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // // fai - // input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // // snp_position - // input[3] = [] - // // known_snps - // input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // // known_snps_tbi - // input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // // chr_directory - // input[6] = UNTAR.out.untar.map{ it[1] } - // // mappability - // input[7] = [] - // // target_bed - // input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // // gccontent_profile - // input[9] = [] - // """ - // } - // } - - // } - - // when { - // process { - // """ - // input[0] = CONTROLFREEC_FREEC.out.ratio - // """ - // } - // } - - // then { - // assertAll( - // { assert process.success }, - // { assert snapshot(process.out).match() } - // ) - // } - - // } - - test("human - freec_ratio - stub") { - - options "-stub" - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.ratio - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/controlfreec/freec2circos/tests/main.nf.test.snap b/modules/nf-core/controlfreec/freec2circos/tests/main.nf.test.snap deleted file mode 100644 index 91357e7a38..0000000000 --- a/modules/nf-core/controlfreec/freec2circos/tests/main.nf.test.snap +++ /dev/null @@ -1,61 +0,0 @@ -{ - "human - freec_ratio - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test.circos.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,4f1feb9a79f9bac014447bdcd6571c30" - ], - "circos": [ - [ - { - "id": "test", - "single_end": false, - "sex": "XX" - }, - "test.circos.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,4f1feb9a79f9bac014447bdcd6571c30" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-28T13:18:29.093673" - }, - "human - freec_ratio": { - "content": [ - "hs21 5011211 5012210 1.758106" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-28T13:18:10.147735" - }, - "version": { - "content": [ - [ - "versions.yml:md5,4f1feb9a79f9bac014447bdcd6571c30" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-28T13:18:10.153107" - } -} \ No newline at end of file diff --git a/modules/nf-core/controlfreec/freec2circos/tests/nextflow.config b/modules/nf-core/controlfreec/freec2circos/tests/nextflow.config deleted file mode 100644 index ca9c22369c..0000000000 --- a/modules/nf-core/controlfreec/freec2circos/tests/nextflow.config +++ /dev/null @@ -1,23 +0,0 @@ -process { - withName:CONTROLFREEC_FREEC{ - ext.args = { [ - "sample":[ - inputformat: 'pileup', - mateorientation: 'FR' - ], - "general" :[ - bedgraphoutput: "TRUE", - noisydata: "TRUE", - minexpectedgc: "0", - readcountthreshold: "1", - sex: meta.sex, - window: "10", - ], - "control":[ - inputformat: "pileup", - mateorientation: "FR" - ] - ] - } - } -} diff --git a/modules/nf-core/controlfreec/makegraph2/tests/main.nf.test b/modules/nf-core/controlfreec/makegraph2/tests/main.nf.test deleted file mode 100644 index aed63f02aa..0000000000 --- a/modules/nf-core/controlfreec/makegraph2/tests/main.nf.test +++ /dev/null @@ -1,161 +0,0 @@ -nextflow_process { - - name "Test Process CONTROLFREEC_MAKEGRAPH2" - script "../main.nf" - process "CONTROLFREEC_MAKEGRAPH2" - - tag "modules" - tag "modules_nfcore" - tag "controlfreec" - tag "controlfreec/makegraph2" - tag "controlfreec/freec" - tag "untar" - - setup { - - run("UNTAR") { - script "../../../../nf-core/untar/main.nf" - process { - """ - input[0] = [ [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz', checkIfExists: true) - ] - """ - } - } - - run("CONTROLFREEC_FREEC") { - script "../../../../nf-core/controlfreec/freec/main.nf" - process { - """ - input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test.mpileup.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - [],[],[],[] - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // snp_position - input[3] = [] - // known_snps - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // known_snps_tbi - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // chr_directory - input[6] = UNTAR.out.untar.map{ it[1] } - // mappability - input[7] = [] - // target_bed - input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // gccontent_profile - input[9] = [] - """ - } - } - - } - - test("human - freec_ratio") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = CONTROLFREEC_FREEC.out.ratio.join(CONTROLFREEC_FREEC.out.BAF) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("version") } - ) - } - - } - - // test("human - freec_ratio - single") { - - // config "./nextflow.config" - - // setup { - - // run("CONTROLFREEC_FREEC") { - // script "../../../../nf-core/controlfreec/freec/main.nf" - // process { - // """ - // input[0] = [ [ id:'test', single_end:false, sex:'XX' ], // meta map - // [], - // file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/mpileup/test2.mpileup.gz', checkIfExists: true), - // [],[],[],[] - // ] - // // fasta - // input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - // // fai - // input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - // // snp_position - // input[3] = [] - // // known_snps - // input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true) - // // known_snps_tbi - // input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - // // chr_directory - // input[6] = UNTAR.out.untar.map{ it[1] } - // // mappability - // input[7] = [] - // // target_bed - // input[8] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed', checkIfExists: true) - // // gccontent_profile - // input[9] = [] - // """ - // } - // } - - // } - - // when { - // process { - // """ - // input[0] = CONTROLFREEC_FREEC.out.ratio.join(CONTROLFREEC_FREEC.out.BAF) - // """ - // } - // } - - // then { - // assertAll( - // { assert process.success }, - // { assert snapshot(process.out).match() } - // ) - // } - - // } - - test("human - freec_ratio - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], - [], [] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/controlfreec/makegraph2/tests/main.nf.test.snap b/modules/nf-core/controlfreec/makegraph2/tests/main.nf.test.snap deleted file mode 100644 index 81d67b93bb..0000000000 --- a/modules/nf-core/controlfreec/makegraph2/tests/main.nf.test.snap +++ /dev/null @@ -1,79 +0,0 @@ -{ - "human - freec_ratio - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test_BAF.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test_ratio.log2.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test_ratio.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,2d7885bddfa4a981cd1ed78963d5f514" - ], - "png_baf": [ - [ - { - "id": "test" - }, - "test_BAF.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "png_ratio": [ - [ - { - "id": "test" - }, - "test_ratio.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "png_ratio_log2": [ - [ - { - "id": "test" - }, - "test_ratio.log2.png:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,2d7885bddfa4a981cd1ed78963d5f514" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-26T16:36:29.963449" - }, - "version": { - "content": [ - [ - "versions.yml:md5,2d7885bddfa4a981cd1ed78963d5f514" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-26T17:14:23.354467" - } -} \ No newline at end of file diff --git a/modules/nf-core/controlfreec/makegraph2/tests/nextflow.config b/modules/nf-core/controlfreec/makegraph2/tests/nextflow.config deleted file mode 100644 index ca9c22369c..0000000000 --- a/modules/nf-core/controlfreec/makegraph2/tests/nextflow.config +++ /dev/null @@ -1,23 +0,0 @@ -process { - withName:CONTROLFREEC_FREEC{ - ext.args = { [ - "sample":[ - inputformat: 'pileup', - mateorientation: 'FR' - ], - "general" :[ - bedgraphoutput: "TRUE", - noisydata: "TRUE", - minexpectedgc: "0", - readcountthreshold: "1", - sex: meta.sex, - window: "10", - ], - "control":[ - inputformat: "pileup", - mateorientation: "FR" - ] - ] - } - } -} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test deleted file mode 100644 index 0790fb8136..0000000000 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test +++ /dev/null @@ -1,166 +0,0 @@ -nextflow_process { - - name "Test Process DEEPVARIANT_RUNDEEPVARIANT" - script "../main.nf" - process "DEEPVARIANT_RUNDEEPVARIANT" - - tag "deepvariant/rundeepvariant" - tag "deepvariant" - tag "modules" - tag "modules_nfcore" - - test("homo_sapiens - [bam, bai] - fasta - fai") { - when { - config "./nextflow.config" - - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [],[] - ] - input[4] = [ - [],[] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("homo_sapiens - [cram, crai, genome_bed] - fasta - fai") { - config "./nextflow-intervals.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [],[] - ] - input[4] = [ - [],[] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("homo_sapiens - [cram, crai, genome_bed] - fasta - fai - par_bed") { - config "./nextflow-non-autosomal-calling.config" - tag "test" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [],[] - ] - input[4] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.blacklist_intervals.bed', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("homo_sapiens - [bam, bai] - fasta_gz - fasta_gz_fai") { - when { - config "./nextflow.config" - - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.gz', checkIfExists: true) - ] - input[2] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.gz.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome'], - file(params.modules_testdata_base_path + '/genomics/homo_sapiens/genome/genome.fasta.gz.gzi', checkIfExists: true) - ] - input[4] = [ - [],[] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap b/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap deleted file mode 100644 index 8e836336da..0000000000 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/main.nf.test.snap +++ /dev/null @@ -1,358 +0,0 @@ -{ - "homo_sapiens - [bam, bai] - fasta_gz - fasta_gz_fai": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" - ] - ], - "4": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ], - "gvcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" - ] - ], - "gvcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" - ] - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" - ] - ], - "vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" - ] - ], - "versions": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-14T08:16:22.036932742" - }, - "homo_sapiens - [bam, bai] - fasta - fai": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" - ] - ], - "4": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ], - "gvcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" - ] - ], - "gvcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" - ] - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" - ] - ], - "vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" - ] - ], - "versions": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-14T08:13:35.621497498" - }, - "homo_sapiens - [cram, crai, genome_bed] - fasta - fai": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" - ] - ], - "4": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ], - "gvcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,6251a87945e530ca61a989d7187d89dc" - ] - ], - "gvcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,32ca0d6713b96ed4ce07c79421bb04a9" - ] - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,cf14200d683c17a6e433bb076d487fee" - ] - ], - "vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,e9bcd1d1f5280e0d76ed8fd31f27bd59" - ] - ], - "versions": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-14T08:14:32.23781232" - }, - "homo_sapiens - [cram, crai, genome_bed] - fasta - fai - par_bed": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,b79936a7bf53fa4ee7e5866664e37d56" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,22f9f4c6c8c1faa8b129eddf32b445b8" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,c82ce85ed16dcabe411995c52aaffd85" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,6420a456b0507c70c8423293395c29bc" - ] - ], - "4": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ], - "gvcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz:md5,c82ce85ed16dcabe411995c52aaffd85" - ] - ], - "gvcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.g.vcf.gz.tbi:md5,6420a456b0507c70c8423293395c29bc" - ] - ], - "vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz:md5,b79936a7bf53fa4ee7e5866664e37d56" - ] - ], - "vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test_out.vcf.gz.tbi:md5,22f9f4c6c8c1faa8b129eddf32b445b8" - ] - ], - "versions": [ - "versions.yml:md5,cd692ea876a00da762fd4608c9f40f01" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-14T08:15:29.680851997" - } -} \ No newline at end of file diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config deleted file mode 100644 index 78d8d5982a..0000000000 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-intervals.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - withName: DEEPVARIANT_RUNDEEPVARIANT { - ext.args = '--model_type=WGS ' - ext.prefix = { "${meta.id}_out" } - } - -} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config deleted file mode 100644 index 6d265292ab..0000000000 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow-non-autosomal-calling.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - withName: DEEPVARIANT_RUNDEEPVARIANT { - ext.args = '--model_type=WGS --haploid_contigs chr22' - ext.prefix = { "${meta.id}_out" } - } - -} diff --git a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config b/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config deleted file mode 100644 index 77e355cae8..0000000000 --- a/modules/nf-core/deepvariant/rundeepvariant/tests/nextflow.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - withName: DEEPVARIANT_RUNDEEPVARIANT { - ext.args = ' --regions=\"chr22:0-40001\" --model_type=WGS ' - ext.prefix = { "${meta.id}_out" } - } - -} diff --git a/modules/nf-core/dragmap/align/tests/main.nf.test b/modules/nf-core/dragmap/align/tests/main.nf.test deleted file mode 100644 index 5abe76f6a7..0000000000 --- a/modules/nf-core/dragmap/align/tests/main.nf.test +++ /dev/null @@ -1,285 +0,0 @@ -nextflow_process { - - name "Test Process DRAGMAP_ALIGN" - script "../main.nf" - process "DRAGMAP_ALIGN" - tag "modules" - tag "modules_nfcore" - tag "dragmap" - tag "dragmap/align" - tag "dragmap/hashtable" - - test("sarscov2 - fastq, hashtable, fasta, false") { - - setup { - run("DRAGMAP_HASHTABLE") { - script "../../hashtable/main.nf" - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ] - input[1] = DRAGMAP_HASHTABLE.out.hashmap - input[2] = [[id:'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = false //sort - """ - } - } - - then { - assert { process.success } - assertAll ( - { assert snapshot( - file(process.out.bam[0][1]).name, - file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - fastq, hashtable, fasta, true") { - - setup { - run("DRAGMAP_HASHTABLE") { - script "../../hashtable/main.nf" - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ] - input[1] = DRAGMAP_HASHTABLE.out.hashmap - input[2] = [[id:'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = true //sort - """ - } - } - - then { - assert { process.success } - assertAll ( - { assert snapshot( - file(process.out.bam[0][1]).name, - file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - [fastq1, fastq2], hashtable, fasta, false") { - - setup { - run("DRAGMAP_HASHTABLE") { - script "../../hashtable/main.nf" - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = DRAGMAP_HASHTABLE.out.hashmap - input[2] = [[id:'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = false //sort - """ - } - } - - then { - assert { process.success } - assertAll ( - { assert snapshot( - file(process.out.bam[0][1]).name, - file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - [fastq1, fastq2], hashtable, fasta, true") { - - setup { - run("DRAGMAP_HASHTABLE") { - script "../../hashtable/main.nf" - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = DRAGMAP_HASHTABLE.out.hashmap - input[2] = [[id:'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = true //sort - """ - } - } - - then { - assert { process.success } - assertAll ( - { assert snapshot( - file(process.out.bam[0][1]).name, - file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("homo_sapiens - [fastq1, fastq2], hashtable, fasta, true") { - - setup { - run("DRAGMAP_HASHTABLE") { - script "../../hashtable/main.nf" - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = DRAGMAP_HASHTABLE.out.hashmap - input[2] = [[id:'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = true //sort - """ - } - } - - then { - assert { process.success } - assertAll ( - { assert snapshot( - file(process.out.bam[0][1]).name, - file(process.out.log[0][1]).readLines().findAll { it.startsWith("decompHash") }, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - [fastq1, fastq2], hashtable, fasta, true - stub") { - - options "-stub" - setup { - run("DRAGMAP_HASHTABLE") { - script "../../hashtable/main.nf" - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = DRAGMAP_HASHTABLE.out.hashmap - input[2] = [[id:'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[3] = true //sort - """ - } - } - - then { - assert { process.success } - assertAll ( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } -} diff --git a/modules/nf-core/dragmap/align/tests/main.nf.test.snap b/modules/nf-core/dragmap/align/tests/main.nf.test.snap deleted file mode 100644 index 9a63fde007..0000000000 --- a/modules/nf-core/dragmap/align/tests/main.nf.test.snap +++ /dev/null @@ -1,238 +0,0 @@ -{ - "sarscov2 - [fastq1, fastq2], hashtable, fasta, false": { - "content": [ - "test.bam", - [ - "decompHashTableCtxInit...", - "decompHashTableHeader...", - "decompHashTableLiterals...", - "decompHashTableExtIndex...", - "decompHashTableAutoHits...", - "decompHashTableSetFlags..." - ], - [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ], - { - "DRAGMAP_ALIGN": { - "dragmap": "1.2.1", - "samtools": "1.19.2", - "pigz": "2.3.4" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:33:50.428894432" - }, - "homo_sapiens - [fastq1, fastq2], hashtable, fasta, true": { - "content": [ - "test.bam", - [ - "decompHashTableCtxInit...", - "decompHashTableHeader...", - "decompHashTableLiterals...", - "decompHashTableExtIndex...", - "decompHashTableAutoHits...", - "decompHashTableSetFlags..." - ], - [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ], - { - "DRAGMAP_ALIGN": { - "dragmap": "1.2.1", - "samtools": "1.19.2", - "pigz": "2.3.4" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:34:27.492548556" - }, - "sarscov2 - fastq, hashtable, fasta, true": { - "content": [ - "test.bam", - [ - "decompHashTableCtxInit...", - "decompHashTableHeader...", - "decompHashTableLiterals...", - "decompHashTableExtIndex...", - "decompHashTableAutoHits...", - "decompHashTableSetFlags..." - ], - [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ], - { - "DRAGMAP_ALIGN": { - "dragmap": "1.2.1", - "samtools": "1.19.2", - "pigz": "2.3.4" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:33:39.843877739" - }, - "sarscov2 - [fastq1, fastq2], hashtable, fasta, true": { - "content": [ - "test.bam", - [ - "decompHashTableCtxInit...", - "decompHashTableHeader...", - "decompHashTableLiterals...", - "decompHashTableExtIndex...", - "decompHashTableAutoHits...", - "decompHashTableSetFlags..." - ], - [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ], - { - "DRAGMAP_ALIGN": { - "dragmap": "1.2.1", - "samtools": "1.19.2", - "pigz": "2.3.4" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:34:00.702498161" - }, - "sarscov2 - [fastq1, fastq2], hashtable, fasta, true - stub": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": false - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "crai": [ - - ], - "cram": [ - - ], - "csi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "sam": [ - - ], - "versions": [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ] - }, - { - "DRAGMAP_ALIGN": { - "dragmap": "1.2.1", - "samtools": "1.19.2", - "pigz": "2.3.4" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:13:17.187912755" - }, - "sarscov2 - fastq, hashtable, fasta, false": { - "content": [ - "test.bam", - [ - "decompHashTableCtxInit...", - "decompHashTableHeader...", - "decompHashTableLiterals...", - "decompHashTableExtIndex...", - "decompHashTableAutoHits...", - "decompHashTableSetFlags..." - ], - [ - "versions.yml:md5,bec50713b6dac1cc16fe68b731848394" - ], - { - "DRAGMAP_ALIGN": { - "dragmap": "1.2.1", - "samtools": "1.19.2", - "pigz": "2.3.4" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:33:28.056988229" - } -} \ No newline at end of file diff --git a/modules/nf-core/dragmap/hashtable/tests/main.nf.test b/modules/nf-core/dragmap/hashtable/tests/main.nf.test deleted file mode 100644 index f22b453feb..0000000000 --- a/modules/nf-core/dragmap/hashtable/tests/main.nf.test +++ /dev/null @@ -1,66 +0,0 @@ -nextflow_process { - - name "Test Process DRAGMAP_HASHTABLE" - script "../main.nf" - process "DRAGMAP_HASHTABLE" - tag "modules" - tag "modules_nfcore" - tag "dragmap" - tag "dragmap/hashtable" - - test("sarscov2 - fasta") { - - when { - - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assert { process.success } - assertAll( - { assert snapshot( - file(process.out.hashmap[0][1]).name, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() - } - ) - } - } - - test("sarscov2 - fasta - stub") { - - options "-stub" - when { - - process { - """ - input[0] = [ - [id:'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assert { process.success } - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - // TODO Add test using alt-masked bed file - // https://github.com/Illumina/dragmap#build-hash-table-using-an-alt-masked-bed-file -} diff --git a/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap b/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap deleted file mode 100644 index af7efb419b..0000000000 --- a/modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap +++ /dev/null @@ -1,62 +0,0 @@ -{ - "sarscov2 - fasta - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - [ - - ] - ] - ], - "1": [ - "versions.yml:md5,050c28333b92fac50eec250c28b841d0" - ], - "hashmap": [ - [ - { - "id": "test" - }, - [ - - ] - ] - ], - "versions": [ - "versions.yml:md5,050c28333b92fac50eec250c28b841d0" - ] - }, - { - "DRAGMAP_HASHTABLE": { - "dragmap": "1.2.1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:34:52.49644133" - }, - "sarscov2 - fasta": { - "content": [ - "dragmap", - [ - "versions.yml:md5,050c28333b92fac50eec250c28b841d0" - ], - { - "DRAGMAP_HASHTABLE": { - "dragmap": "1.2.1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-10T11:34:44.786652653" - } -} \ No newline at end of file diff --git a/modules/nf-core/ensemblvep/download/tests/main.nf.test b/modules/nf-core/ensemblvep/download/tests/main.nf.test deleted file mode 100644 index a558599578..0000000000 --- a/modules/nf-core/ensemblvep/download/tests/main.nf.test +++ /dev/null @@ -1,60 +0,0 @@ -nextflow_process { - - name "Test Process ENSEMBLVEP_DOWNLOAD" - script "../main.nf" - process "ENSEMBLVEP_DOWNLOAD" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "ensemblvep" - tag "ensemblvep/download" - - test("celegans - download") { - - when { - process { - """ - input[0] = Channel.of([ - [id:"113_WBcel235"], - params.vep_genome, - params.vep_species, - params.vep_cache_version - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("celegans - download - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [id:"113_WBcel235"], - params.vep_genome, - params.vep_species, - params.vep_cache_version - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/ensemblvep/download/tests/main.nf.test.snap b/modules/nf-core/ensemblvep/download/tests/main.nf.test.snap deleted file mode 100644 index 706bd28f19..0000000000 --- a/modules/nf-core/ensemblvep/download/tests/main.nf.test.snap +++ /dev/null @@ -1,322 +0,0 @@ -{ - "celegans - download": { - "content": [ - { - "0": [ - [ - { - "id": "113_WBcel235" - }, - [ - [ - [ - [ - "1-1000000.gz:md5,cadcba92b0999210dd8d832505d2e4c4", - "10000001-11000000.gz:md5,998a75dd927d10d45f8eebeef5fc7a75", - "1000001-2000000.gz:md5,a5cb3adb1ec9f40eed6a355d1492ba9b", - "11000001-12000000.gz:md5,46e6917f51093e28cce061774b9ed158", - "12000001-13000000.gz:md5,0adffacf8482d6c224df27104f65c9d6", - "13000001-14000000.gz:md5,aee759d812fc900a980ab0c4c5bd0273", - "14000001-15000000.gz:md5,f65537a3f76c40e63b6deb0b6cdb09dc", - "15000001-16000000.gz:md5,379f092ad1afa888da1fc13e80535def", - "2000001-3000000.gz:md5,86839741524579fd089498d6bee44dff", - "3000001-4000000.gz:md5,509b28af3920427e951f00b6973b5df4", - "4000001-5000000.gz:md5,f606e69cf59b0bdf2b61653608d955a6", - "5000001-6000000.gz:md5,a14ce1e21856e4a77ed63c67cbdfb26a", - "6000001-7000000.gz:md5,e1a895d6e8b352182b53ed1d0ce6e24e", - "7000001-8000000.gz:md5,ddf91b60f636d26b68b6bab3520b6b32", - "8000001-9000000.gz:md5,57482b996f89e92bbd0196efa4915cd3", - "9000001-10000000.gz:md5,43b5d89f84236b49b384d7f37f928129" - ], - [ - "1-1000000.gz:md5,d18811781848f70baef0b0348190d7ce", - "10000001-11000000.gz:md5,19011165abc56233ea0c5b0e6938d9c9", - "1000001-2000000.gz:md5,5e720fa191f3c9ac799b6a071bcc4332", - "11000001-12000000.gz:md5,b19c46fb00ca13a2a31128bd1829ddf5", - "12000001-13000000.gz:md5,54354b0870ca96641c51ed63382da007", - "13000001-14000000.gz:md5,6954fdc223f58eb406e602752ab7d139", - "14000001-15000000.gz:md5,929275a1cfea883999dddc20931a2e72", - "15000001-16000000.gz:md5,5f5b783a589a1fd80cc565e6f339c540", - "2000001-3000000.gz:md5,54e476e0e9f4a5d973ee710fd824abc7", - "3000001-4000000.gz:md5,d78d4a63165429fdb3a61b7cdbd3c43a", - "4000001-5000000.gz:md5,983f8efcebb7f62d7e7b1b3c0573d43e", - "5000001-6000000.gz:md5,e2cd03ed5b67b8ee123e4c4958508fe4", - "6000001-7000000.gz:md5,d04bc9335ba39ace20bce936e3a5cdeb", - "7000001-8000000.gz:md5,9354b26a9ba94aa5bc30f537c22382fb", - "8000001-9000000.gz:md5,b227c6ef81ab72d211d25dc4f44813b9", - "9000001-10000000.gz:md5,a6d7f29edd7c22139403a11cac989b7a" - ], - [ - "1-1000000.gz:md5,2117acb322a117a9c5db85c072575331", - "10000001-11000000.gz:md5,646c9582b56eb12ddbb1dd35b25c3670", - "1000001-2000000.gz:md5,ee433e4e5e37b2d008c43e1af4be0f8d", - "11000001-12000000.gz:md5,962fd6e52046484b3b123f9380ed64e9", - "12000001-13000000.gz:md5,1abf2d695c829eb2c88e0d3dbc739a1c", - "13000001-14000000.gz:md5,a6e03bf867f5cc694174a230f1b13a6b", - "2000001-3000000.gz:md5,a5b250aa9e3ee8cecc23bea0e2fa19a1", - "3000001-4000000.gz:md5,1390a6d2a28a4861b282d36d0fb85660", - "4000001-5000000.gz:md5,4bc7106bb2661aea28613c31935a5c8f", - "5000001-6000000.gz:md5,7317d6fbb3c77d7cdd31e781afab8f7d", - "6000001-7000000.gz:md5,1a3b6fa586e570c16b4833e34b28751e", - "7000001-8000000.gz:md5,b7bcb06393682f621403afdf19bf87b4", - "8000001-9000000.gz:md5,0011675a8567d394da54a52480b35786", - "9000001-10000000.gz:md5,e4fa88e4ec57ed0c71fd21090d8aa17a" - ], - [ - "1-1000000.gz:md5,a47af22d33275652036ddf7161699c7c", - "10000001-11000000.gz:md5,7fc129e7edbaa5be87306de417c2ef28", - "1000001-2000000.gz:md5,cbc12c339741df5ad06bf9a946be6c93", - "11000001-12000000.gz:md5,d1cc5e20e3d3402debdc102087a5407f", - "12000001-13000000.gz:md5,42c69c8e86d28151e9a8b1787dbee125", - "13000001-14000000.gz:md5,c7459d1789a833e8a898ebdbc607e7d8", - "14000001-15000000.gz:md5,5806b20108f56d9eeabcdd4f8450dca3", - "15000001-16000000.gz:md5,78e859f70026a05be43d48b9b272f287", - "16000001-17000000.gz:md5,539db7fc976bee4b6031f8dcb6a4641d", - "17000001-18000000.gz:md5,f3ea55e7552dc36734d6e8ba67d1e4c2", - "2000001-3000000.gz:md5,539013ecfdcd06eb653445f857265322", - "3000001-4000000.gz:md5,beb9701b402bd5ddc46a4da6e531f783", - "4000001-5000000.gz:md5,3f46efb2635850cc6c3d8ae51727a400", - "5000001-6000000.gz:md5,e11549bca12c5e2a7a208a997fda1c68", - "6000001-7000000.gz:md5,c0f3546c6859dc1a5fe9ff7f015ecd7e", - "7000001-8000000.gz:md5,344b72822f647819f4ee6b5afa9d7701", - "8000001-9000000.gz:md5,1c06d285ff5c53f89f073212343902b7", - "9000001-10000000.gz:md5,79140e754039c6d6fc6eeecddcf2aa8e" - ], - [ - "1-1000000.gz:md5,40ef48190d3269cd4112450bc717b1ef" - ], - [ - "1-1000000.gz:md5,1a8739457c429931923ed77596a9ee54", - "10000001-11000000.gz:md5,316fa1d06fc1878b6a5995f4aee3e49d", - "1000001-2000000.gz:md5,3926c03a091850c909bd0ccfc7133c0b", - "11000001-12000000.gz:md5,29ca11d2f05051cc439a0d24a9db134c", - "12000001-13000000.gz:md5,a46f648554e91999652019516c933754", - "13000001-14000000.gz:md5,167b126d1c690a0e7e25fc5ccd09fb7c", - "14000001-15000000.gz:md5,645554c896133c476c3083302371bcf8", - "15000001-16000000.gz:md5,60fc48d9a7aff6286fc6630c46bcfebc", - "16000001-17000000.gz:md5,07e1750d1c95a61e96774d2cf3da4d89", - "17000001-18000000.gz:md5,59d084309f6a975ec1066a828b5845ba", - "18000001-19000000.gz:md5,868c12d305dbd4d04399ec7848804328", - "19000001-20000000.gz:md5,6de03a00061f6a88dcbbb8ed5fc0b8dc", - "20000001-21000000.gz:md5,732b956f13da9ef01f9de3355d12e28b", - "2000001-3000000.gz:md5,7c7528266c523cad419ea25e75d9566e", - "3000001-4000000.gz:md5,bb2283c0cfb0e4601fc535a4d51e6f2d", - "4000001-5000000.gz:md5,64c7f28f554414a88c886b0bcadb3c39", - "5000001-6000000.gz:md5,58e7106fe577a8b5e5c698445b4f0c33", - "6000001-7000000.gz:md5,2e309d12cf1c1c6276585f457ceeacc2", - "7000001-8000000.gz:md5,08cb0600f7806608f0103187a6c9c64e", - "8000001-9000000.gz:md5,869333c2615f714860d17d794640d4ad", - "9000001-10000000.gz:md5,b85cc861c6a3b30cf6f06c8af136b383" - ], - [ - "1-1000000.gz:md5,c8d97b084c159c3cb5be1fff4637dfce", - "10000001-11000000.gz:md5,f441f2af06fd4973749dfbfbef40fe1b", - "1000001-2000000.gz:md5,c42a1526a836cfacefb67e9217f648aa", - "11000001-12000000.gz:md5,264421c249c696b45c92e2611285fee7", - "12000001-13000000.gz:md5,e673d1fdbe7dc0d09bea3d11a5797d6a", - "13000001-14000000.gz:md5,88f4f84e63b362f1b4f800c48b37e82c", - "14000001-15000000.gz:md5,26282f2b305ed82fb9f8875e97361105", - "15000001-16000000.gz:md5,30b9132c2610d42919ba231d1adbef2a", - "16000001-17000000.gz:md5,3d0e975ccd1ae4e92bf1d9d915ed293f", - "17000001-18000000.gz:md5,7db5b3819da3df1e47fe757dc9c6f2ba", - "2000001-3000000.gz:md5,55f6130a8d5872bdc9f8eed231ad0f65", - "3000001-4000000.gz:md5,402b826dbf6993c207ad15483a44182b", - "4000001-5000000.gz:md5,43cf926d43db25af5724fb5077edfee1", - "5000001-6000000.gz:md5,f40276dbea3f6f9a75f9301d1253eb09", - "6000001-7000000.gz:md5,df0d2d38060d4e7c606072ae814b1f38", - "7000001-8000000.gz:md5,c4117cc51255c0a91c51ff43403f00f7", - "8000001-9000000.gz:md5,59a4ebadca27041634c58652c544c8dd", - "9000001-10000000.gz:md5,c54510616273a4d1bfa9d525dbbbca40" - ], - "chr_synonyms.txt:md5,d390f0bcc6fec9786bc66b75f2d4390b", - "info.txt:md5,249c88c7a71464e048cca0c4b2a21198" - ] - ] - ] - ] - ], - "1": [ - "versions.yml:md5,25f0fd61e1a90ecec5427a9400ad6bc9" - ], - "cache": [ - [ - { - "id": "113_WBcel235" - }, - [ - [ - [ - [ - "1-1000000.gz:md5,cadcba92b0999210dd8d832505d2e4c4", - "10000001-11000000.gz:md5,998a75dd927d10d45f8eebeef5fc7a75", - "1000001-2000000.gz:md5,a5cb3adb1ec9f40eed6a355d1492ba9b", - "11000001-12000000.gz:md5,46e6917f51093e28cce061774b9ed158", - "12000001-13000000.gz:md5,0adffacf8482d6c224df27104f65c9d6", - "13000001-14000000.gz:md5,aee759d812fc900a980ab0c4c5bd0273", - "14000001-15000000.gz:md5,f65537a3f76c40e63b6deb0b6cdb09dc", - "15000001-16000000.gz:md5,379f092ad1afa888da1fc13e80535def", - "2000001-3000000.gz:md5,86839741524579fd089498d6bee44dff", - "3000001-4000000.gz:md5,509b28af3920427e951f00b6973b5df4", - "4000001-5000000.gz:md5,f606e69cf59b0bdf2b61653608d955a6", - "5000001-6000000.gz:md5,a14ce1e21856e4a77ed63c67cbdfb26a", - "6000001-7000000.gz:md5,e1a895d6e8b352182b53ed1d0ce6e24e", - "7000001-8000000.gz:md5,ddf91b60f636d26b68b6bab3520b6b32", - "8000001-9000000.gz:md5,57482b996f89e92bbd0196efa4915cd3", - "9000001-10000000.gz:md5,43b5d89f84236b49b384d7f37f928129" - ], - [ - "1-1000000.gz:md5,d18811781848f70baef0b0348190d7ce", - "10000001-11000000.gz:md5,19011165abc56233ea0c5b0e6938d9c9", - "1000001-2000000.gz:md5,5e720fa191f3c9ac799b6a071bcc4332", - "11000001-12000000.gz:md5,b19c46fb00ca13a2a31128bd1829ddf5", - "12000001-13000000.gz:md5,54354b0870ca96641c51ed63382da007", - "13000001-14000000.gz:md5,6954fdc223f58eb406e602752ab7d139", - "14000001-15000000.gz:md5,929275a1cfea883999dddc20931a2e72", - "15000001-16000000.gz:md5,5f5b783a589a1fd80cc565e6f339c540", - "2000001-3000000.gz:md5,54e476e0e9f4a5d973ee710fd824abc7", - "3000001-4000000.gz:md5,d78d4a63165429fdb3a61b7cdbd3c43a", - "4000001-5000000.gz:md5,983f8efcebb7f62d7e7b1b3c0573d43e", - "5000001-6000000.gz:md5,e2cd03ed5b67b8ee123e4c4958508fe4", - "6000001-7000000.gz:md5,d04bc9335ba39ace20bce936e3a5cdeb", - "7000001-8000000.gz:md5,9354b26a9ba94aa5bc30f537c22382fb", - "8000001-9000000.gz:md5,b227c6ef81ab72d211d25dc4f44813b9", - "9000001-10000000.gz:md5,a6d7f29edd7c22139403a11cac989b7a" - ], - [ - "1-1000000.gz:md5,2117acb322a117a9c5db85c072575331", - "10000001-11000000.gz:md5,646c9582b56eb12ddbb1dd35b25c3670", - "1000001-2000000.gz:md5,ee433e4e5e37b2d008c43e1af4be0f8d", - "11000001-12000000.gz:md5,962fd6e52046484b3b123f9380ed64e9", - "12000001-13000000.gz:md5,1abf2d695c829eb2c88e0d3dbc739a1c", - "13000001-14000000.gz:md5,a6e03bf867f5cc694174a230f1b13a6b", - "2000001-3000000.gz:md5,a5b250aa9e3ee8cecc23bea0e2fa19a1", - "3000001-4000000.gz:md5,1390a6d2a28a4861b282d36d0fb85660", - "4000001-5000000.gz:md5,4bc7106bb2661aea28613c31935a5c8f", - "5000001-6000000.gz:md5,7317d6fbb3c77d7cdd31e781afab8f7d", - "6000001-7000000.gz:md5,1a3b6fa586e570c16b4833e34b28751e", - "7000001-8000000.gz:md5,b7bcb06393682f621403afdf19bf87b4", - "8000001-9000000.gz:md5,0011675a8567d394da54a52480b35786", - "9000001-10000000.gz:md5,e4fa88e4ec57ed0c71fd21090d8aa17a" - ], - [ - "1-1000000.gz:md5,a47af22d33275652036ddf7161699c7c", - "10000001-11000000.gz:md5,7fc129e7edbaa5be87306de417c2ef28", - "1000001-2000000.gz:md5,cbc12c339741df5ad06bf9a946be6c93", - "11000001-12000000.gz:md5,d1cc5e20e3d3402debdc102087a5407f", - "12000001-13000000.gz:md5,42c69c8e86d28151e9a8b1787dbee125", - "13000001-14000000.gz:md5,c7459d1789a833e8a898ebdbc607e7d8", - "14000001-15000000.gz:md5,5806b20108f56d9eeabcdd4f8450dca3", - "15000001-16000000.gz:md5,78e859f70026a05be43d48b9b272f287", - "16000001-17000000.gz:md5,539db7fc976bee4b6031f8dcb6a4641d", - "17000001-18000000.gz:md5,f3ea55e7552dc36734d6e8ba67d1e4c2", - "2000001-3000000.gz:md5,539013ecfdcd06eb653445f857265322", - "3000001-4000000.gz:md5,beb9701b402bd5ddc46a4da6e531f783", - "4000001-5000000.gz:md5,3f46efb2635850cc6c3d8ae51727a400", - "5000001-6000000.gz:md5,e11549bca12c5e2a7a208a997fda1c68", - "6000001-7000000.gz:md5,c0f3546c6859dc1a5fe9ff7f015ecd7e", - "7000001-8000000.gz:md5,344b72822f647819f4ee6b5afa9d7701", - "8000001-9000000.gz:md5,1c06d285ff5c53f89f073212343902b7", - "9000001-10000000.gz:md5,79140e754039c6d6fc6eeecddcf2aa8e" - ], - [ - "1-1000000.gz:md5,40ef48190d3269cd4112450bc717b1ef" - ], - [ - "1-1000000.gz:md5,1a8739457c429931923ed77596a9ee54", - "10000001-11000000.gz:md5,316fa1d06fc1878b6a5995f4aee3e49d", - "1000001-2000000.gz:md5,3926c03a091850c909bd0ccfc7133c0b", - "11000001-12000000.gz:md5,29ca11d2f05051cc439a0d24a9db134c", - "12000001-13000000.gz:md5,a46f648554e91999652019516c933754", - "13000001-14000000.gz:md5,167b126d1c690a0e7e25fc5ccd09fb7c", - "14000001-15000000.gz:md5,645554c896133c476c3083302371bcf8", - "15000001-16000000.gz:md5,60fc48d9a7aff6286fc6630c46bcfebc", - "16000001-17000000.gz:md5,07e1750d1c95a61e96774d2cf3da4d89", - "17000001-18000000.gz:md5,59d084309f6a975ec1066a828b5845ba", - "18000001-19000000.gz:md5,868c12d305dbd4d04399ec7848804328", - "19000001-20000000.gz:md5,6de03a00061f6a88dcbbb8ed5fc0b8dc", - "20000001-21000000.gz:md5,732b956f13da9ef01f9de3355d12e28b", - "2000001-3000000.gz:md5,7c7528266c523cad419ea25e75d9566e", - "3000001-4000000.gz:md5,bb2283c0cfb0e4601fc535a4d51e6f2d", - "4000001-5000000.gz:md5,64c7f28f554414a88c886b0bcadb3c39", - "5000001-6000000.gz:md5,58e7106fe577a8b5e5c698445b4f0c33", - "6000001-7000000.gz:md5,2e309d12cf1c1c6276585f457ceeacc2", - "7000001-8000000.gz:md5,08cb0600f7806608f0103187a6c9c64e", - "8000001-9000000.gz:md5,869333c2615f714860d17d794640d4ad", - "9000001-10000000.gz:md5,b85cc861c6a3b30cf6f06c8af136b383" - ], - [ - "1-1000000.gz:md5,c8d97b084c159c3cb5be1fff4637dfce", - "10000001-11000000.gz:md5,f441f2af06fd4973749dfbfbef40fe1b", - "1000001-2000000.gz:md5,c42a1526a836cfacefb67e9217f648aa", - "11000001-12000000.gz:md5,264421c249c696b45c92e2611285fee7", - "12000001-13000000.gz:md5,e673d1fdbe7dc0d09bea3d11a5797d6a", - "13000001-14000000.gz:md5,88f4f84e63b362f1b4f800c48b37e82c", - "14000001-15000000.gz:md5,26282f2b305ed82fb9f8875e97361105", - "15000001-16000000.gz:md5,30b9132c2610d42919ba231d1adbef2a", - "16000001-17000000.gz:md5,3d0e975ccd1ae4e92bf1d9d915ed293f", - "17000001-18000000.gz:md5,7db5b3819da3df1e47fe757dc9c6f2ba", - "2000001-3000000.gz:md5,55f6130a8d5872bdc9f8eed231ad0f65", - "3000001-4000000.gz:md5,402b826dbf6993c207ad15483a44182b", - "4000001-5000000.gz:md5,43cf926d43db25af5724fb5077edfee1", - "5000001-6000000.gz:md5,f40276dbea3f6f9a75f9301d1253eb09", - "6000001-7000000.gz:md5,df0d2d38060d4e7c606072ae814b1f38", - "7000001-8000000.gz:md5,c4117cc51255c0a91c51ff43403f00f7", - "8000001-9000000.gz:md5,59a4ebadca27041634c58652c544c8dd", - "9000001-10000000.gz:md5,c54510616273a4d1bfa9d525dbbbca40" - ], - "chr_synonyms.txt:md5,d390f0bcc6fec9786bc66b75f2d4390b", - "info.txt:md5,249c88c7a71464e048cca0c4b2a21198" - ] - ] - ] - ] - ], - "versions": [ - "versions.yml:md5,25f0fd61e1a90ecec5427a9400ad6bc9" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-21T09:09:48.574969389" - }, - "celegans - download - stub": { - "content": [ - { - "0": [ - [ - { - "id": "113_WBcel235" - }, - [ - - ] - ] - ], - "1": [ - "versions.yml:md5,25f0fd61e1a90ecec5427a9400ad6bc9" - ], - "cache": [ - [ - { - "id": "113_WBcel235" - }, - [ - - ] - ] - ], - "versions": [ - "versions.yml:md5,25f0fd61e1a90ecec5427a9400ad6bc9" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-21T09:10:03.728940123" - } -} \ No newline at end of file diff --git a/modules/nf-core/ensemblvep/download/tests/nextflow.config b/modules/nf-core/ensemblvep/download/tests/nextflow.config deleted file mode 100644 index 0a4ae1a6a8..0000000000 --- a/modules/nf-core/ensemblvep/download/tests/nextflow.config +++ /dev/null @@ -1,12 +0,0 @@ -params { - vep_cache_version = "113" - vep_genome = "WBcel235" - vep_species = "caenorhabditis_elegans" -} - -process { - withName: ENSEMBLVEP_DOWNLOAD { - ext.args = '--AUTO c --CONVERT --NO_BIOPERL --NO_HTSLIB --NO_TEST --NO_UPDATE' - ext.prefix = { "${params.vep_cache_version}_${params.vep_genome}" } - } -} diff --git a/modules/nf-core/ensemblvep/vep/tests/main.nf.test b/modules/nf-core/ensemblvep/vep/tests/main.nf.test deleted file mode 100644 index e5b20af715..0000000000 --- a/modules/nf-core/ensemblvep/vep/tests/main.nf.test +++ /dev/null @@ -1,117 +0,0 @@ -nextflow_process { - - name "Test Process ENSEMBLVEP_VEP" - script "../main.nf" - process "ENSEMBLVEP_VEP" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "ensemblvep" - tag "ensemblvep/vep" - tag "ensemblvep/download" - - test("test_ensemblvep_vep_fasta_vcf - stub (not really but linting complains otherwise)") { - config "./vcf.config" - - setup { - run("ENSEMBLVEP_DOWNLOAD") { - script "../../download/main.nf" - - process { - """ - input[0] = Channel.of([ - [id:"113_WBcel235"], - params.vep_genome, - params.vep_species, - params.vep_cache_version - ]) - """ - } - } - } - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true), - [] - ]) - input[1] = params.vep_genome - input[2] = params.vep_species - input[3] = params.vep_cache_version - input[4] = ENSEMBLVEP_DOWNLOAD.out.cache.map{ meta, cache -> [cache] } - input[5] = Channel.value([ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - input[6] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - file(process.out.tbi.get(0).get(1)).name - ).match() } - ) - } - - } - - test("test_ensemblvep_vep_fasta_tab_gz") { - config "./tab.gz.config" - - setup { - run("ENSEMBLVEP_DOWNLOAD") { - script "../../download/main.nf" - - process { - """ - input[0] = Channel.of([ - [id:"113_WBcel235"], - params.vep_genome, - params.vep_species, - params.vep_cache_version - ]) - """ - } - } - } - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true), - [] - ]) - input[1] = params.vep_genome - input[2] = params.vep_species - input[3] = params.vep_cache_version - input[4] = ENSEMBLVEP_DOWNLOAD.out.cache.map{ meta, cache -> [cache] } - input[5] = Channel.value([ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - input[6] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() }, - { assert path(process.out.tab.get(0).get(1)).linesGzip.contains("## ENSEMBL VARIANT EFFECT PREDICTOR v113.0") } - ) - } - } -} \ No newline at end of file diff --git a/modules/nf-core/ensemblvep/vep/tests/main.nf.test.snap b/modules/nf-core/ensemblvep/vep/tests/main.nf.test.snap deleted file mode 100644 index 2597a4766d..0000000000 --- a/modules/nf-core/ensemblvep/vep/tests/main.nf.test.snap +++ /dev/null @@ -1,28 +0,0 @@ -{ - "test_ensemblvep_vep_fasta_tab_gz": { - "content": [ - [ - "versions.yml:md5,534306f30b29b830c409da4b0a26bd20" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-24T10:03:33.681292738" - }, - "test_ensemblvep_vep_fasta_vcf - stub (not really but linting complains otherwise)": { - "content": [ - [ - "versions.yml:md5,534306f30b29b830c409da4b0a26bd20" - ], - "d41d8cd98f00b204e9800998ecf8427e", - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-24T10:15:45.231110684" - } -} \ No newline at end of file diff --git a/modules/nf-core/ensemblvep/vep/tests/nextflow.config b/modules/nf-core/ensemblvep/vep/tests/nextflow.config deleted file mode 100644 index 0a4ae1a6a8..0000000000 --- a/modules/nf-core/ensemblvep/vep/tests/nextflow.config +++ /dev/null @@ -1,12 +0,0 @@ -params { - vep_cache_version = "113" - vep_genome = "WBcel235" - vep_species = "caenorhabditis_elegans" -} - -process { - withName: ENSEMBLVEP_DOWNLOAD { - ext.args = '--AUTO c --CONVERT --NO_BIOPERL --NO_HTSLIB --NO_TEST --NO_UPDATE' - ext.prefix = { "${params.vep_cache_version}_${params.vep_genome}" } - } -} diff --git a/modules/nf-core/ensemblvep/vep/tests/tab.gz.config b/modules/nf-core/ensemblvep/vep/tests/tab.gz.config deleted file mode 100644 index 40eb03e594..0000000000 --- a/modules/nf-core/ensemblvep/vep/tests/tab.gz.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: ENSEMBLVEP_VEP { - ext.args = '--tab --compress_output bgzip' - } -} diff --git a/modules/nf-core/ensemblvep/vep/tests/vcf.config b/modules/nf-core/ensemblvep/vep/tests/vcf.config deleted file mode 100644 index ad8955a37e..0000000000 --- a/modules/nf-core/ensemblvep/vep/tests/vcf.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: ENSEMBLVEP_VEP { - ext.args = '--vcf' - } -} diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test deleted file mode 100644 index 30dbb8aabf..0000000000 --- a/modules/nf-core/fastp/tests/main.nf.test +++ /dev/null @@ -1,576 +0,0 @@ -nextflow_process { - - name "Test Process FASTP" - script "../main.nf" - process "FASTP" - tag "modules" - tag "modules_nfcore" - tag "fastp" - - test("test_fastp_single_end") { - - when { - - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end") { - - when { - - process { - """ - adapter_fasta = [] - save_trimmed_pass = true - save_trimmed_fail = false - save_merged = false - - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("fastp test_fastp_interleaved") { - - config './nextflow.interleaved.config' - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert snapshot( - process.out.reads, - process.out.json, - process.out.versions).match() } - ) - } - } - - test("test_fastp_single_end_trim_fail") { - - when { - - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end_trim_fail") { - - config './nextflow.save_failed.config' - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, - { assert snapshot( - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.json, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end_merged") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() }, - ) - } - } - - test("test_fastp_paired_end_merged_adapterlist") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) - input[2] = false - input[3] = false - input[4] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("
") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_single_end_qc_only") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads, - process.out.reads_fail, - process.out.reads_fail, - process.out.reads_merged, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end_qc_only") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads, - process.out.reads_fail, - process.out.reads_fail, - process.out.reads_merged, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_single_end - stub") { - - options "-stub" - - when { - - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end - stub") { - - options "-stub" - - when { - - process { - """ - adapter_fasta = [] - save_trimmed_pass = true - save_trimmed_fail = false - save_merged = false - - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("fastp - stub test_fastp_interleaved") { - - options "-stub" - - config './nextflow.interleaved.config' - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_single_end_trim_fail - stub") { - - options "-stub" - - when { - - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end_trim_fail - stub") { - - options "-stub" - - config './nextflow.save_failed.config' - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end_merged - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end_merged_adapterlist - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) - input[2] = false - input[3] = false - input[4] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_single_end_qc_only - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end_qc_only - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap deleted file mode 100644 index 9e2aaf3158..0000000000 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ /dev/null @@ -1,1331 +0,0 @@ -{ - "test_fastp_single_end_qc_only - stub": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:51.8619133" - }, - "test_fastp_paired_end": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,7cf3bff1922b512bcca58439eb2d3679" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" - ] - ] - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:15.121411815" - }, - "test_fastp_paired_end_merged_adapterlist": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,533983f8c11cc3f2ccdcea01531f68ae" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" - ] - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:51.561598206" - }, - "test_fastp_single_end_qc_only": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,93f407199ee8b94c023c291bddfc4dce" - ] - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:56.392912049" - }, - "test_fastp_paired_end_trim_fail": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", - "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", - "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", - "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,5009a892192f2084c2af69c153d88d6c" - ] - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:38.690242568" - }, - "fastp - stub test_fastp_interleaved": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:23.678200076" - }, - "test_fastp_single_end - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:08.756547678" - }, - "test_fastp_paired_end_merged_adapterlist - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:47.596331823" - }, - "test_fastp_paired_end_merged - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:39.962303534" - }, - "test_fastp_paired_end_merged": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,8f99097bfa04b629891105b8af9c429f" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" - ] - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:46.300238743" - }, - "test_fastp_paired_end - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:16.309925689" - }, - "test_fastp_single_end": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,81dc86dd695967bb5c015e0a978bf20c" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" - ] - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:07.133909607" - }, - "test_fastp_single_end_trim_fail - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_fail": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:28.086573661" - }, - "test_fastp_paired_end_trim_fail - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:35.606162029" - }, - "fastp test_fastp_interleaved": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,217d62dc13a23e92513a1bd8e1bcea39" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,101003b8ac634ca5fd381656ac2b8b9f" - ] - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:23.114582408" - }, - "test_fastp_single_end_trim_fail": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d721f75d68a382c819b6499e6325a942" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd" - ] - ], - [ - - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:39:30.757538842" - }, - "test_fastp_paired_end_qc_only": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,1ad31d6559ff5d4d275f501f3f5c02b9" - ] - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:01.381972575" - }, - "test_fastp_paired_end_qc_only - stub": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,3799377c4173131ba9392346e1c40bb9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-31T13:40:56.392034947" - } -} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.interleaved.config b/modules/nf-core/fastp/tests/nextflow.interleaved.config deleted file mode 100644 index 4be8dbd2c8..0000000000 --- a/modules/nf-core/fastp/tests/nextflow.interleaved.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: FASTP { - ext.args = "--interleaved_in -e 30" - } -} diff --git a/modules/nf-core/fastp/tests/nextflow.save_failed.config b/modules/nf-core/fastp/tests/nextflow.save_failed.config deleted file mode 100644 index 53b61b0c15..0000000000 --- a/modules/nf-core/fastp/tests/nextflow.save_failed.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: FASTP { - ext.args = "-e 30" - } -} diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test deleted file mode 100644 index e9d79a074e..0000000000 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ /dev/null @@ -1,309 +0,0 @@ -nextflow_process { - - name "Test Process FASTQC" - script "../main.nf" - process "FASTQC" - - tag "modules" - tag "modules_nfcore" - tag "fastqc" - - test("sarscov2 single-end [fastq]") { - - when { - process { - """ - input[0] = Channel.of([ - [ id: 'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("sarscov2 paired-end [fastq]") { - - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("sarscov2 interleaved [fastq]") { - - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("sarscov2 paired-end [bam]") { - - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("sarscov2 multiple [fastq]") { - - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("sarscov2 custom_prefix") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'mysample', single_end:true ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } - - test("sarscov2 single-end [fastq] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id: 'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 paired-end [fastq] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 interleaved [fastq] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 paired-end [bam] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 multiple [fastq] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 custom_prefix - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id:'mysample', single_end:true ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap deleted file mode 100644 index d5db3092fb..0000000000 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ /dev/null @@ -1,392 +0,0 @@ -{ - "sarscov2 custom_prefix": { - "content": [ - [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:16.374038" - }, - "sarscov2 single-end [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": true - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:24.993809" - }, - "sarscov2 custom_prefix - stub": { - "content": [ - { - "0": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:03:10.93942" - }, - "sarscov2 interleaved [fastq]": { - "content": [ - [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:01:42.355718" - }, - "sarscov2 paired-end [bam]": { - "content": [ - [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:01:53.276274" - }, - "sarscov2 multiple [fastq]": { - "content": [ - [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:05.527626" - }, - "sarscov2 paired-end [fastq]": { - "content": [ - [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:01:31.188871" - }, - "sarscov2 paired-end [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:34.273566" - }, - "sarscov2 multiple [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:03:02.304411" - }, - "sarscov2 single-end [fastq]": { - "content": [ - [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:01:19.095607" - }, - "sarscov2 interleaved [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:44.640184" - }, - "sarscov2 paired-end [bam] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:53.550742" - } -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test b/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test deleted file mode 100644 index 8a90634051..0000000000 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test +++ /dev/null @@ -1,72 +0,0 @@ -nextflow_process { - - name "Test Process FGBIO_CALLMOLECULARCONSENSUSREADS" - script "../main.nf" - process "FGBIO_CALLMOLECULARCONSENSUSREADS" - - tag "modules" - tag "modules_nfcore" - tag "fgbio" - tag "fgbio/callmolecularconsensusreads" - tag "fgbio/sortbam" - - setup { - - run("FGBIO_SORTBAM") { - script "../../sortbam/main.nf" - config "./sort.config" - process { - """ - input[0] = [[ id:'homo_sapiens_genome' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) - ] - """ - } - } - } - - test("homo_sapiens - bam") { - - when { - process { - """ - input[0] = FGBIO_SORTBAM.out.bam - input[1] = 1 - input[2] = 20 - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - stub") { - - options "-stub" - - when { - process { - """ - input[0] = FGBIO_SORTBAM.out.bam - input[1] = 1 - input[2] = 20 - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap b/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap deleted file mode 100644 index e7e4507f2d..0000000000 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/main.nf.test.snap +++ /dev/null @@ -1,68 +0,0 @@ -{ - "homo_sapiens - stub": { - "content": [ - { - "0": [ - [ - { - "id": "homo_sapiens_genome" - }, - "homo_sapiens_genome_consensus_unmapped.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" - ], - "bam": [ - [ - { - "id": "homo_sapiens_genome" - }, - "homo_sapiens_genome_consensus_unmapped.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:22:07.722755" - }, - "homo_sapiens - bam": { - "content": [ - { - "0": [ - [ - { - "id": "homo_sapiens_genome" - }, - "homo_sapiens_genome_consensus_unmapped.bam:md5,f56c861f1f604ecc9894dc9182b170f8" - ] - ], - "1": [ - "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" - ], - "bam": [ - [ - { - "id": "homo_sapiens_genome" - }, - "homo_sapiens_genome_consensus_unmapped.bam:md5,f56c861f1f604ecc9894dc9182b170f8" - ] - ], - "versions": [ - "versions.yml:md5,b5ef59a06877dec12426c4c2c02e887c" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:21:46.241305" - } -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/sort.config b/modules/nf-core/fgbio/callmolecularconsensusreads/tests/sort.config deleted file mode 100644 index b205c8f210..0000000000 --- a/modules/nf-core/fgbio/callmolecularconsensusreads/tests/sort.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - withName: FGBIO_SORTBAM { - ext.args = '-s TemplateCoordinate' - ext.prefix = { "${meta.id}_out" } - } -} diff --git a/modules/nf-core/fgbio/fastqtobam/tests/bam.config b/modules/nf-core/fgbio/fastqtobam/tests/bam.config deleted file mode 100644 index 014ba9205a..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/bam.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.suffix = "bam" -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/fastqtobam/tests/cram.config b/modules/nf-core/fgbio/fastqtobam/tests/cram.config deleted file mode 100644 index 2406cb99e1..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/cram.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.suffix = "cram" -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/fastqtobam/tests/custom_sample.config b/modules/nf-core/fgbio/fastqtobam/tests/custom_sample.config deleted file mode 100644 index 2ed567b4db..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/custom_sample.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = "--sample CustomSample --library CustomLibrary" -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test b/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test deleted file mode 100644 index d10a005220..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test +++ /dev/null @@ -1,218 +0,0 @@ -nextflow_process { - - name "Test Process FGBIO_FASTQTOBAM" - script "../main.nf" - process "FGBIO_FASTQTOBAM" - - tag "modules" - tag "modules_nfcore" - tag "fgbio" - tag "fgbio/fastqtobam" - - test("homo_sapiens - [fastq1, fastq2] - default") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_2.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.cram, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [fastq1, fastq2] - cram") { - - config "./cram.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_2.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.bam, - file(process.out.cram[0][1]).name, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [fastq1, fastq2] - bam") { - - config "./bam.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_2.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.cram, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - fastq1") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.cram, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [fastq1, fastq2] - umi") { - - config "./umi.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_2.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.cram, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [fastq1, fastq2] - custom sample") { - - config "./custom_sample.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_2.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.cram, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [fastq1, fastq2] - stub") { - - options "-stub" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test.umi_2.fastq.gz', checkIfExists: true) - ] - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.bam[0][1]).name, - process.out.cram, - process.out.versions - ).match() } - ) - } - - } -} diff --git a/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap b/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap deleted file mode 100644 index dd167b9768..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/main.nf.test.snap +++ /dev/null @@ -1,114 +0,0 @@ -{ - "homo_sapiens - [fastq1, fastq2] - cram": { - "content": [ - [ - - ], - "test.cram", - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:23:19.214068" - }, - "homo_sapiens - fastq1": { - "content": [ - "test.bam", - [ - - ], - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:23:52.501663" - }, - "homo_sapiens - [fastq1, fastq2] - default": { - "content": [ - "test.bam", - [ - - ], - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:23:02.561152" - }, - "homo_sapiens - [fastq1, fastq2] - umi": { - "content": [ - "test.bam", - [ - - ], - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:24:09.020635" - }, - "homo_sapiens - [fastq1, fastq2] - bam": { - "content": [ - "test.bam", - [ - - ], - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:23:35.97054" - }, - "homo_sapiens - [fastq1, fastq2] - custom sample": { - "content": [ - "test.bam", - [ - - ], - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:24:25.692023" - }, - "homo_sapiens - [fastq1, fastq2] - stub": { - "content": [ - "test.bam", - [ - - ], - [ - "versions.yml:md5,5f78e5611a92d4bd41337180b6d071b3" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:24:37.828713" - } -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/fastqtobam/tests/umi.config b/modules/nf-core/fgbio/fastqtobam/tests/umi.config deleted file mode 100644 index 7b668aa939..0000000000 --- a/modules/nf-core/fgbio/fastqtobam/tests/umi.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = "--read-structures +T 12M11S+T" -} \ No newline at end of file diff --git a/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test b/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test deleted file mode 100644 index a9e8bd256c..0000000000 --- a/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test +++ /dev/null @@ -1,60 +0,0 @@ -nextflow_process { - - name "Test Process FGBIO_GROUPREADSBYUMI" - script "../main.nf" - process "FGBIO_GROUPREADSBYUMI" - - tag "modules" - tag "modules_nfcore" - tag "fgbio" - tag "fgbio/groupreadsbyumi" - - test("sarscov2 - bam") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.unsorted_tagged.bam', checkIfExists: true) - ] - input[1] = "Adjacency" - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.unsorted_tagged.bam', checkIfExists: true) - ] - input[1] = "Adjacency" - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap b/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap deleted file mode 100644 index 67956c5337..0000000000 --- a/modules/nf-core/fgbio/groupreadsbyumi/tests/main.nf.test.snap +++ /dev/null @@ -1,108 +0,0 @@ -{ - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "histogram": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:25:36.897639" - }, - "sarscov2 - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped.bam:md5,35bfc992c30d8e3e50816159fa58cb11" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped_histogram.txt:md5,9a0c622b65209afbce0840e2affff983" - ] - ], - "2": [ - "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped.bam:md5,35bfc992c30d8e3e50816159fa58cb11" - ] - ], - "histogram": [ - [ - { - "id": "test", - "single_end": false - }, - "test_umi-grouped_histogram.txt:md5,9a0c622b65209afbce0840e2affff983" - ] - ], - "versions": [ - "versions.yml:md5,3951d85671eb08c5731449a16bd9a229" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-11-11T12:25:25.077144" - } -} \ No newline at end of file diff --git a/modules/nf-core/freebayes/tests/main.nf.test b/modules/nf-core/freebayes/tests/main.nf.test deleted file mode 100644 index eb2d7a8055..0000000000 --- a/modules/nf-core/freebayes/tests/main.nf.test +++ /dev/null @@ -1,190 +0,0 @@ -nextflow_process { - - name "Test Process FREEBAYES" - script "../main.nf" - process "FREEBAYES" - - tag "modules" - tag "modules_nfcore" - tag "freebayes" - - test("sarscov2 - [ bam, bai ] - fasta - fai") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [], - [], - [] - ] - input[1] = [ [ id: 'test_fasta' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id: 'test_fai' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - path(process.out.vcf[0][1]).linesGzip[2..10], - process.out.versions - ).match() - } - ) - } - - } - - test("sarscov2 - [ bam, bai, bed ] - fasta - fai") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [], - [], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), - ] - input[1] = [ [ id: 'fasta' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id: 'fai' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - path(process.out.vcf[0][1]).linesGzip[2..10], - process.out.versions - ).match() - } - ) - } - - } - - test("sarscov2 - [ cram, crai ] - fasta - fai") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], - [], - [], - ] - input[1] = [ [ id: 'fasta' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id: 'fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - path(process.out.vcf[0][1]).linesGzip[2..10], - process.out.versions - ).match() - } - ) - } - - } - - test("sarscov2 - [ bam, bai, bam, bai ] - fasta - fai") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam.bai', checkIfExists: true), - [], - ] - input[1] = [ [ id: 'fasta' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id: 'fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - path(process.out.vcf[0][1]).linesGzip[2..10], - process.out.versions - ).match() - } - ) - } - - } - - test("sarscov2 - [ cram, crai, cram, crai, bed ] - fasta - fai") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true), - ] - input[1] = [ [ id: 'fasta' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id: 'fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - path(process.out.vcf[0][1]).linesGzip[2..10], - process.out.versions - ).match() - } - ) - } - - } -} diff --git a/modules/nf-core/freebayes/tests/main.nf.test.snap b/modules/nf-core/freebayes/tests/main.nf.test.snap deleted file mode 100644 index f9f25a2ee2..0000000000 --- a/modules/nf-core/freebayes/tests/main.nf.test.snap +++ /dev/null @@ -1,122 +0,0 @@ -{ - "sarscov2 - [ cram, crai, cram, crai, bed ] - fasta - fai": { - "content": [ - "test.vcf.gz", - [ - "##source=freeBayes v1.3.6", - "##reference=genome.fasta", - "##contig=", - "##phasing=none", - "##commandline=\"freebayes -f genome.fasta --target genome.bed test.paired_end.sorted.cram test2.paired_end.sorted.cram\"", - "##INFO=", - "##INFO=", - "##INFO=", - "##INFO=" - ], - [ - "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-14T16:16:26.462458" - }, - "sarscov2 - [ bam, bai ] - fasta - fai": { - "content": [ - "test.vcf.gz", - [ - "##source=freeBayes v1.3.6", - "##reference=genome.fasta", - "##contig=", - "##phasing=none", - "##commandline=\"freebayes -f genome.fasta test.paired_end.sorted.bam\"", - "##INFO=", - "##INFO=", - "##INFO=", - "##INFO=" - ], - [ - "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-14T16:16:02.547974" - }, - "sarscov2 - [ cram, crai ] - fasta - fai": { - "content": [ - "test.vcf.gz", - [ - "##source=freeBayes v1.3.6", - "##reference=genome.fasta", - "##contig=", - "##phasing=none", - "##commandline=\"freebayes -f genome.fasta test.paired_end.sorted.cram\"", - "##INFO=", - "##INFO=", - "##INFO=", - "##INFO=" - ], - [ - "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-14T16:16:13.594195" - }, - "sarscov2 - [ bam, bai, bed ] - fasta - fai": { - "content": [ - "test.vcf.gz", - [ - "##source=freeBayes v1.3.6", - "##reference=genome.fasta", - "##contig=", - "##phasing=none", - "##commandline=\"freebayes -f genome.fasta --target test.bed test.paired_end.sorted.bam\"", - "##INFO=", - "##INFO=", - "##INFO=", - "##INFO=" - ], - [ - "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-14T16:16:07.514526" - }, - "sarscov2 - [ bam, bai, bam, bai ] - fasta - fai": { - "content": [ - "test.vcf.gz", - [ - "##source=freeBayes v1.3.6", - "##reference=genome.fasta", - "##contig=", - "##phasing=none", - "##commandline=\"freebayes -f genome.fasta test.paired_end.sorted.bam test2.paired_end.sorted.bam\"", - "##INFO=", - "##INFO=", - "##INFO=", - "##INFO=" - ], - [ - "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-14T16:16:20.085987" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/applybqsr/tests/main.nf.test b/modules/nf-core/gatk4/applybqsr/tests/main.nf.test deleted file mode 100644 index acb41ce1e4..0000000000 --- a/modules/nf-core/gatk4/applybqsr/tests/main.nf.test +++ /dev/null @@ -1,154 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_APPLYBQSR" - script "../main.nf" - process "GATK4_APPLYBQSR" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/applybqsr" - - test("sarscov2 - bam") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - bam - intervals") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 - cram") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match() }, - { assert snapshot(file(process.out.cram[0][1]).name).match("test.cram") } - ) - } - } - - test("sarscov2 - cram - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - ) - } - } - - test("sarscov2 - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap b/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap deleted file mode 100644 index 427cbddb8d..0000000000 --- a/modules/nf-core/gatk4/applybqsr/tests/main.nf.test.snap +++ /dev/null @@ -1,180 +0,0 @@ -{ - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - - ], - "versions": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:32:45.888751339" - }, - "sarscov2 - bam - intervals": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,51259943bca01c92b20fb5b7ac09a246" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,51259943bca01c92b20fb5b7ac09a246" - ] - ], - "cram": [ - - ], - "versions": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:31:59.340916681" - }, - "sarscov2 - cram": { - "content": [ - [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:32:16.162569909" - }, - "test.cram": { - "content": [ - "test.cram" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-09T03:10:46.70859771" - }, - "sarscov2 - cram - stub": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ], - "bam": [ - - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:32:34.223186142" - }, - "sarscov2 - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,213acb451007a0098a6a6a360fa68d72" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,213acb451007a0098a6a6a360fa68d72" - ] - ], - "cram": [ - - ], - "versions": [ - "versions.yml:md5,91928754768510a59bde637403ee6a94" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:31:44.601557038" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/applyvqsr/tests/allelspecificity.config b/modules/nf-core/gatk4/applyvqsr/tests/allelspecificity.config deleted file mode 100644 index ac368bd058..0000000000 --- a/modules/nf-core/gatk4/applyvqsr/tests/allelspecificity.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4_APPLYVQSR { - ext.args = '--mode SNP --truth-sensitivity-filter-level 99.0 -AS' - } -} diff --git a/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test b/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test deleted file mode 100644 index 104eb7f01b..0000000000 --- a/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test +++ /dev/null @@ -1,106 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_APPLYVQSR" - script "../main.nf" - process "GATK4_APPLYVQSR" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/applyvqsr" - - test("human - vcf") { - - config "./no-allelspecificity.config" - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2.recal', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2.recal.idx', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2.tranches', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions") }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.2") }, - { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match() } - ) - } - - } - - test("human - vcf - allele-specific") { - - config "./allelspecificity.config" - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2_allele_specific.recal', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2_allele_specific.recal.idx', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2_allele_specific.tranches', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions_allelspecific") }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.2") }, - { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match() } - ) - } - - } - - test("human - vcf - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2.recal', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2.recal.idx', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/variantrecalibrator/test2.tranches', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap b/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap deleted file mode 100644 index 1f3e97cbfd..0000000000 --- a/modules/nf-core/gatk4/applyvqsr/tests/main.nf.test.snap +++ /dev/null @@ -1,95 +0,0 @@ -{ - "human - vcf": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T13:31:50.727658" - }, - "human - vcf - allele-specific": { - "content": [ - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T13:29:42.331816" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:33:41.980566137" - }, - "human - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:34:08.561335315" - }, - "versions_allelspecific": { - "content": [ - [ - "versions.yml:md5,198986205018e3e6cdd651680a5e8cdd" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:33:56.418381574" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/applyvqsr/tests/no-allelspecificity.config b/modules/nf-core/gatk4/applyvqsr/tests/no-allelspecificity.config deleted file mode 100644 index c08c918e1a..0000000000 --- a/modules/nf-core/gatk4/applyvqsr/tests/no-allelspecificity.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4_APPLYVQSR { - ext.args = '--mode SNP --truth-sensitivity-filter-level 99.0' - } -} diff --git a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test b/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test deleted file mode 100644 index 97c1c1ecb1..0000000000 --- a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test +++ /dev/null @@ -1,250 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_BASERECALIBRATOR" - script "../main.nf" - process "GATK4_BASERECALIBRATOR" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/baserecalibrator" - - test("sarscov2 - bam") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) - input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 - bam - intervals") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) - input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - bam - multiple sites") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) - ]) - input[5] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("homo_sapiens - cram") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)]) - input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 - bam - stub") { - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) - input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 - bam - intervals - stub") { - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)]) - input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - bam - multiple sites - stub") { - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) - ]) - input[5] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("homo_sapiens - cram - stub") { - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] - ]) - input[1] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) - input[2] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)]) - input[3] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)]) - input[4] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)]) - input[5] = Channel.of([[ id:'test' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap b/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap deleted file mode 100644 index efdf46b3df..0000000000 --- a/modules/nf-core/gatk4/baserecalibrator/tests/main.nf.test.snap +++ /dev/null @@ -1,266 +0,0 @@ -{ - "homo_sapiens - cram": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,35d89a3811aa31711fc9815b6b80e6ec" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,35d89a3811aa31711fc9815b6b80e6ec" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-01-23T15:37:29.36262858" - }, - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:36:20.634357503" - }, - "sarscov2 - bam - intervals": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,9ecb5f00a2229291705addc09c0ec231" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,9ecb5f00a2229291705addc09c0ec231" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:35:55.223087741" - }, - "sarscov2 - bam - multiple sites": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:36:10.08523788" - }, - "homo_sapiens - cram - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-01-23T15:38:23.045092592" - }, - "sarscov2 - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:35:41.89476551" - }, - "sarscov2 - bam - intervals - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-01-23T15:37:56.722728282" - }, - "sarscov2 - bam - multiple sites - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1150a8b62c614926eeedda9d4bc8f651" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-01-23T15:38:09.797767675" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test b/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test deleted file mode 100644 index 81f048f67b..0000000000 --- a/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test +++ /dev/null @@ -1,106 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_CALCULATECONTAMINATION" - script "../main.nf" - process "GATK4_CALCULATECONTAMINATION" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/calculatecontamination" - - test("human - pileup-table") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test2.pileups.table', checkIfExists: true), - [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions") }, - { assert snapshot(file(process.out.contamination.get(0).get(1)).readLines()[0]).match() } - ) - } - - } - - test("human - pileup-table - matched-pair") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test2.pileups.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.pileups.table', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions_pair") }, - { assert snapshot(file(process.out.contamination.get(0).get(1)).readLines()[0]).match() } - ) - } - - } - - test("human - pileup-table - segmentation") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test2.pileups.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.pileups.table', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions_segmentation") }, - { assert snapshot(file(process.out.contamination.get(0).get(1)).readLines()[0]).match("contamination") }, - { assert snapshot(file(process.out.segmentation.get(0).get(1)).readLines()[0]).match("segmentation") } - ) - } - - } - - test("human - pileup-table - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test2.pileups.table', checkIfExists: true), - [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap b/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap deleted file mode 100644 index 756c2452f8..0000000000 --- a/modules/nf-core/gatk4/calculatecontamination/tests/main.nf.test.snap +++ /dev/null @@ -1,127 +0,0 @@ -{ - "versions_pair": { - "content": [ - [ - "versions.yml:md5,05685d2e6a839916a120c07b4db98914" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:39:04.844937172" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,05685d2e6a839916a120c07b4db98914" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:38:50.36175509" - }, - "versions_segmentation": { - "content": [ - [ - "versions.yml:md5,05685d2e6a839916a120c07b4db98914" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:39:22.516513354" - }, - "segmentation": { - "content": [ - "#SAMPLE=tumour" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T12:57:38.845287" - }, - "human - pileup-table": { - "content": [ - "sample\tcontamination\terror" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T11:09:16.292509" - }, - "human - pileup-table - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.contamination.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.segmentation.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,05685d2e6a839916a120c07b4db98914" - ], - "contamination": [ - [ - { - "id": "test" - }, - "test.contamination.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "segmentation": [ - [ - { - "id": "test" - }, - "test.segmentation.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,05685d2e6a839916a120c07b4db98914" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:39:40.353818746" - }, - "human - pileup-table - matched-pair": { - "content": [ - "sample\tcontamination\terror" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T11:09:26.408848" - }, - "contamination": { - "content": [ - "sample\tcontamination\terror" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T12:57:38.840651" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/calculatecontamination/tests/nextflow.config b/modules/nf-core/gatk4/calculatecontamination/tests/nextflow.config deleted file mode 100644 index db836b7f80..0000000000 --- a/modules/nf-core/gatk4/calculatecontamination/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4_CALCULATECONTAMINATION { - ext.args = { "--tumor-segmentation ${meta.id}.segmentation.table" } - } -} diff --git a/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test b/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test deleted file mode 100644 index db58bf421c..0000000000 --- a/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test +++ /dev/null @@ -1,77 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_CNNSCOREVARIANTS" - script "../main.nf" - process "GATK4_CNNSCOREVARIANTS" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/cnnscorevariants" - - test("homo sapiens - vcf") { - when { - process { - """ - input_vcf = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi", checkIfExists: true), - [], - [] - ] - fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) - fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) - dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) - - input = [input_vcf, fasta, fai, dict, [], []] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - path(process.out.vcf[0][1]).vcf.variantsMD5, - file(process.out.tbi[0][1]).name, - ).match() } - ) - } - - } - - test("homo sapiens - vcf - stub") { - - options "-stub" - - when { - process { - """ - input_vcf = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi", checkIfExists: true), - [], - [] - ] - fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) - fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) - dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) - - input = [input_vcf, fasta, fai, dict, [], []] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap b/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap deleted file mode 100644 index 63be00cfee..0000000000 --- a/modules/nf-core/gatk4/cnnscorevariants/tests/main.nf.test.snap +++ /dev/null @@ -1,65 +0,0 @@ -{ - "homo sapiens - vcf": { - "content": [ - [ - "versions.yml:md5,7e0d98246eb35725469a53e6fb8acfbf" - ], - "34e15624519ba7408d53cb8bb365ffc1", - "test.cnn.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-18T09:39:27.896072791" - }, - "homo sapiens - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.cnn.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cnn.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,7e0d98246eb35725469a53e6fb8acfbf" - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.cnn.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.cnn.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,7e0d98246eb35725469a53e6fb8acfbf" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-06T10:46:55.099673108" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test b/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test deleted file mode 100644 index a8a9c6d2e8..0000000000 --- a/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test +++ /dev/null @@ -1,56 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_CREATESEQUENCEDICTIONARY" - script "../main.nf" - process "GATK4_CREATESEQUENCEDICTIONARY" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/createsequencedictionary" - - test("sarscov2 - fasta") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - fasta - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap b/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap deleted file mode 100644 index e8a600fd11..0000000000 --- a/modules/nf-core/gatk4/createsequencedictionary/tests/main.nf.test.snap +++ /dev/null @@ -1,68 +0,0 @@ -{ - "sarscov2 - fasta - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "genome.dict:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" - ], - "dict": [ - [ - { - "id": "test" - }, - "genome.dict:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:51:56.155954077" - }, - "sarscov2 - fasta": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "genome.dict:md5,7362679f176e0f52add03c08f457f646" - ] - ], - "1": [ - "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" - ], - "dict": [ - [ - { - "id": "test" - }, - "genome.dict:md5,7362679f176e0f52add03c08f457f646" - ] - ], - "versions": [ - "versions.yml:md5,e993b2c99f7f6b0fcd8428de15c61439" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T10:51:45.562993875" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test deleted file mode 100644 index 8552ca47dc..0000000000 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test +++ /dev/null @@ -1,113 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_ESTIMATELIBRARYCOMPLEXITY" - script "../main.nf" - process "GATK4_ESTIMATELIBRARYCOMPLEXITY" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/estimatelibrarycomplexity" - - test("homo_sapiens - bam") { - - when { - process { - """ - // [ meta, input ] - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true) - ] - // fasta - input[1] = [] - // fai - input[2] = [] - // dict - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict' , checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.metrics[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - - test("homo_sapiens - cram") { - - when { - process { - """ - // [ meta, input ] - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) - ] - // fasta - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta' , checkIfExists: true) - // fai - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai' , checkIfExists: true) - // dict - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict' , checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.metrics[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - - test("homo sapiens - bam - stub") { - - options "-stub" - - when { - process { - """ - // [ meta, input ] - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true) - ] - // fasta - input[1] = [] - // fai - input[2] = [] - // dict - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict' , checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.metrics[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap b/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap deleted file mode 100644 index 73752535e9..0000000000 --- a/modules/nf-core/gatk4/estimatelibrarycomplexity/tests/main.nf.test.snap +++ /dev/null @@ -1,41 +0,0 @@ -{ - "homo_sapiens - cram": { - "content": [ - "test.metrics", - [ - "versions.yml:md5,a7b6a9d538151a577da5f5727ace31e6" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:01:20.304274717" - }, - "homo sapiens - bam - stub": { - "content": [ - "test.metrics", - [ - "versions.yml:md5,a7b6a9d538151a577da5f5727ace31e6" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-07T10:17:35.145738139" - }, - "homo_sapiens - bam": { - "content": [ - "test.metrics", - [ - "versions.yml:md5,a7b6a9d538151a577da5f5727ace31e6" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:00:54.378191881" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test b/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test deleted file mode 100644 index 83c3703fcb..0000000000 --- a/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test +++ /dev/null @@ -1,176 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_FILTERMUTECTCALLS" - script "../main.nf" - process "GATK4_FILTERMUTECTCALLS" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/filtermutectcalls" - - test("human - vcf - base") { - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.stats', checkIfExists: true), - [], - [], - [], - [] - ] - - input[1] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions_base") }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.2") }, - { assert path(process.out.tbi.get(0).get(1)).linesGzip.toString().contains("TBI")}, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0]).match() } - ) - } - - } - - test("human - vcf - with-files") { - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.stats', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_test2_paired_mutect2_calls.artifact-prior.tar.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_test2_paired.segmentation.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_test2_paired.contamination.table', checkIfExists: true), - [] - ] - - input[1] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions_with-files") }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.2") }, - { assert path(process.out.tbi.get(0).get(1)).linesGzip.toString().contains("TBI")}, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0..5]).match() } - ) - } - - } - - test("human - vcf - use-val") { - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.stats', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_test2_paired_mutect2_calls.artifact-prior.tar.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_test2_paired.segmentation.table', checkIfExists: true), - [], - '20.0' - ] - - input[1] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions_use-val") }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.2") }, - { assert path(process.out.tbi.get(0).get(1)).linesGzip.toString().contains("TBI")}, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0]).match() } - ) - } - - } - - test("human - vcf - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.stats', checkIfExists: true), - [], - [], - [], - [] - ] - - input[1] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap b/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap deleted file mode 100644 index 28a63357e7..0000000000 --- a/modules/nf-core/gatk4/filtermutectcalls/tests/main.nf.test.snap +++ /dev/null @@ -1,140 +0,0 @@ -{ - "human - vcf - use-val": { - "content": [ - "#Ln prior of deletion of length 10=-20.72326583694641" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T12:46:03.887912" - }, - "versions_with-files": { - "content": [ - [ - "versions.yml:md5,029e46832ac21665f3ba027974061ed0" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:04:55.625468064" - }, - "human - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.filtered.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.filtered.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.filtered.vcf.gz.filteringStats.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,029e46832ac21665f3ba027974061ed0" - ], - "stats": [ - [ - { - "id": "test" - }, - "test.filtered.vcf.gz.filteringStats.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.filtered.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.filtered.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,029e46832ac21665f3ba027974061ed0" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:05:33.111919824" - }, - "versions_use-val": { - "content": [ - [ - "versions.yml:md5,029e46832ac21665f3ba027974061ed0" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:05:19.277193087" - }, - "versions_base": { - "content": [ - [ - "versions.yml:md5,029e46832ac21665f3ba027974061ed0" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:04:36.657284567" - }, - "human - vcf - with-files": { - "content": [ - [ - "#Ln prior of deletion of length 10=-20.72326583694641", - "#Ln prior of deletion of length 9=-20.72326583694641", - "#Ln prior of deletion of length 8=-20.72326583694641", - "#Ln prior of deletion of length 7=-20.72326583694641", - "#Ln prior of deletion of length 6=-20.72326583694641", - "#Ln prior of deletion of length 5=-20.72326583694641" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T12:45:43.699286" - }, - "human - vcf - base": { - "content": [ - "#Ln prior of deletion of length 10=-20.72326583694641" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-15T12:47:39.949405" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/filtermutectcalls/tests/nextflow.config b/modules/nf-core/gatk4/filtermutectcalls/tests/nextflow.config deleted file mode 100644 index 12fa58fb34..0000000000 --- a/modules/nf-core/gatk4/filtermutectcalls/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4_FILTERMUTECTCALLS { - ext.prefix = { "${meta.id}.filtered" } - } -} diff --git a/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test b/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test deleted file mode 100644 index c315ed8fc0..0000000000 --- a/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test +++ /dev/null @@ -1,78 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_FILTERVARIANTTRANCHES" - script "../main.nf" - config "./nextflow.config" - process "GATK4_FILTERVARIANTTRANCHES" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/filtervarianttranches" - - test("homo sapiens - vcf") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi", checkIfExists: true), - [] - ] - input[1] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz", checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi", checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) - input[4] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf[0][1]).name, - file(process.out.tbi[0][1]).name, - ).match() - } - ) - } - - } - - test("homo sapiens - vcf - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi", checkIfExists: true), - [] - ] - input[1] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz", checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi", checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true) - input[4] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta.fai", checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.dict", checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap b/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap deleted file mode 100644 index 8bc251b61c..0000000000 --- a/modules/nf-core/gatk4/filtervarianttranches/tests/main.nf.test.snap +++ /dev/null @@ -1,65 +0,0 @@ -{ - "homo sapiens - vcf": { - "content": [ - [ - "versions.yml:md5,bad82b4b3eb370f70925cc069b16b63a" - ], - "test.filtered.vcf.gz", - "test.filtered.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-04T14:45:11.404254527" - }, - "homo sapiens - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,bad82b4b3eb370f70925cc069b16b63a" - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,bad82b4b3eb370f70925cc069b16b63a" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-04T14:18:50.66032726" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config b/modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config deleted file mode 100644 index 7a8f0a061b..0000000000 --- a/modules/nf-core/gatk4/filtervarianttranches/tests/nextflow.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - - ext.args = "--info-key CNN_1D" -} diff --git a/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test b/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test deleted file mode 100644 index 173b149b54..0000000000 --- a/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test +++ /dev/null @@ -1,60 +0,0 @@ - -nextflow_process { - - name "Test Process GATK4_GATHERBQSRREPORTS" - script "../main.nf" - process "GATK4_GATHERBQSRREPORTS" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/gatherbqsrreports" - - test("test-gatk4-gatherbqsrreports") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true) - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-gatk4-gatherbqsrreports-multiple") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test2.baserecalibrator.table', checkIfExists: true) - ] - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap b/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap deleted file mode 100644 index e792d07ec5..0000000000 --- a/modules/nf-core/gatk4/gatherbqsrreports/tests/main.nf.test.snap +++ /dev/null @@ -1,72 +0,0 @@ -{ - "test-gatk4-gatherbqsrreports-multiple": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.table:md5,0c1257eececf95db8ca378272d0f21f9" - ] - ], - "1": [ - "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" - ], - "table": [ - [ - { - "id": "test", - "single_end": false - }, - "test.table:md5,0c1257eececf95db8ca378272d0f21f9" - ] - ], - "versions": [ - "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:07:33.025431761" - }, - "test-gatk4-gatherbqsrreports": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.table:md5,9603b69fdc3b5090de2e0dd78bfcc4bf" - ] - ], - "1": [ - "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" - ], - "table": [ - [ - { - "id": "test", - "single_end": false - }, - "test.table:md5,9603b69fdc3b5090de2e0dd78bfcc4bf" - ] - ], - "versions": [ - "versions.yml:md5,f7d3164566a7377bf766fb8b3933a34f" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:07:09.791064374" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test b/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test deleted file mode 100644 index f33c6a0d94..0000000000 --- a/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test +++ /dev/null @@ -1,62 +0,0 @@ - -nextflow_process { - - name "Test Process GATK4_GATHERPILEUPSUMMARIES" - script "../main.nf" - process "GATK4_GATHERPILEUPSUMMARIES" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/gatherpileupsummaries" - - test("test-gatk4-gatherpileupsummaries") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.pileups.table', checkIfExists: true) ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-gatk4-gatherpileupsummaries - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.pileups.table', checkIfExists: true) ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap b/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap deleted file mode 100644 index e7094d73f4..0000000000 --- a/modules/nf-core/gatk4/gatherpileupsummaries/tests/main.nf.test.snap +++ /dev/null @@ -1,72 +0,0 @@ -{ - "test-gatk4-gatherpileupsummaries - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.out.pileups.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,585747d3136a5bf0563bbbe229690526" - ], - "table": [ - [ - { - "id": "test", - "single_end": false - }, - "test.out.pileups.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,585747d3136a5bf0563bbbe229690526" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:08:38.118444526" - }, - "test-gatk4-gatherpileupsummaries": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.out.pileups.table:md5,8e0ca6f66e112bd2f7ec1d31a2d62469" - ] - ], - "1": [ - "versions.yml:md5,585747d3136a5bf0563bbbe229690526" - ], - "table": [ - [ - { - "id": "test", - "single_end": false - }, - "test.out.pileups.table:md5,8e0ca6f66e112bd2f7ec1d31a2d62469" - ] - ], - "versions": [ - "versions.yml:md5,585747d3136a5bf0563bbbe229690526" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:08:17.759423015" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/gatherpileupsummaries/tests/nextflow.config b/modules/nf-core/gatk4/gatherpileupsummaries/tests/nextflow.config deleted file mode 100644 index 2b49a6fa39..0000000000 --- a/modules/nf-core/gatk4/gatherpileupsummaries/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: 'GATK4_GATHERPILEUPSUMMARIES' { - ext.prefix = { "${meta.id}.out" } - } -} diff --git a/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test b/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test deleted file mode 100644 index 5fef5dd254..0000000000 --- a/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test +++ /dev/null @@ -1,160 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_GENOMICSDBIMPORT" - script "../main.nf" - process "GATK4_GENOMICSDBIMPORT" - - tag "modules" - tag "modules_nfcore" - tag "untar" - tag "gatk4" - tag "gatk4/genomicsdbimport" - - test("test_gatk4_genomicsdbimport_create_genomicsdb") { - - when { - process { - """ - // [meta, vcf, tbi, interval, interval_value, workspace ] - input[0] = [ [ id:'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.interval_list', checkIfExists: true) , - [] , - [] ] - // run_intlist - input[1] = false - // run_updatewspace - input[2] = false - // input_map - input[3] = false - - """ - } - } - - then { - assertAll( - { assert process.success }, - //{ assert snapshot(file(process.out.updatedb.get(0).get(1)).list().sort()).match() } - //{ assert snapshot(process.out.intervallist.get(0).get(1)).match() } - { assert snapshot( - file(process.out.genomicsdb.get(0).get(1)).list().sort(), - process.out.versions - ).match() } - ) - } - } - - test("test_gatk4_genomicsdbimport_get_intervalslist") { - - setup { - run("UNTAR") { - script "../../../untar/main.nf" - process { - """ - input[0] = Channel.of([ [], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_genomicsdb.tar.gz', checkIfExists: true) ]) - """ - } - } - } - - when { - process { - """ - input[0] = Channel.of([ [id:"test"], [], [], [], []]).combine(UNTAR.out.untar.map{ it[1] }) - // run_intlist - input[1] = true - // run_updatewspace - input[2] = false - // input_map - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - //{ assert snapshot(file(process.out.genomicsdb.get(0).get(1)).list().sort()).match() } - //{ assert snapshot(file(process.out.updatedb.get(0).get(1)).list().sort()).match() } - { assert snapshot( - process.out.intervallist.get(0).get(1), - process.out.versions - ).match() } - ) - } - } - - test("test_gatk4_genomicsdbimport_update_genomicsdb") { - - setup { - run("UNTAR") { - script "../../../untar/main.nf" - process { - """ - input[0] = Channel.of([ [], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_genomicsdb.tar.gz', checkIfExists: true) ]) - """ - } - } - } - - when { - process { - """ - input[0] = Channel.of([ [id:"test"], file( params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test2.genome.vcf.gz' , checkIfExists: true), file( params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test2.genome.vcf.gz.tbi' , checkIfExists: true), [], []]).combine(UNTAR.out.untar.map{ it[1] }) - // run_intlist - input[1] = false - // run_updatewspace - input[2] = true - // input_map - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - //{ assert snapshot(file(process.out.genomicsdb.get(0).get(1)).list().sort()).match() } - //{ assert snapshot(process.out.intervallist.get(0).get(1)).match() } - { assert snapshot( - file(process.out.updatedb.get(0).get(1)).list().sort(), - process.out.versions - ).match() } - ) - } - } - - test("test_gatk4_genomicsdbimport_stub") { - - options "-stub" - - when { - process { - """ - // [meta, vcf, tbi, interval, interval_value, workspace ] - input[0] = [ [ id:'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.interval_list', checkIfExists: true) , - [] , - [] ] - // run_intlist - input[1] = false - // run_updatewspace - input[2] = false - // input_map - input[3] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match()} - ) - } - } -} diff --git a/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap b/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap deleted file mode 100644 index cb47a432c9..0000000000 --- a/modules/nf-core/gatk4/genomicsdbimport/tests/main.nf.test.snap +++ /dev/null @@ -1,98 +0,0 @@ -{ - "test_gatk4_genomicsdbimport_get_intervalslist": { - "content": [ - "test.interval_list:md5,4c85812ac15fc1cd29711a851d23c0bf", - [ - "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:09:55.9195126" - }, - "test_gatk4_genomicsdbimport_create_genomicsdb": { - "content": [ - [ - "__tiledb_workspace.tdb", - "callset.json", - "chr22$1$40001", - "vcfheader.vcf", - "vidmap.json" - ], - [ - "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:09:25.302350893" - }, - "test_gatk4_genomicsdbimport_update_genomicsdb": { - "content": [ - [ - "__tiledb_workspace.tdb", - "callset.json", - "chr22$1$40001", - "vcfheader.vcf", - "vidmap.json" - ], - [ - "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:10:13.206208761" - }, - "test_gatk4_genomicsdbimport_stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" - ], - "genomicsdb": [ - [ - { - "id": "test" - }, - "test:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "intervallist": [ - - ], - "updatedb": [ - - ], - "versions": [ - "versions.yml:md5,5e722d5d01b9b1a0076ce80d0199b157" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:10:36.510210505" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/genomicsdbimport/tests/nextflow.config b/modules/nf-core/gatk4/genomicsdbimport/tests/nextflow.config deleted file mode 100644 index e177a144f4..0000000000 --- a/modules/nf-core/gatk4/genomicsdbimport/tests/nextflow.config +++ /dev/null @@ -1,2 +0,0 @@ -process { -} diff --git a/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test b/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test deleted file mode 100644 index 25bc2d3806..0000000000 --- a/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test +++ /dev/null @@ -1,285 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_GENOTYPEGVCFS" - script "../main.nf" - process "GATK4_GENOTYPEGVCFS" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/genotypegvcfs" - tag "untar" - - setup { - run("UNTAR") { - script "../../../untar/main.nf" - process { - """ - input[0] = [ - [id:"test"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_genomicsdb.tar.gz', checkIfExists: true) - ] - """ - } - } - } - - test("homo_sapiens - [gvcf, idx, [], []], fasta, fai, dict, [], []") { - - when { - process { - """ - input[0] = [ - [id:"test"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.idx', checkIfExists: true), - [], - [] - ] - input[1] = [ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists:true) - ] - input[2] = [ - [id:"fai"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists:true) - ] - input[3] = [ - [id:"dict"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists:true) - ] - input[4] = [[],[]] - input[5] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { [it[0], path(it[1]).vcf.variantsMD5] }, - process.out.tbi.collect { [it[0], file(it[1]).name] }, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [gvcf_gz, tbi, [], []], fasta, fai, dict, dbsnp, dbsnp_tbi") { - - when { - process { - """ - input[0] = [ - [id:"test"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - [], - [] - ] - input[1] = [ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists:true) - ] - input[2] = [ - [id:"fai"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists:true) - ] - input[3] = [ - [id:"dict"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists:true) - ] - input[4] = [ - [id:"dbsnp"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists:true) - ] - input[5] = [ - [id:"dbsnp"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists:true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { [it[0], path(it[1]).vcf.variantsMD5] }, - process.out.tbi.collect { [it[0], file(it[1]).name] }, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [gvcf_gz, tbi, bed, []], fasta, fai, dict, [], []") { - - when { - process { - """ - input[0] = [ - [id:"test"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists:true), - [] - ] - input[1] = [ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists:true) - ] - input[2] = [ - [id:"fai"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists:true) - ] - input[3] = [ - [id:"dict"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists:true) - ] - input[4] = [[],[]] - input[5] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { [it[0], path(it[1]).vcf.variantsMD5] }, - process.out.tbi.collect { [it[0], file(it[1]).name] }, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [gendb, [], [], []], fasta, fai, dict, [], []") { - - when { - process { - """ - input[0] = UNTAR.out.untar.map { meta, gendb -> [ meta, gendb, [], [], []] } - input[1] = [ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists:true) - ] - input[2] = [ - [id:"fai"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists:true) - ] - input[3] = [ - [id:"dict"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists:true) - ] - input[4] = [[],[]] - input[5] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { [it[0], path(it[1]).vcf.variantsMD5] }, - process.out.tbi.collect { [it[0], file(it[1]).name] }, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [gendb, bed, [], []], fasta, fai, dict, [], []") { - - when { - process { - """ - input[0] = UNTAR.out.untar.map { meta, gendb -> - [ - meta, - gendb, - [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists:true), - [] - ] - } - input[1] = [ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists:true) - ] - input[2] = [ - [id:"fai"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists:true) - ] - input[3] = [ - [id:"dict"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists:true) - ] - input[4] = [[],[]] - input[5] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.vcf.collect { [it[0], path(it[1]).vcf.variantsMD5] }, - process.out.tbi.collect { [it[0], file(it[1]).name] }, - process.out.versions - ).match() } - ) - } - - } - - test("homo_sapiens - [gvcf, idx, [], []], fasta, fai, dict, [], [] - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [id:"test"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.idx', checkIfExists: true), - [], - [] - ] - input[1] = [ - [id:"fasta"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists:true) - ] - input[2] = [ - [id:"fai"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists:true) - ] - input[3] = [ - [id:"dict"], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists:true) - ] - input[4] = [[],[]] - input[5] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap b/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap deleted file mode 100644 index 30e2dc1cc6..0000000000 --- a/modules/nf-core/gatk4/genotypegvcfs/tests/main.nf.test.snap +++ /dev/null @@ -1,191 +0,0 @@ -{ - "homo_sapiens - [gendb, [], [], []], fasta, fai, dict, [], []": { - "content": [ - [ - [ - { - "id": "test" - }, - "1ab95fbc5ec55b208f3001572bec54fa" - ] - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:16:45.625453031" - }, - "homo_sapiens - [gvcf, idx, [], []], fasta, fai, dict, [], []": { - "content": [ - [ - [ - { - "id": "test" - }, - "1ab95fbc5ec55b208f3001572bec54fa" - ] - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:15:55.296562046" - }, - "homo_sapiens - [gvcf_gz, tbi, bed, []], fasta, fai, dict, [], []": { - "content": [ - [ - [ - { - "id": "test" - }, - "1ab95fbc5ec55b208f3001572bec54fa" - ] - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:16:30.471742609" - }, - "homo_sapiens - [gvcf_gz, tbi, [], []], fasta, fai, dict, dbsnp, dbsnp_tbi": { - "content": [ - [ - [ - { - "id": "test" - }, - "9b7d476515e07e5486633c42abd86cc" - ] - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:16:13.266019505" - }, - "homo_sapiens - [gvcf, idx, [], []], fasta, fai, dict, [], [] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:17:19.342242664" - }, - "homo_sapiens - [gendb, bed, [], []], fasta, fai, dict, [], []": { - "content": [ - [ - [ - { - "id": "test" - }, - "1ab95fbc5ec55b208f3001572bec54fa" - ] - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi" - ] - ], - [ - "versions.yml:md5,fb1ca56ba52eb3fcda70dbef401f06b9" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:17:01.475664058" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test b/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test deleted file mode 100644 index 79cd6344cb..0000000000 --- a/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test +++ /dev/null @@ -1,104 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_GETPILEUPSUMMARIES" - script "../main.nf" - process "GATK4_GETPILEUPSUMMARIES" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/getpileupsummaries" - - test("human - bam") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list', checkIfExists: true) - ] - input[1] = [[],[]] // fasta - input[2] = [[],[]] // fai - input[3] = [[],[]] // dict - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("human - cram") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list', checkIfExists: true) - ] - input[1] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("human - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true) , - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list', checkIfExists: true) - ] - input[1] = [[],[]] // fasta - input[2] = [[],[]] // fai - input[3] = [[],[]] // dict - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap b/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap deleted file mode 100644 index e44c13bad8..0000000000 --- a/modules/nf-core/gatk4/getpileupsummaries/tests/main.nf.test.snap +++ /dev/null @@ -1,101 +0,0 @@ -{ - "human - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.pileups.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" - ], - "table": [ - [ - { - "id": "test" - }, - "test.pileups.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:19:28.038865911" - }, - "human - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" - ] - ], - "1": [ - "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" - ], - "table": [ - [ - { - "id": "test" - }, - "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" - ] - ], - "versions": [ - "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:18:47.633313304" - }, - "human - cram": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" - ] - ], - "1": [ - "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" - ], - "table": [ - [ - { - "id": "test" - }, - "test.pileups.table:md5,2d7ce4a54df6b9249e12d60737a67dac" - ] - ], - "versions": [ - "versions.yml:md5,eb6e918939c8daf7ba3b4b65169ea98a" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:19:14.207172594" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test deleted file mode 100644 index 18d35f498c..0000000000 --- a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test +++ /dev/null @@ -1,154 +0,0 @@ -// nf-core modules test gatk4/haplotypecaller -nextflow_process { - - name "Test Process GATK4_HAPLOTYPECALLER" - script "../main.nf" - process "GATK4_HAPLOTYPECALLER" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/haplotypecaller" - - test("homo_sapiens - [bam, bai] - fasta - fai - dict") { - - when { - process { - """ - input[0] = [ - [ id:'test_bam' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [], - [] - ] - input[1] = [ [ id:'test_fa' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id:'test_fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [ id:'test_dict' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - file(process.out.tbi[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - - test("homo_sapiens - [cram, crai] - fasta - fai - dict") { - - when { - process { - """ - input[0] = [ - [ id:'test_cram' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], - [] - ] - input[1] = [ [ id:'test_fa' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id:'test_fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [ id:'test_dict' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) ] - input[4] = [ [], [] ] - input[5] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - file(process.out.tbi[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - - test("homo_sapiens - [cram, crai] - fasta - fai - dict - sites - sites_tbi") { - - when { - process { - """ - input[0] = [ - [ id:'test_cram_sites' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], - [] - ] - input[1] = [ [ id:'test_fa' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id:'test_fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [ id:'test_dict' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) ] - input[4] = [ [ id:'test_sites' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true) ] - input[5] = [ [ id:'test_sites_tbi' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true) ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - file(process.out.tbi[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - - test("homo_sapiens - [cram, crai, dragstr_model] - fasta - fai - dict - sites - sites_tbi") { - - when { - process { - """ - input[0] = [ - [ id:'test_cram_sites_dragstr' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test_paired_end_sorted_dragstrmodel.txt', checkIfExists: true) - ] - input[1] = [ [ id:'test_fa' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id:'test_fai' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - input[3] = [ [ id:'test_dict' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) ] - input[4] = [ [ id:'test_sites' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true) ] - input[5] = [ [ id:'test_sites_tbi' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true) ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.vcf[0][1]).name, - file(process.out.tbi[0][1]).name, - process.out.versions - ).match() - } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap deleted file mode 100644 index e3ba2bdfa9..0000000000 --- a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap +++ /dev/null @@ -1,58 +0,0 @@ -{ - "homo_sapiens - [cram, crai] - fasta - fai - dict": { - "content": [ - "test_cram.vcf.gz", - "test_cram.vcf.gz.tbi", - [ - "versions.yml:md5,2528212fed975c92514cf6641379e878" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:20:32.392608448" - }, - "homo_sapiens - [cram, crai] - fasta - fai - dict - sites - sites_tbi": { - "content": [ - "test_cram_sites.vcf.gz", - "test_cram_sites.vcf.gz.tbi", - [ - "versions.yml:md5,2528212fed975c92514cf6641379e878" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:20:49.012555768" - }, - "homo_sapiens - [bam, bai] - fasta - fai - dict": { - "content": [ - "test_bam.vcf.gz", - "test_bam.vcf.gz.tbi", - [ - "versions.yml:md5,2528212fed975c92514cf6641379e878" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:20:09.342159899" - }, - "homo_sapiens - [cram, crai, dragstr_model] - fasta - fai - dict - sites - sites_tbi": { - "content": [ - "test_cram_sites_dragstr.vcf.gz", - "test_cram_sites_dragstr.vcf.gz.tbi", - [ - "versions.yml:md5,2528212fed975c92514cf6641379e878" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:21:06.551678783" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test b/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test deleted file mode 100644 index 33bf46fbf1..0000000000 --- a/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test +++ /dev/null @@ -1,58 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_INTERVALLISTTOBED" - script "../main.nf" - process "GATK4_INTERVALLISTTOBED" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/intervallisttobed" - - test("homo sapiens - bed") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list", checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo sapiens - bed - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list", checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap b/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap deleted file mode 100644 index 0664f5e913..0000000000 --- a/modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap +++ /dev/null @@ -1,72 +0,0 @@ -{ - "homo sapiens - bed": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,9046675d01199fbbee79f2bc1c5dce52" - ] - ], - "1": [ - "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" - ], - "bed": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,9046675d01199fbbee79f2bc1c5dce52" - ] - ], - "versions": [ - "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-04T13:44:42.715318379" - }, - "homo sapiens - bed - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" - ], - "bed": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,27876d5035fa3f6d4750152ed4033259" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-04T13:45:01.440631153" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test b/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test deleted file mode 100644 index bffe02e4f6..0000000000 --- a/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test +++ /dev/null @@ -1,38 +0,0 @@ - -nextflow_process { - - name "Test Process GATK4_LEARNREADORIENTATIONMODEL" - script "../main.nf" - process "GATK4_LEARNREADORIENTATIONMODEL" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/learnreadorientationmodel" - - test("test-gatk4-learnreadorientationmodel") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.f1r2.tar.gz', checkIfExists: true)] ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - path(process.out.artifactprior[0][1]).linesGzip[3..7], - process.out.versions - ).match() - } - ) - } - } - -} diff --git a/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap b/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap deleted file mode 100644 index 638e058359..0000000000 --- a/modules/nf-core/gatk4/learnreadorientationmodel/tests/main.nf.test.snap +++ /dev/null @@ -1,21 +0,0 @@ -{ - "test-gatk4-learnreadorientationmodel": { - "content": [ - [ - "CTT\tAAG\t2.7114986684474486E-6\t3.2076972826656866E-5\t2.6085822355549755E-6\t0.0\t2.6371799896540086E-6\t3.3869355267901446E-6\t2.6085822355549755E-6\t0.0\t0.9995881552107633\t4.6590850211691583E-5\t2.8848017683240004E-4\t3.0744010710100574E-5\t38334\t116", - "GTT\tAAC\t0.1\t0.1\t0.1\t0.0\t0.1\t0.1\t0.1\t0.0\t0.1\t0.1\t0.1\t0.1\t0\t0", - "TAT\tATA\t0.0\t5.548307163536064E-6\t5.144357865084592E-6\t6.205892051757818E-6\t0.0\t5.907388162200423E-6\t5.176730417709638E-6\t6.083872804985981E-6\t0.9924019419831304\t3.946972069386949E-5\t0.007516612822150651\t7.908925559851714E-6\t19439\t95", - "AAA\tTTT\t0.0\t1.7634470563520664E-6\t2.8327478284981175E-6\t1.8084237600021914E-6\t0.0\t1.7692606885284446E-6\t2.263339968296726E-6\t1.8660094002474611E-6\t0.9990845693211764\t1.8004690536795885E-5\t8.701192700921183E-4\t1.5003489492700572E-5\t56708\t130", - "CAA\tTTG\t0.0\t3.4445551925564533E-6\t3.435193155024585E-6\t5.139879646597498E-6\t0.0\t3.4674461103560476E-6\t3.428570449688764E-6\t6.343168047383713E-6\t0.9945238954147358\t1.3629167993931722E-4\t0.0052793454402581125\t3.5208652465150646E-5\t29263\t197" - ], - [ - "versions.yml:md5,e8e087001bd49c02f325e90b1fbeb44d" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:24:53.596350009" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/learnreadorientationmodel/tests/nextflow.config b/modules/nf-core/gatk4/learnreadorientationmodel/tests/nextflow.config deleted file mode 100644 index 79e4f67df3..0000000000 --- a/modules/nf-core/gatk4/learnreadorientationmodel/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4_LEARNREADORIENTATIONMODEL { - ext.prefix = { "${meta.id}.artifact-prior" } - } -} diff --git a/modules/nf-core/gatk4/markduplicates/tests/bam.config b/modules/nf-core/gatk4/markduplicates/tests/bam.config deleted file mode 100644 index 0bbfbac353..0000000000 --- a/modules/nf-core/gatk4/markduplicates/tests/bam.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - withName: GATK4_MARKDUPLICATES { - ext.args = '--CREATE_INDEX true' - ext.prefix = { "${meta.id}.bam" } - } - -} diff --git a/modules/nf-core/gatk4/markduplicates/tests/cram.config b/modules/nf-core/gatk4/markduplicates/tests/cram.config deleted file mode 100644 index 04a9b0745a..0000000000 --- a/modules/nf-core/gatk4/markduplicates/tests/cram.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - withName: GATK4_MARKDUPLICATES { - ext.args = '--CREATE_INDEX true' - ext.prefix = { "${meta.id}.cram" } - } - -} diff --git a/modules/nf-core/gatk4/markduplicates/tests/main.nf.test b/modules/nf-core/gatk4/markduplicates/tests/main.nf.test deleted file mode 100644 index bbcf74db67..0000000000 --- a/modules/nf-core/gatk4/markduplicates/tests/main.nf.test +++ /dev/null @@ -1,126 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_MARKDUPLICATES" - script "../main.nf" - process "GATK4_MARKDUPLICATES" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/markduplicates" - - test("sarscov2 - bam") { - config "./bam.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.bam).match("bam") }, - { assert snapshot(process.out.bai).match("bai") }, - { assert snapshot(process.out.versions).match("versions") }, - { assert snapshot(file(process.out.metrics[0][1]).name).match("test.metrics") } - ) - } - } - - test("homo_sapiens - multiple bam") { - config "./bam.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) - ] - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.bam).match("multi bam") }, - { assert snapshot(process.out.bai).match("multi bai") }, - { assert snapshot(process.out.versions).match("multi versions") }, - { assert snapshot(file(process.out.metrics[0][1]).name).match("multi test.metrics") } - ) - } - - } - - test("homo_sapiens - multiple cram") { - config "./cram.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(file(process.out.cram[0][1]).name).match("multi cram")}, - { assert snapshot(file(process.out.crai[0][1]).name).match("multi crai") }, - { assert snapshot(process.out.versions).match("multi cram versions") }, - { assert snapshot(file(process.out.metrics[0][1]).name).match("multi cram test.metrics") } - ) - } - - } - - test("stub") { - config "./bam.config" - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [] - ] - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/markduplicates/tests/main.nf.test.snap b/modules/nf-core/gatk4/markduplicates/tests/main.nf.test.snap deleted file mode 100644 index 336bb3735b..0000000000 --- a/modules/nf-core/gatk4/markduplicates/tests/main.nf.test.snap +++ /dev/null @@ -1,160 +0,0 @@ -{ - "multi bam": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,8a808b1a94d2627c4d659a2151c4cb9f" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-02-13T15:21:36.059923" - }, - "multi crai": { - "content": [ - "test.cram.crai" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-12T17:43:37.780426007" - }, - "multi bai": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.bai:md5,38b99c5f771895ecf5324c3186b9d452" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-02-13T15:21:36.09642" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,c58bf16c6e3786cc4d17bb7249f9ffe5" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-02-13T15:21:08.710549" - }, - "multi test.metrics": { - "content": [ - "test.bam.metrics" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-12T17:43:11.732892667" - }, - "bai": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.bai:md5,26001bcdbce12e9f07557d8f7b8d360e" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-12T17:42:39.651888758" - }, - "multi cram versions": { - "content": [ - [ - "versions.yml:md5,c58bf16c6e3786cc4d17bb7249f9ffe5" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-02-13T15:21:56.966376" - }, - "multi versions": { - "content": [ - [ - "versions.yml:md5,c58bf16c6e3786cc4d17bb7249f9ffe5" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-02-13T15:21:36.138095" - }, - "multi cram test.metrics": { - "content": [ - "test.cram.metrics" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-12T17:43:37.798977444" - }, - "multi cram": { - "content": [ - "test.cram" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-12T17:43:37.771137858" - }, - "bam": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,75d914ba8804eaf2acf02ab432197ec9" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-02-13T15:21:08.645892" - }, - "test.metrics": { - "content": [ - "test.bam.metrics" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2023-12-12T17:42:39.672508385" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test b/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test deleted file mode 100644 index 5f5ab40233..0000000000 --- a/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test +++ /dev/null @@ -1,57 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_MERGEMUTECTSTATS" - script "../main.nf" - process "GATK4_MERGEMUTECTSTATS" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/mergemutectstats" - - test("human - stats, tsv") { - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.stats', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.versions).match("versions") }, - { assert snapshot(file(process.out.stats.get(0).get(1)).readLines()[0]).match() } - ) - } - - } - - test("human - stats,tsv - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/paired_mutect2_calls/test_test2_paired_mutect2_calls.vcf.gz.stats', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap b/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap deleted file mode 100644 index 77da5d7820..0000000000 --- a/modules/nf-core/gatk4/mergemutectstats/tests/main.nf.test.snap +++ /dev/null @@ -1,59 +0,0 @@ -{ - "versions": { - "content": [ - [ - "versions.yml:md5,2b6e8361dd6734be029e7480dbcb7794" - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:29:44.84165293" - }, - "human - stats,tsv - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.vcf.gz.stats:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,2b6e8361dd6734be029e7480dbcb7794" - ], - "stats": [ - [ - { - "id": "test", - "single_end": false - }, - "test.vcf.gz.stats:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,2b6e8361dd6734be029e7480dbcb7794" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-10-31T11:29:54.48600467" - }, - "human - stats, tsv": { - "content": [ - "statistic\tvalue" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-05-16T10:13:56.262881" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test b/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test deleted file mode 100644 index 343fff68c9..0000000000 --- a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test +++ /dev/null @@ -1,90 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_MERGEVCFS" - script "../main.nf" - process "GATK4_MERGEVCFS" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/mergevcfs" - - test("test_gatk4_mergevcfs") { - when { - process { - """ - input[0] = [ [ id:'test' ], [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) ]] - input[1] = [ [], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)] - """ - } - } - - then { - assertAll( - { assert process.success }, - { - assert snapshot( - process.out.versions, - file(process.out.vcf.get(0).get(1)).name, - file(process.out.tbi.get(0).get(1)).name - ).match("test_gatk4_mergevcfs") - }, - ) - } - - } - - test("test_gatk4_mergevcfs_no_dict") { - when { - process { - """ - input[0] = [ [ id:'test' ], [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) ]] - input[1] = [ [],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { - assert snapshot( - process.out.versions, - file(process.out.vcf.get(0).get(1)).name, - file(process.out.tbi.get(0).get(1)).name - ).match("test_gatk4_mergevcfs_no_dict") - }, - ) - } - - } - - test("test_gatk4_mergevcfs_no_dict_stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) ]] - input[1] = [ [],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { - assert snapshot( - process.out.versions, - file(process.out.vcf.get(0).get(1)).name, - file(process.out.tbi.get(0).get(1)).name - ).match("test_gatk4_mergevcfs_no_dict_stub") - }, - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap b/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap deleted file mode 100644 index 5fab6dca1b..0000000000 --- a/modules/nf-core/gatk4/mergevcfs/tests/main.nf.test.snap +++ /dev/null @@ -1,44 +0,0 @@ -{ - "test_gatk4_mergevcfs_no_dict_stub": { - "content": [ - [ - "versions.yml:md5,829a91432cc945f3227b1355587d25e0" - ], - "test.vcf.gz", - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-07T08:29:25.813956308" - }, - "test_gatk4_mergevcfs": { - "content": [ - [ - "versions.yml:md5,829a91432cc945f3227b1355587d25e0" - ], - "test.vcf.gz", - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-07T08:28:42.580265083" - }, - "test_gatk4_mergevcfs_no_dict": { - "content": [ - [ - "versions.yml:md5,829a91432cc945f3227b1355587d25e0" - ], - "test.vcf.gz", - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-07T08:29:12.795329336" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/mutect2/tests/main.nf.test b/modules/nf-core/gatk4/mutect2/tests/main.nf.test deleted file mode 100644 index b0e22144c6..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/main.nf.test +++ /dev/null @@ -1,375 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_MUTECT2" - script "../main.nf" - process "GATK4_MUTECT2" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/mutect2" - config "./nextflow.config" - - test("human - bam - tumor_normal_pair") { - when { - params { - module_args = "--normal-sample normal" - } - process { - """ - input[0] = [ - [ - id:'test', - normal_id:'normal', - tumor_id:'tumour' - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true) - ], - [] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - input[6] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz', checkIfExists: true) - input[7] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz.tbi', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { - assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats, - process.out.f1r2, - process.out.versions, - ).match() - } - ) - } - } - - test("human - bam - tumor_normal_pair_f1r2") { - - when { - params { - module_args = "--normal-sample normal --f1r2-tar-gz test.f1r2.tar.gz" - } - process { - """ - input[0] = [ - [ - id:'test', - normal_id:'normal', - tumor_id:'tumour' - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true) - ], - [] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - input[6] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz', checkIfExists: true) - input[7] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz.tbi', checkIfExists: true) - """ - } - } - then { - assertAll( - { assert process.success }, - { - assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats, - process.out.f1r2.collect { file(it[1]).getName() }, - process.out.versions - ).match() - } - ) - } - } - test("human - bam - tumor_only"){ - when { - params { - module_args = '' - } - process { - """ - input[0] = [ - [ id:'test'], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true)], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true)], - [] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - input[6] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz', checkIfExists: true) - input[7] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz.tbi', checkIfExists: true) - """ - } - } - then { - assertAll( - { assert process.success }, - { - assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats, - process.out.f1r2, - process.out.versions - ).match() - } - ) - } - } - test("human - cram"){ - when { - params { - module_args = '' - } - process{ - """ - input[0] = [ - [ id:'test'], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true)], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true)], - [] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - input[6] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz', checkIfExists: true) - input[7] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz.tbi', checkIfExists: true) - """ - } - } - then { - assertAll( - { assert process.success }, - { - assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats, - process.out.f1r2, - process.out.versions - ).match() - } - ) - } - } - - test("human - bam - generate_pon") { - when { - params { - module_args = '' - } - process { - """ - input[0] = [ - [ id:'test'], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true)], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true)], - [] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = [] - input[5] = [] - input[6] = [] - input[7] = [] - """ - } - } - then { - assertAll( - { assert process.success }, - { - assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats, - process.out.f1r2, - process.out.versions - ).match() - } - ) - } - } - - test("mitochondria - bam"){ - when { - params { - module_args = "--mitochondria-mode" - } - process { - """ - input[0] = [ - [ id:'test'], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/mitochon_standin.recalibrated.sorted.bam', checkIfExists: true)], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/mitochon_standin.recalibrated.sorted.bam.bai', checkIfExists: true)], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true)] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - ] - input[4] = [] - input[5] = [] - input[6] = [] - input[7] = [] - """ - } - } - then { - assertAll( - { assert process.success }, - { - assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.tbi.collect { file(it[1]).getName() }, - process.out.stats, - process.out.f1r2, - process.out.versions - ).match() - } - ) - } - } - - test("human - bam - tumor_normal_pair_f1r2 - stub"){ - - options "-stub" - - when { - params { - module_args = '' - } - process { - """ - input[0] = [ - [ - id:'test', - normal_id:'normal', - tumor_id:'tumour' - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true) - ], - [] - ] - input[1] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [ - [ id:'genome' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.dict', checkIfExists: true) - ] - input[4] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz', checkIfExists: true) - input[5] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/gnomAD.r2.1.1.vcf.gz.tbi', checkIfExists: true) - input[6] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz', checkIfExists: true) - input[7] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/mills_and_1000G.indels.hg38.vcf.gz.tbi', checkIfExists: true) - """ - } - } - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap b/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap deleted file mode 100644 index 80d07bccbe..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/main.nf.test.snap +++ /dev/null @@ -1,265 +0,0 @@ -{ - "human - bam - generate_pon": { - "content": [ - "876aa6be01c0c8fc71ad8e99ed842240", - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.stats:md5,b569ce66bbffe9588b3d221e821023ee" - ] - ], - [ - - ], - [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T15:44:32.616294519" - }, - "human - cram": { - "content": [ - "1b65f1a163b517944bf2e4b74230e035", - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.stats:md5,55ed641e16089afb33cdbc478e202d3d" - ] - ], - [ - - ], - [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T15:42:27.117032089" - }, - "mitochondria - bam": { - "content": [ - "ea70f79e33805a2c0b47b32a48a8d26f", - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.stats:md5,fc6ea14ca2da346babe78161beea28c9" - ] - ], - [ - - ], - [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T15:44:46.867520687" - }, - "human - bam - tumor_normal_pair": { - "content": [ - "7418ed45a029394253817a5eb7149334", - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.stats:md5,17d2091015d04cbd4a26b7a67dc659e6" - ] - ], - [ - - ], - [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T16:02:48.334206829" - }, - "human - bam - tumor_only": { - "content": [ - "1b65f1a163b517944bf2e4b74230e035", - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.stats:md5,55ed641e16089afb33cdbc478e202d3d" - ] - ], - [ - - ], - [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T15:40:12.534802185" - }, - "human - bam - tumor_normal_pair_f1r2 - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.stats:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.f1r2.tar.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "4": [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ], - "f1r2": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.f1r2.tar.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "stats": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.stats:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T15:44:59.443047344" - }, - "human - bam - tumor_normal_pair_f1r2": { - "content": [ - "7418ed45a029394253817a5eb7149334", - [ - "test.vcf.gz.tbi" - ], - [ - [ - { - "id": "test", - "normal_id": "normal", - "tumor_id": "tumour" - }, - "test.vcf.gz.stats:md5,17d2091015d04cbd4a26b7a67dc659e6" - ] - ], - [ - "test.f1r2.tar.gz" - ], - [ - "versions.yml:md5,8b99605d0a404d9ccbf8628ca881a8a4" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-08T16:25:12.434872797" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/mutect2/tests/nextflow.config b/modules/nf-core/gatk4/mutect2/tests/nextflow.config deleted file mode 100644 index 08e9428517..0000000000 --- a/modules/nf-core/gatk4/mutect2/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4_MUTECT2 { - ext.args = params.module_args - } -} diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/AS.config b/modules/nf-core/gatk4/variantrecalibrator/tests/AS.config deleted file mode 100644 index eadb336e9d..0000000000 --- a/modules/nf-core/gatk4/variantrecalibrator/tests/AS.config +++ /dev/null @@ -1,7 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - withName: GATK4_VARIANTRECALIBRATOR { - ext.args = '-mode SNP -an QD -an MQ -an FS -AS' - } -} diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test b/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test deleted file mode 100644 index 2ce4b46e53..0000000000 --- a/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test +++ /dev/null @@ -1,167 +0,0 @@ -nextflow_process { - - name "Test Process GATK4_VARIANTRECALIBRATOR" - script "../main.nf" - process "GATK4_VARIANTRECALIBRATOR" - - tag "modules" - tag "modules_nfcore" - tag "gatk4" - tag "gatk4/variantrecalibrator" - - test("homo sapiens - vcf - allele specificity") { - config "./AS.config" - when { - process { - """ - input_vcf = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi", checkIfExists: true) - ] - - resources_vcf = [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz", checkIfExists: true) - ] - resources_tbi = [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi", checkIfExists: true) - ] - labels = [ - '--resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.hg38.vcf.gz', - '--resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.hg38.vcf.gz', - '--resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.hg38.vcf.gz', - '--resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp_138.hg38.vcf.gz' - ] - - fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta", checkIfExists: true) - fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) - dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.dict", checkIfExists: true) - - input = [input_vcf, resources_vcf, resources_tbi, labels, fasta, fai, dict] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.recal[0][1]).name, - file(process.out.idx[0][1]).name, - process.out.tranches, - process.out.plots, - ).match() } - ) - } - - } - - test("homo sapiens - vcf - no allele specificity") { - config "./noAS.config" - when { - process { - """ - input_vcf = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi", checkIfExists: true) - ] - - resources_vcf = [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz", checkIfExists: true) - ] - resources_tbi = [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi", checkIfExists: true) - ] - labels = [ - '--resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.hg38.vcf.gz', - '--resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.hg38.vcf.gz', - '--resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.hg38.vcf.gz', - '--resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp_138.hg38.vcf.gz' - ] - - fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta", checkIfExists: true) - fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) - dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.dict", checkIfExists: true) - - input = [input_vcf, resources_vcf, resources_tbi, labels, fasta, fai, dict] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.recal[0][1]).name, - file(process.out.idx[0][1]).name, - process.out.tranches, - process.out.plots, - ).match() } - ) - } - - } - - test("homo sapiens - vcf - stub") { - - options "-stub" - - when { - process { - """ - input_vcf = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test2_haplotc.ann.vcf.gz.tbi", checkIfExists: true) - ] - - resources_vcf = [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz", checkIfExists: true) - ] - resources_tbi = [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/hapmap_3.3.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_omni2.5.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/1000G_phase1.snps.hg38.vcf.gz.tbi", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi", checkIfExists: true) - ] - labels = [ - '--resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.hg38.vcf.gz', - '--resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.hg38.vcf.gz', - '--resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.hg38.vcf.gz', - '--resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp_138.hg38.vcf.gz' - ] - - fasta = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta", checkIfExists: true) - fai = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) - dict = file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.dict", checkIfExists: true) - - input = [input_vcf, resources_vcf, resources_tbi, labels, fasta, fai, dict] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap b/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap deleted file mode 100644 index 62882f25fa..0000000000 --- a/modules/nf-core/gatk4/variantrecalibrator/tests/main.nf.test.snap +++ /dev/null @@ -1,133 +0,0 @@ -{ - "homo sapiens - vcf - allele specificity": { - "content": [ - [ - "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" - ], - "test.recal", - "test.recal.idx", - [ - [ - { - "id": "test" - }, - "test.tranches:md5,ad52fa69325c758f458a30ee5b43d6b5" - ] - ], - [ - - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-06T10:19:03.416258473" - }, - "homo sapiens - vcf - no allele specificity": { - "content": [ - [ - "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" - ], - "test.recal", - "test.recal.idx", - [ - [ - { - "id": "test" - }, - "test.tranches:md5,c029e52fd63a893e1154cc9144a19eeb" - ] - ], - [ - - ] - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-06T10:26:53.032044124" - }, - "homo sapiens - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.recal:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.idx:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.tranches:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "testplots.R:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" - ], - "idx": [ - [ - { - "id": "test" - }, - "test.idx:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "plots": [ - [ - { - "id": "test" - }, - "testplots.R:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "recal": [ - [ - { - "id": "test" - }, - "test.recal:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tranches": [ - [ - { - "id": "test" - }, - "test.tranches:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,fb9c98d8bd2f8335179f7c037c63bb0d" - ] - } - ], - "meta": { - "nf-test": "0.9.1", - "nextflow": "24.10.0" - }, - "timestamp": "2024-11-06T10:14:43.858797367" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config b/modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config deleted file mode 100644 index 69efa09ea8..0000000000 --- a/modules/nf-core/gatk4/variantrecalibrator/tests/noAS.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - - withName: GATK4_VARIANTRECALIBRATOR { - ext.args = '-mode SNP -an QD -an MQ -an FS -an SOR' - } -} diff --git a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test b/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test deleted file mode 100644 index 25284c769c..0000000000 --- a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test +++ /dev/null @@ -1,197 +0,0 @@ -nextflow_process { - - name "Test Process GATK4SPARK_APPLYBQSR" - script "../main.nf" - config "./nextflow.config" - process "GATK4SPARK_APPLYBQSR" - - tag "modules" - tag "modules_nfcore" - tag "gatk4spark" - tag "gatk4spark/applybqsr" - - test("sarscov2 - bam") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam - stub") { - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [], - [], - [], - [] - ] - input[1] = [] - input[2] = [] - input[3] = [] - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - - test("sarscov2 - bam intervals") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam intervals -stub") { - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - cram") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - cram -stub") { - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/test.baserecalibrator.table', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } -} diff --git a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap b/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap deleted file mode 100644 index cd2a088c73..0000000000 --- a/modules/nf-core/gatk4spark/applybqsr/tests/main.nf.test.snap +++ /dev/null @@ -1,296 +0,0 @@ -{ - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ] - }, - { - "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:56:27.915627809" - }, - "sarscov2 - cram": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram:md5,133213fe1e49e30f796e1eb836fb6611" - ] - ], - "2": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ], - "bam": [ - - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,133213fe1e49e30f796e1eb836fb6611" - ] - ], - "versions": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ] - }, - { - "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:57:42.699756036" - }, - "sarscov2 - cram -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ] - }, - { - "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:57:58.189642524" - }, - "sarscov2 - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,1901c819fcba0fdd5e2482e6dc8285ef" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,1901c819fcba0fdd5e2482e6dc8285ef" - ] - ], - "cram": [ - - ], - "versions": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ] - }, - { - "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:56:13.425170564" - }, - "sarscov2 - bam intervals": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,2ca2446f0125890280056fd7da822732" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,2ca2446f0125890280056fd7da822732" - ] - ], - "cram": [ - - ], - "versions": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ] - }, - { - "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:56:55.562307069" - }, - "sarscov2 - bam intervals -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ], - "bam": [ - [ - { - "id": "test" - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,985dcafacddb7013ec01b73fd9163290" - ] - }, - { - "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:57:11.97218192" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4spark/applybqsr/tests/nextflow.config b/modules/nf-core/gatk4spark/applybqsr/tests/nextflow.config deleted file mode 100644 index 85142680d8..0000000000 --- a/modules/nf-core/gatk4spark/applybqsr/tests/nextflow.config +++ /dev/null @@ -1 +0,0 @@ -docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64 -e "HOME=${HOME}" -v /etc/passwd:/etc/passwd:ro -v /etc/shadow:/etc/shadow:ro -v /etc/group:/etc/group:ro -v $HOME:$HOME' diff --git a/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test b/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test deleted file mode 100644 index 6bb4d9dd01..0000000000 --- a/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test +++ /dev/null @@ -1,268 +0,0 @@ -nextflow_process { - - name "Test Process GATK4SPARK_BASERECALIBRATOR" - script "../main.nf" - config "./nextflow.config" - process "GATK4SPARK_BASERECALIBRATOR" - - tag "modules" - tag "modules_nfcore" - tag "gatk4spark" - tag "gatk4spark/baserecalibrator" - - test("sarscov2 - bam") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) - input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo sapiens - cram") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true)) - input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true)) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam - intervals") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) - input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam - multi sites") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) - ]) - input[5] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ]) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam -stub") { - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) - input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo sapiens - cram -stub") { - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz', checkIfExists: true)) - input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gatk/haplotypecaller_calls/test_haplotcaller.cnn.vcf.gz.tbi', checkIfExists: true)) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam - intervals -stub") { - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)) - input[5] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true)) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam - multi sites -stub") { - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ]) - input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) - input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)) - input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true)) - input[4] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz', checkIfExists: true) - ]) - input[5] = Channel.of([ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf.gz.tbi', checkIfExists: true) - ]) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } -} diff --git a/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap b/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap deleted file mode 100644 index 28394ad3db..0000000000 --- a/modules/nf-core/gatk4spark/baserecalibrator/tests/main.nf.test.snap +++ /dev/null @@ -1,306 +0,0 @@ -{ - "sarscov2 - bam - intervals -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:00:38.617564388" - }, - "sarscov2 - bam - multi sites": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:59:50.213616922" - }, - "homo sapiens - cram": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,ab82f81e027d8762b01c631b4ef792c0" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,ab82f81e027d8762b01c631b4ef792c0" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:58:59.091441241" - }, - "sarscov2 - bam - intervals": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,9ecb5f00a2229291705addc09c0ec231" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,9ecb5f00a2229291705addc09c0ec231" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:59:24.000377035" - }, - "sarscov2 - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,e2e43abdc0c943c1a54dae816d0b9ea7" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T14:58:25.814297279" - }, - "sarscov2 - bam - multi sites -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:00:55.024158381" - }, - "sarscov2 - bam -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:00:05.696488985" - }, - "homo sapiens - cram -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ], - "table": [ - [ - { - "id": "test" - }, - "test.table:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,d98a4e7d4b5c7b7c59268214c538bd58" - ] - }, - { - "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:00:21.556918585" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config b/modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config deleted file mode 100644 index a1a17be887..0000000000 --- a/modules/nf-core/gatk4spark/baserecalibrator/tests/nextflow.config +++ /dev/null @@ -1,2 +0,0 @@ -docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64 -e "HOME=${HOME}" -v /etc/passwd:/etc/passwd:ro -v /etc/shadow:/etc/shadow:ro -v /etc/group:/etc/group:ro -v $HOME:$HOME' - diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/bam.config b/modules/nf-core/gatk4spark/markduplicates/tests/bam.config deleted file mode 100644 index 7135842481..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/bam.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4SPARK_MARKDUPLICATES { - ext.prefix = { "${meta.id}.bam" } - } -} diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/cram.config b/modules/nf-core/gatk4spark/markduplicates/tests/cram.config deleted file mode 100644 index 03f3302b06..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/cram.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: GATK4SPARK_MARKDUPLICATES { - ext.prefix = { "${meta.id}.cram" } - } -} diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test b/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test deleted file mode 100644 index 40dbb713a0..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test +++ /dev/null @@ -1,263 +0,0 @@ -nextflow_process { - - name "Test Process GATK4SPARK_MARKDUPLICATES" - script "../main.nf" - config "./nextflow.config" - process "GATK4SPARK_MARKDUPLICATES" - - tag "modules" - tag "modules_nfcore" - tag "gatk4spark" - tag "gatk4spark/markduplicates" - - test("sarscov2 - bam") { - config "./bam.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo_sapiens - bam - multiple") { - config "./bam.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo_sapiens - bam - metrics") { - config "./metrics.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out.versions, - process.out.output, - process.out.bam_index, - path(process.out.metrics[0][1]).readLines()[5], - path(process.out.metrics[0][1]).readLines().size(), - path(process.out.versions[0]).yaml - ) - } - ) - } - } - - test("homo_sapiens - cram") { - config "./cram.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - bam -stub") { - options "-stub" - config "./bam.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo_sapiens - bam - multiple -stub") { - options "-stub" - config "./bam.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo_sapiens - bam - metrics -stub") { - options "-stub" - config "./metrics.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("homo_sapiens - cram -stub") { - options "-stub" - config "./cram.config" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.name.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.name.sorted.bam', checkIfExists: true) - ] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - input[3] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.dict', checkIfExists: true) - """ - } - } - - then { - assert process.success - assertAll( - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } -} diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap b/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap deleted file mode 100644 index 1482578a1c..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/main.nf.test.snap +++ /dev/null @@ -1,486 +0,0 @@ -{ - "homo_sapiens - bam - multiple": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,1154a16717d430199f3e9994a87b546a" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d947dccacf3fb7fcf174d364a5f7856d" - ] - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d947dccacf3fb7fcf174d364a5f7856d" - ] - ], - "metrics": [ - - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,1154a16717d430199f3e9994a87b546a" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:01:54.825208573" - }, - "homo_sapiens - cram": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram:md5,e3bcab34b141b0838cd9b6b779e09a7a" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - - ], - "metrics": [ - - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram:md5,e3bcab34b141b0838cd9b6b779e09a7a" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:03:51.19014784" - }, - "homo_sapiens - bam - metrics -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "metrics": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:05:23.678812172" - }, - "homo_sapiens - bam - multiple -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "metrics": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:04:49.498784821" - }, - "homo_sapiens - cram -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "metrics": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:05:56.744218653" - }, - "sarscov2 - bam": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,dc1a09ac6371aab7c50d1a554baa06d3" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,253c47e57247a2cee11afcbb414122a4" - ] - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,253c47e57247a2cee11afcbb414122a4" - ] - ], - "metrics": [ - - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,dc1a09ac6371aab7c50d1a554baa06d3" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:01:22.411041697" - }, - "sarscov2 - bam -stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ], - "bam_index": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "metrics": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "output": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1184eb9fbc4a9cb7384b760b2c112c94" - ] - }, - { - "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.6.1.0" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-11T15:04:15.984302135" - } -} \ No newline at end of file diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/metrics.config b/modules/nf-core/gatk4spark/markduplicates/tests/metrics.config deleted file mode 100644 index b3710223c1..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/metrics.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - withName: GATK4SPARK_MARKDUPLICATES { - ext.args = '--metrics-file test.metrics' - ext.prefix = { "${meta.id}.bam" } - } -} diff --git a/modules/nf-core/gatk4spark/markduplicates/tests/nextflow.config b/modules/nf-core/gatk4spark/markduplicates/tests/nextflow.config deleted file mode 100644 index 85142680d8..0000000000 --- a/modules/nf-core/gatk4spark/markduplicates/tests/nextflow.config +++ /dev/null @@ -1 +0,0 @@ -docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64 -e "HOME=${HOME}" -v /etc/passwd:/etc/passwd:ro -v /etc/shadow:/etc/shadow:ro -v /etc/group:/etc/group:ro -v $HOME:$HOME' diff --git a/modules/nf-core/gawk/tests/main.nf.test b/modules/nf-core/gawk/tests/main.nf.test deleted file mode 100644 index 54462271dd..0000000000 --- a/modules/nf-core/gawk/tests/main.nf.test +++ /dev/null @@ -1,198 +0,0 @@ -nextflow_process { - - name "Test Process GAWK" - script "../main.nf" - process "GAWK" - - tag "modules" - tag "modules_nfcore" - tag "gawk" - - config "./nextflow.config" - - test("Convert fasta to bed") { - when { - params { - gawk_suffix = "bed" - gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }\'' - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[1] = [] - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Convert fasta to bed with program file") { - when { - params { - gawk_suffix = "bed" - gawk_args2 = "" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[1] = Channel.of('BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }').collectFile(name:"program.awk") - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Convert fasta to bed using awk redirect instead of shell redirect") { - when { - params { - gawk_suffix = "bed" - gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 > "test.bed" }\'' - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[1] = [] - input[2] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Extract first column from multiple files") { - when { - params { - gawk_suffix = "bed" - gawk_args2 = "" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [file(params.modules_testdata_base_path + 'generic/txt/hello.txt', checkIfExists: true), - file(params.modules_testdata_base_path + 'generic/txt/species_names.txt', checkIfExists: true)] - ] - input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.awk") - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Unzip files before processing") { - when { - params { - gawk_suffix = "bed" - gawk_args2 = "" - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/NA12878_chrM.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/NA24385_sv.vcf.gz', checkIfExists: true)] - ] - input[1] = Channel.of('/^#CHROM/ { print \$1, \$10 }').collectFile(name:"column_header.awk") - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Compress after processing") { - when { - params { - gawk_suffix = "txt.gz" - gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }\'' - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - input[1] = [] - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Input and output files are similar") { - when { - params { - gawk_suffix = "txt" - gawk_args = "" - gawk_args2 = "" - } - process { - """ - input[0] = [ - [ id:'hello' ], // meta map - [file(params.modules_testdata_base_path + 'generic/txt/hello.txt', checkIfExists: true), - file(params.modules_testdata_base_path + 'generic/txt/species_names.txt', checkIfExists: true)] - ] - input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.awk") - input[2] = false - """ - } - } - - then { - assertAll( - { assert process.failed }, - { assert process.errorReport.contains("Input and output names are the same, set prefix in module configuration to disambiguate!") } - ) - } - } -} \ No newline at end of file diff --git a/modules/nf-core/gawk/tests/main.nf.test.snap b/modules/nf-core/gawk/tests/main.nf.test.snap deleted file mode 100644 index d8e8ac755d..0000000000 --- a/modules/nf-core/gawk/tests/main.nf.test.snap +++ /dev/null @@ -1,200 +0,0 @@ -{ - "Compress after processing": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.txt.gz:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "1": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ], - "output": [ - [ - { - "id": "test" - }, - "test.txt.gz:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "versions": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.1" - }, - "timestamp": "2024-11-27T17:11:20.054143406" - }, - "Convert fasta to bed": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "1": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ], - "output": [ - [ - { - "id": "test" - }, - "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "versions": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-19T13:14:02.347809811" - }, - "Convert fasta to bed with program file": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "1": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ], - "output": [ - [ - { - "id": "test" - }, - "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "versions": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-19T13:14:11.894616209" - }, - "Extract first column from multiple files": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bed:md5,566c51674bd643227bb2d83e0963376d" - ] - ], - "1": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ], - "output": [ - [ - { - "id": "test" - }, - "test.bed:md5,566c51674bd643227bb2d83e0963376d" - ] - ], - "versions": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-19T22:04:47.729300129" - }, - "Unzip files before processing": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bed:md5,1e31ebd4a060aab5433bbbd9ab24e403" - ] - ], - "1": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ], - "output": [ - [ - { - "id": "test" - }, - "test.bed:md5,1e31ebd4a060aab5433bbbd9ab24e403" - ] - ], - "versions": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-19T22:08:19.533527657" - }, - "Convert fasta to bed using awk redirect instead of shell redirect": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "1": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ], - "output": [ - [ - { - "id": "test" - }, - "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" - ] - ], - "versions": [ - "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-05T08:31:09.88842854" - } -} \ No newline at end of file diff --git a/modules/nf-core/gawk/tests/nextflow.config b/modules/nf-core/gawk/tests/nextflow.config deleted file mode 100644 index 895709a763..0000000000 --- a/modules/nf-core/gawk/tests/nextflow.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - withName: GAWK { - ext.suffix = params.gawk_suffix - ext.args2 = params.gawk_args2 - } -} diff --git a/modules/nf-core/goleft/indexcov/tests/main.nf.test b/modules/nf-core/goleft/indexcov/tests/main.nf.test deleted file mode 100644 index 1296c644cd..0000000000 --- a/modules/nf-core/goleft/indexcov/tests/main.nf.test +++ /dev/null @@ -1,131 +0,0 @@ -nextflow_process { - - name "Test Process GOLEFT_INDEXCOV" - script "../main.nf" - process "GOLEFT_INDEXCOV" - - tag "modules" - tag "modules_nfcore" - tag "goleft" - tag "goleft/indexcov" - - test("sarscov2 - bam") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.sorted.bam", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai", checkIfExists: true) - ], - ]) - - input[1] = Channel.of( - [ - [:], - file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta.fai", checkIfExists: true) - ] - ) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.ped, - process.out.bed, - file(process.out.bed_index[0][1]).name, - process.out.roc, - process.out.html, - process.out.png, - process.out.versions - ).match() } - ) - } - - } - - - test("sarscov2 - crai") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram", checkIfExists: true) - ], - [ - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/cram/test.paired_end.markduplicates.sorted.cram.crai", checkIfExists: true), - file(params.modules_testdata_base_path + "genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai", checkIfExists: true) - ] - ]) - - input[1] = Channel.of( - [ - [:], - file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai", checkIfExists: true) - ] - ) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.ped, - process.out.bed, - file(process.out.bed_index[0][1]).name, - process.out.roc, - process.out.html, - process.out.png, - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [], - [] - ]) - - input[1] = Channel.of([ - [:], - [] - ]) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/goleft/indexcov/tests/main.nf.test.snap b/modules/nf-core/goleft/indexcov/tests/main.nf.test.snap deleted file mode 100644 index 1c79232db0..0000000000 --- a/modules/nf-core/goleft/indexcov/tests/main.nf.test.snap +++ /dev/null @@ -1,205 +0,0 @@ -{ - "sarscov2 - crai": { - "content": [ - [ - [ - { - "id": "test" - }, - "test-indexcov.ped:md5,8737714b6ea160e06d5282391f89f791" - ] - ], - [ - [ - { - "id": "test" - }, - "test-indexcov.bed.gz:md5,04aa3637cffca5d99316df7741c06589" - ] - ], - "test-indexcov.bed.gz.tbi", - [ - [ - { - "id": "test" - }, - "test-indexcov.roc:md5,548b76fdf16e97768b0c9b8ecbfd5bef" - ] - ], - [ - [ - { - "id": "test" - }, - [ - "index.html:md5,41840ede180b20cdf6074c431269929e", - "test-indexcov-depth-chr21.html:md5,4c839b03f2f41e3fdca5642903c35008", - "test-indexcov-roc-chr21.html:md5,f84b547328a23196f16f71d093eb7450" - ] - ] - ], - [ - [ - { - "id": "test" - }, - [ - "test-indexcov-depth-chr21.png:md5,1999b0bf1cd0680f6d107d438e7257cf", - "test-indexcov-roc-chr21.png:md5,41f1460535b255fff053da59fcccf698" - ] - ] - ], - [ - "versions.yml:md5,f9c06c1c05a2a31854b4e04e449a24c5" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-22T06:40:17.142801459" - }, - "sarscov2 - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - [ - "test-indexcov.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test-indexcov.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test-indexcov.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test-indexcov.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - - ], - "7": [ - "versions.yml:md5,f9c06c1c05a2a31854b4e04e449a24c5" - ], - "bed": [ - [ - { - "id": "test" - }, - "test-indexcov.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "bed_index": [ - [ - { - "id": "test" - }, - "test-indexcov.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "html": [ - - ], - "output": [ - [ - { - "id": "test" - }, - [ - "test-indexcov.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test-indexcov.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "ped": [ - - ], - "png": [ - - ], - "roc": [ - - ], - "versions": [ - "versions.yml:md5,f9c06c1c05a2a31854b4e04e449a24c5" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-22T06:44:59.203730744" - }, - "sarscov2 - bam": { - "content": [ - [ - [ - { - "id": "test" - }, - "test-indexcov.ped:md5,da2bd9882474d2f00f8ad2ab20b140c9" - ] - ], - [ - [ - { - "id": "test" - }, - "test-indexcov.bed.gz:md5,eab7a78287e261d600c06def12a33029" - ] - ], - "test-indexcov.bed.gz.tbi", - [ - [ - { - "id": "test" - }, - "test-indexcov.roc:md5,3f460308bb86203d1ada71b7c84d995d" - ] - ], - [ - [ - { - "id": "test" - }, - "index.html:md5,d1cc28023cd827446e0f9c905c94fe3e" - ] - ], - [ - - ], - [ - "versions.yml:md5,f9c06c1c05a2a31854b4e04e449a24c5" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-22T06:39:48.470187823" - } -} \ No newline at end of file diff --git a/modules/nf-core/lofreq/callparallel/tests/main.nf.test b/modules/nf-core/lofreq/callparallel/tests/main.nf.test deleted file mode 100644 index 31f199208b..0000000000 --- a/modules/nf-core/lofreq/callparallel/tests/main.nf.test +++ /dev/null @@ -1,109 +0,0 @@ -nextflow_process { - - name "Test Process LOFREQ_CALLPARALLEL" - script "../main.nf" - process "LOFREQ_CALLPARALLEL" - - tag "modules" - tag "modules_nfcore" - tag "lofreq" - tag "lofreq/callparallel" - - test("sarscov2 - bam") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [ [ id:'fasta' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'fai' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - process.out.tbi, - path(process.out.vcf[0][1]).vcf.summary - ).match() }, - ) - } - - } - - test("sarscov2 - bam - bed") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = [ [ id:'fasta' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'fai' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - process.out.tbi, - path(process.out.vcf[0][1]).vcf.summary - ).match() }, - ) - } - - } - - test("sarscov2 - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [ [ id:'fasta' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = [ [ id:'fai' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/lofreq/callparallel/tests/main.nf.test.snap b/modules/nf-core/lofreq/callparallel/tests/main.nf.test.snap deleted file mode 100644 index 11587f4ace..0000000000 --- a/modules/nf-core/lofreq/callparallel/tests/main.nf.test.snap +++ /dev/null @@ -1,93 +0,0 @@ -{ - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,1a60c330fb42841e8dcf3cd507a70bfc" - ] - ], - "2": [ - "versions.yml:md5,56d45e0015add277b2689f071a4fe3e4" - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,1a60c330fb42841e8dcf3cd507a70bfc" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,56d45e0015add277b2689f071a4fe3e4" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.0" - }, - "timestamp": "2024-08-28T12:01:24.268196316" - }, - "sarscov2 - bam": { - "content": [ - [ - "versions.yml:md5,56d45e0015add277b2689f071a4fe3e4" - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,4cb176febbc8c26d717a6c6e67b9c905" - ] - ], - "VcfFile [chromosomes=[], sampleCount=0, variantCount=0, phased=true, phasedAutodetect=true]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.0" - }, - "timestamp": "2024-08-28T14:14:55.381365088" - }, - "sarscov2 - bam - bed": { - "content": [ - [ - "versions.yml:md5,56d45e0015add277b2689f071a4fe3e4" - ], - [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,4cb176febbc8c26d717a6c6e67b9c905" - ] - ], - "VcfFile [chromosomes=[], sampleCount=0, variantCount=0, phased=true, phasedAutodetect=true]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.0" - }, - "timestamp": "2024-08-28T14:15:18.221515296" - } -} \ No newline at end of file diff --git a/modules/nf-core/manta/germline/tests/main.nf.test b/modules/nf-core/manta/germline/tests/main.nf.test deleted file mode 100644 index 1d49ad23a1..0000000000 --- a/modules/nf-core/manta/germline/tests/main.nf.test +++ /dev/null @@ -1,162 +0,0 @@ -nextflow_process { - - name "Test Process MANTA_GERMLINE" - script "../main.nf" - process "MANTA_GERMLINE" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "manta" - tag "manta/germline" - - test("human - cram") { - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [],[] - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = Channel.of("[manta]", "enableRemoteReadRetrievalForInsertionsInGermlineCallingModes = 0") - .collectFile(name:"manta_options.ini", newLine:true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.diploid_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("version") } - ) - } - - } - - test("human - cram - bed") { - - when { - process { - """ - input[0] = [ [ id:'bed_test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed.gz.tbi', checkIfExists: true) - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.diploid_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("bed_version") } - ) - } - - } - - test("human - cram - bed - jointcalling") { - - when { - process { - """ - input[0] = [ [ id:'bed_test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram', checkIfExists: true) - ], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram.crai', checkIfExists: true) - ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed.gz.tbi', checkIfExists: true) - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.diploid_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("joint_version") } - ) - } - - } - test("human - cram - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [],[] - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/manta/germline/tests/main.nf.test.snap b/modules/nf-core/manta/germline/tests/main.nf.test.snap deleted file mode 100644 index 79d5541e32..0000000000 --- a/modules/nf-core/manta/germline/tests/main.nf.test.snap +++ /dev/null @@ -1,139 +0,0 @@ -{ - "human - cram - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test" - }, - "test.diploid_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "5": [ - [ - { - "id": "test" - }, - "test.diploid_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - "versions.yml:md5,18070b443a26855ef64dafa179dfba01" - ], - "candidate_small_indels_vcf": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "candidate_small_indels_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "candidate_sv_vcf": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "candidate_sv_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diploid_sv_vcf": [ - [ - { - "id": "test" - }, - "test.diploid_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "diploid_sv_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.diploid_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,18070b443a26855ef64dafa179dfba01" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-21T17:54:09.788372" - }, - "joint_version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-21T15:03:07.745972" - }, - "bed_version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-21T13:49:38.745653" - }, - "version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-21T13:49:14.885769" - } -} \ No newline at end of file diff --git a/modules/nf-core/manta/germline/tests/nextflow.config b/modules/nf-core/manta/germline/tests/nextflow.config deleted file mode 100644 index 22acb24265..0000000000 --- a/modules/nf-core/manta/germline/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: MANTA_GERMLINE { - ext.args = '--exome ' - } -} diff --git a/modules/nf-core/manta/somatic/tests/main.nf.test b/modules/nf-core/manta/somatic/tests/main.nf.test deleted file mode 100644 index 121f13849f..0000000000 --- a/modules/nf-core/manta/somatic/tests/main.nf.test +++ /dev/null @@ -1,121 +0,0 @@ -nextflow_process { - - name "Test Process MANTA_SOMATIC" - script "../main.nf" - process "MANTA_SOMATIC" - - tag "modules" - tag "modules_nfcore" - tag "manta" - tag "manta/somatic" - - test("human - cram") { - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [], [] - ] - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = Channel.of("[manta]", "enableRemoteReadRetrievalForInsertionsInGermlineCallingModes = 0") - .collectFile(name:"manta_options.ini", newLine:true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.diploid_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.somatic_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("version") } - ) - } - - } - - test("human - cram - bed") { - - when { - process { - """ - input[0] = [ [ id:'bed_test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi', checkIfExists: true) - ] - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.diploid_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.somatic_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("bed_version") } - ) - } - - } - - test("human - cram - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [], [] - ] - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - input[3] = Channel.of("[manta]", "enableRemoteReadRetrievalForInsertionsInGermlineCallingModes = 0") - .collectFile(name:"manta_options.ini", newLine:true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/manta/somatic/tests/main.nf.test.snap b/modules/nf-core/manta/somatic/tests/main.nf.test.snap deleted file mode 100644 index 03af6607a1..0000000000 --- a/modules/nf-core/manta/somatic/tests/main.nf.test.snap +++ /dev/null @@ -1,179 +0,0 @@ -{ - "human - cram - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_small_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_small_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": false - }, - "test.diploid_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - "test.diploid_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "8": [ - "versions.yml:md5,816f991f1d88cadebdeff97b0b676932" - ], - "candidate_small_indels_vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_small_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "candidate_small_indels_vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_small_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "candidate_sv_vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "candidate_sv_vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.candidate_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diploid_sv_vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test.diploid_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "diploid_sv_vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.diploid_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "somatic_sv_vcf": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "somatic_sv_vcf_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,816f991f1d88cadebdeff97b0b676932" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T13:15:58.471602141" - }, - "bed_version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T11:38:45.879278746" - }, - "version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T11:38:33.463803355" - } -} \ No newline at end of file diff --git a/modules/nf-core/manta/tumoronly/tests/main.nf.test b/modules/nf-core/manta/tumoronly/tests/main.nf.test deleted file mode 100644 index 9d57b1d8f7..0000000000 --- a/modules/nf-core/manta/tumoronly/tests/main.nf.test +++ /dev/null @@ -1,121 +0,0 @@ -nextflow_process { - - name "Test Process MANTA_TUMORONLY" - script "../main.nf" - process "MANTA_TUMORONLY" - - tag "modules" - tag "modules_nfcore" - tag "manta" - tag "manta/tumoronly" - - test("human - cram") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [], [] - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = Channel.of("[manta]", "enableRemoteReadRetrievalForInsertionsInGermlineCallingModes = 0") - .collectFile(name:"manta_options.ini", newLine:true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.tumor_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("version") } - ) - } - - } - - test("human - cram - bed") { - - when { - process { - """ - input[0] = [ [ id:'bed_test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi', checkIfExists: true) - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.candidate_small_indels_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.candidate_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.tumor_sv_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("bed_version") } - ) - } - - } - - test("human - cram - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [], [] - ] - // fasta - input[1] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - // fai - input[2] = [ [id:'genome'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - ] - // config - input[3] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/manta/tumoronly/tests/main.nf.test.snap b/modules/nf-core/manta/tumoronly/tests/main.nf.test.snap deleted file mode 100644 index abeccd7ac5..0000000000 --- a/modules/nf-core/manta/tumoronly/tests/main.nf.test.snap +++ /dev/null @@ -1,123 +0,0 @@ -{ - "human - cram - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test" - }, - "test.tumor_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "5": [ - [ - { - "id": "test" - }, - "test.tumor_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - "versions.yml:md5,ebbae8cb2fa4e5227b8358914674523c" - ], - "candidate_small_indels_vcf": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "candidate_small_indels_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.candidate_small_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "candidate_sv_vcf": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "candidate_sv_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.candidate_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tumor_sv_vcf": [ - [ - { - "id": "test" - }, - "test.tumor_sv.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "tumor_sv_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.tumor_sv.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,ebbae8cb2fa4e5227b8358914674523c" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-21T14:44:15.752887" - }, - "version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-21T14:36:52.480477" - } -} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/main.nf.test b/modules/nf-core/mosdepth/tests/main.nf.test deleted file mode 100644 index 0b3c860d32..0000000000 --- a/modules/nf-core/mosdepth/tests/main.nf.test +++ /dev/null @@ -1,246 +0,0 @@ -nextflow_process { - - name "Test Process MOSDEPTH" - script "../main.nf" - process "MOSDEPTH" - - tag "modules" - tag "modules_nfcore" - tag "mosdepth" - - test("homo_sapiens - bam, bai, []") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - bam, bai, bed") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - cram, crai, []") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] - ] - input[1] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - cram, crai, bed") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [ - [ id:'test' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - bam, bai, [] - window") { - - config "./window.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - bam, bai, [] - quantized") { - - config "./quantized.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - [] - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - bam, bai, bed - thresholds") { - - config "./threshold.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("homo_sapiens - bam, bai, bed - fail") { - - config "./window.config" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.failed } - ) - } - - } - - test("homo_sapiens - bam, bai, [] - stub") { - - options "-stub" - when { - process { - """ - input[0] = [ - [ id:'test', single_end:true ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - input[1] = [[],[]] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/mosdepth/tests/main.nf.test.snap b/modules/nf-core/mosdepth/tests/main.nf.test.snap deleted file mode 100644 index 67e16562bc..0000000000 --- a/modules/nf-core/mosdepth/tests/main.nf.test.snap +++ /dev/null @@ -1,1386 +0,0 @@ -{ - "homo_sapiens - bam, bai, [] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.global.dist.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "10": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "11": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.region.dist.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.d4:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "8": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "9": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.global.dist.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "per_base_d4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.d4:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "quantized_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "quantized_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "regions_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "regions_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "regions_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.region.dist.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "thresholds_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "thresholds_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:57:12.350279421" - }, - "homo_sapiens - cram, crai, bed": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,9ded0397623fda26a6a3514d6a0e2a2c" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" - ] - ], - "8": [ - - ], - "9": [ - - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - - ], - "quantized_csi": [ - - ], - "regions_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,9ded0397623fda26a6a3514d6a0e2a2c" - ] - ], - "regions_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" - ] - ], - "regions_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "thresholds_bed": [ - - ], - "thresholds_csi": [ - - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:56:12.528228123" - }, - "homo_sapiens - bam, bai, [] - quantized": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" - ] - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - - ], - "7": [ - - ], - "8": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz:md5,f037c215449d361112efc10108fcc17c" - ] - ], - "9": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93" - ] - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz:md5,f037c215449d361112efc10108fcc17c" - ] - ], - "quantized_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93" - ] - ], - "regions_bed": [ - - ], - "regions_csi": [ - - ], - "regions_txt": [ - - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" - ] - ], - "thresholds_bed": [ - - ], - "thresholds_csi": [ - - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:56:38.422491251" - }, - "homo_sapiens - bam, bai, bed": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,9ded0397623fda26a6a3514d6a0e2a2c" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" - ] - ], - "8": [ - - ], - "9": [ - - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - - ], - "quantized_csi": [ - - ], - "regions_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,9ded0397623fda26a6a3514d6a0e2a2c" - ] - ], - "regions_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" - ] - ], - "regions_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "thresholds_bed": [ - - ], - "thresholds_csi": [ - - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:55:43.01015749" - }, - "homo_sapiens - bam, bai, [] - window": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,0b6ea9f0da1228252d9aef2d3b6f7f76" - ] - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,34f48d16fcdd61e44d812e29e02c77b8" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d" - ] - ], - "8": [ - - ], - "9": [ - - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - - ], - "quantized_csi": [ - - ], - "regions_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,34f48d16fcdd61e44d812e29e02c77b8" - ] - ], - "regions_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d" - ] - ], - "regions_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,0b6ea9f0da1228252d9aef2d3b6f7f76" - ] - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "thresholds_bed": [ - - ], - "thresholds_csi": [ - - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:56:27.10647246" - }, - "homo_sapiens - bam, bai, []": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" - ] - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - - ], - "7": [ - - ], - "8": [ - - ], - "9": [ - - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - - ], - "quantized_csi": [ - - ], - "regions_bed": [ - - ], - "regions_csi": [ - - ], - "regions_txt": [ - - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" - ] - ], - "thresholds_bed": [ - - ], - "thresholds_csi": [ - - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:55:30.449110281" - }, - "homo_sapiens - cram, crai, []": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" - ] - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - - ], - "7": [ - - ], - "8": [ - - ], - "9": [ - - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - - ], - "quantized_csi": [ - - ], - "regions_bed": [ - - ], - "regions_csi": [ - - ], - "regions_txt": [ - - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" - ] - ], - "thresholds_bed": [ - - ], - "thresholds_csi": [ - - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:55:55.244274402" - }, - "homo_sapiens - bam, bai, bed - thresholds": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "10": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz:md5,fe70ae728cd10726c42a2bcd44adfc9d" - ] - ], - "11": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196" - ] - ], - "12": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "3": [ - - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "5": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "6": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,9ded0397623fda26a6a3514d6a0e2a2c" - ] - ], - "7": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" - ] - ], - "8": [ - - ], - "9": [ - - ], - "global_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "per_base_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa" - ] - ], - "per_base_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" - ] - ], - "per_base_d4": [ - - ], - "quantized_bed": [ - - ], - "quantized_csi": [ - - ], - "regions_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz:md5,9ded0397623fda26a6a3514d6a0e2a2c" - ] - ], - "regions_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" - ] - ], - "regions_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" - ] - ], - "summary_txt": [ - [ - { - "id": "test", - "single_end": true - }, - "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" - ] - ], - "thresholds_bed": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz:md5,fe70ae728cd10726c42a2bcd44adfc9d" - ] - ], - "thresholds_csi": [ - [ - { - "id": "test", - "single_end": true - }, - "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196" - ] - ], - "versions": [ - "versions.yml:md5,333368078626c18a32eeb12299080cc9" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.3" - }, - "timestamp": "2025-01-17T14:56:49.888375978" - } -} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/quantized.config b/modules/nf-core/mosdepth/tests/quantized.config deleted file mode 100644 index 63c5535066..0000000000 --- a/modules/nf-core/mosdepth/tests/quantized.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = "--quantize 0:1:4:100:200" -} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/threshold.config b/modules/nf-core/mosdepth/tests/threshold.config deleted file mode 100644 index 9b014ddf53..0000000000 --- a/modules/nf-core/mosdepth/tests/threshold.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = "--thresholds 1,10,20,30" -} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/window.config b/modules/nf-core/mosdepth/tests/window.config deleted file mode 100644 index 7a0f755ce9..0000000000 --- a/modules/nf-core/mosdepth/tests/window.config +++ /dev/null @@ -1,3 +0,0 @@ -process { - ext.args = "--by 100" -} \ No newline at end of file diff --git a/modules/nf-core/msisensorpro/scan/tests/main.nf.test b/modules/nf-core/msisensorpro/scan/tests/main.nf.test deleted file mode 100644 index 38334ac221..0000000000 --- a/modules/nf-core/msisensorpro/scan/tests/main.nf.test +++ /dev/null @@ -1,58 +0,0 @@ - -nextflow_process { - - name "Test Process MSISENSORPRO_SCAN" - script "../main.nf" - process "MSISENSORPRO_SCAN" - - tag "modules" - tag "modules_nfcore" - tag "msisensorpro" - tag "msisensorpro/scan" - - test("test-msisensorpro-scan") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-msisensorpro-scan-stub") { - options '-stub' - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/msisensorpro/scan/tests/main.nf.test.snap b/modules/nf-core/msisensorpro/scan/tests/main.nf.test.snap deleted file mode 100644 index f7ea66fc84..0000000000 --- a/modules/nf-core/msisensorpro/scan/tests/main.nf.test.snap +++ /dev/null @@ -1,72 +0,0 @@ -{ - "test-msisensorpro-scan-stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.msisensor_scan.list:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,e99820cdb69a600f5919ee1d7d5d1c3f" - ], - "list": [ - [ - { - "id": "test", - "single_end": false - }, - "test.msisensor_scan.list:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e99820cdb69a600f5919ee1d7d5d1c3f" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-05T16:44:21.450285" - }, - "test-msisensorpro-scan": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.msisensor_scan.list:md5,309d41b136993db24a9f3dade877753b" - ] - ], - "1": [ - "versions.yml:md5,e99820cdb69a600f5919ee1d7d5d1c3f" - ], - "list": [ - [ - { - "id": "test", - "single_end": false - }, - "test.msisensor_scan.list:md5,309d41b136993db24a9f3dade877753b" - ] - ], - "versions": [ - "versions.yml:md5,e99820cdb69a600f5919ee1d7d5d1c3f" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-05T16:44:09.684249" - } -} \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test deleted file mode 100644 index 33316a7ddb..0000000000 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ /dev/null @@ -1,92 +0,0 @@ -nextflow_process { - - name "Test Process MULTIQC" - script "../main.nf" - process "MULTIQC" - - tag "modules" - tag "modules_nfcore" - tag "multiqc" - - config "./nextflow.config" - - test("sarscov2 single-end [fastqc]") { - - when { - process { - """ - input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) - input[1] = [] - input[2] = [] - input[3] = [] - input[4] = [] - input[5] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, - { assert process.out.data[0] ==~ ".*/multiqc_data" }, - { assert snapshot(process.out.versions).match("multiqc_versions_single") } - ) - } - - } - - test("sarscov2 single-end [fastqc] [config]") { - - when { - process { - """ - input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) - input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) - input[2] = [] - input[3] = [] - input[4] = [] - input[5] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, - { assert process.out.data[0] ==~ ".*/multiqc_data" }, - { assert snapshot(process.out.versions).match("multiqc_versions_config") } - ) - } - } - - test("sarscov2 single-end [fastqc] - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) - input[1] = [] - input[2] = [] - input[3] = [] - input[4] = [] - input[5] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.report.collect { file(it).getName() } + - process.out.data.collect { file(it).getName() } + - process.out.plots.collect { file(it).getName() } + - process.out.versions ).match("multiqc_stub") } - ) - } - - } -} diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap deleted file mode 100644 index 26d74307d0..0000000000 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ /dev/null @@ -1,41 +0,0 @@ -{ - "multiqc_versions_single": { - "content": [ - [ - "versions.yml:md5,b05075d2d2b4f485c0d627a5c8e475b2" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-26T16:05:18.927925" - }, - "multiqc_stub": { - "content": [ - [ - "multiqc_report.html", - "multiqc_data", - "multiqc_plots", - "versions.yml:md5,b05075d2d2b4f485c0d627a5c8e475b2" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-26T16:05:55.639955" - }, - "multiqc_versions_config": { - "content": [ - [ - "versions.yml:md5,b05075d2d2b4f485c0d627a5c8e475b2" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-26T16:05:44.067369" - } -} \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config deleted file mode 100644 index c537a6a3e7..0000000000 --- a/modules/nf-core/multiqc/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: 'MULTIQC' { - ext.prefix = null - } -} diff --git a/modules/nf-core/muse/call/tests/main.nf.test b/modules/nf-core/muse/call/tests/main.nf.test deleted file mode 100644 index a0550d5434..0000000000 --- a/modules/nf-core/muse/call/tests/main.nf.test +++ /dev/null @@ -1,81 +0,0 @@ -nextflow_process { - - name "Test Process MUSE_CALL" - script "../main.nf" - process "MUSE_CALL" - - tag "modules" - tag "modules_nfcore" - tag "muse" - tag "muse/call" - - test("human - bam") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true) - ] - input[1] = [ - [ id:'reference' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - path(process.out.txt.get(0).get(1)).readLines()[1..-1] - // first line holds build version which differs between conda and docker/singularity - ).match() - } - ) - } - - } - - test("human - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.recalibrated.sorted.bam.bai', checkIfExists: true) - ] - input[1] = [ - [ id:'reference' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() - } - ) - } - - } - -} diff --git a/modules/nf-core/muse/call/tests/main.nf.test.snap b/modules/nf-core/muse/call/tests/main.nf.test.snap deleted file mode 100644 index bc826adcc6..0000000000 --- a/modules/nf-core/muse/call/tests/main.nf.test.snap +++ /dev/null @@ -1,83 +0,0 @@ -{ - "human - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.MuSE.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,182c20f31394d1d406428dab96ec3b3e" - ], - "txt": [ - [ - { - "id": "test" - }, - "test.MuSE.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,182c20f31394d1d406428dab96ec3b3e" - ] - }, - { - "MUSE_CALL": { - "MuSE": "2.1.2" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-04T11:48:22.223976" - }, - "human - bam": { - "content": [ - [ - "versions.yml:md5,182c20f31394d1d406428dab96ec3b3e" - ], - [ - "##MuSE_call=\"MuSE -f genome.fasta -O test -n 2 call test2.paired_end.recalibrated.sorted.bam test.paired_end.recalibrated.sorted.bam\"", - "##TUMOR=\"Sample=tumour,File=test2.paired_end.recalibrated.sorted.bam\"", - "##NORMAL=\"Sample=normal,File=test.paired_end.recalibrated.sorted.bam\"", - "##contig=", - "##reference=file://genome.fasta", - "chr21\t15730462\tG\tT\t78\t73\t5.06329e-02\t9.99999e-07\t9.99999e-07\t9.98758e-01\t1.24019e-03\t1.00000e+00\t6.56197e-04\t1.36986e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t71\t1\tN\t74\t4\t71\t1\tT\t0/1:88:84,4:12,24:2\t0/0:87:85,1:11,22:.", - "chr21\t26089994\tG\tT\t52\t41\t9.61538e-02\t9.99999e-07\t9.99999e-07\t9.96265e-01\t3.73266e-03\t1.00000e+00\t1.61194e-03\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t40\t1\tN\t47\t5\t40\t0\tT\t0/1:58:53,5:12,24:2\t0/0:45:44,0:11,0:.", - "chr21\t29327119\tG\tT\t64\t69\t4.61538e-02\t9.99999e-07\t9.99999e-07\t9.98757e-01\t1.24119e-03\t1.00000e+00\t5.96791e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t69\t1\tN\t60\t3\t69\t0\tT\t0/1:67:62,3:13,26:2\t0/0:69:69,0:12,0:.", - "chr21\t30289397\tG\tT\t61\t68\t4.91803e-02\t9.99999e-07\t9.99999e-07\t9.99068e-01\t9.30193e-04\t1.00000e+00\t4.36842e-04\t1.47059e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t67\t1\tN\t57\t3\t67\t1\tT\t0/1:65:60,3:14,25:2\t0/0:72:71,1:13,23:.", - "chr21\t31127136\tG\tT\t52\t56\t1.15385e-01\t9.99999e-07\t9.99999e-07\t9.95375e-01\t4.62342e-03\t1.00000e+00\t1.99006e-03\t1.78571e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t55\t1\tN\t46\t6\t55\t1\tT\t0/1:58:52,6:12,24:2\t0/0:60:59,1:12,24:.", - "chr21\t31154294\tG\tT\t51\t54\t5.88235e-02\t9.99999e-07\t9.99999e-07\t9.98171e-01\t1.82684e-03\t1.00000e+00\t7.86016e-04\t1.85185e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t53\t1\tN\t48\t3\t53\t1\tT\t0/1:58:54,3:12,26:2\t0/0:56:55,1:11,23:.", - "chr21\t32368464\tG\tT\t52\t51\t9.61538e-02\t9.99999e-07\t9.99999e-07\t9.97921e-01\t2.07710e-03\t1.00000e+00\t9.01715e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t51\t1\tN\t47\t5\t51\t0\tT\t0/1:58:53,5:11,23:2\t0/0:57:57,0:11,0:.", - "chr21\t32751144\tG\tT\t84\t73\t5.88235e-02\t9.99999e-07\t9.99999e-07\t9.97552e-01\t2.44588e-03\t1.00000e+00\t1.33898e-03\t1.36986e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t72\t1\tN\t79\t5\t72\t1\tT\t0/1:94:89,5:13,24:2\t0/0:79:78,1:12,24:.", - "chr21\t33524890\tG\tT\t65\t58\t7.24638e-02\t9.99999e-07\t9.99999e-07\t9.98752e-01\t1.24643e-03\t1.00000e+00\t6.03800e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t58\t1\tN\t61\t4\t58\t0\tT\t0/1:74:69,5:12,24:2\t0/0:63:63,0:11,0:.", - "chr21\t37124722\tG\tT\t42\t50\t9.30233e-02\t9.99999e-07\t9.99999e-07\t9.97842e-01\t2.15588e-03\t1.00000e+00\t8.42815e-04\t2.00000e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t48\t1\tN\t38\t4\t48\t1\tT\t0/1:49:44,4:12,24:2\t0/0:55:53,1:11,23:.", - "chr21\t39411760\tG\tT\t74\t69\t5.40541e-02\t9.99999e-07\t9.99999e-07\t9.98929e-01\t1.06922e-03\t1.00000e+00\t5.51430e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t68\t1\tN\t70\t4\t68\t0\tT\t0/1:79:75,4:12,24:2\t0/0:74:73,0:11,0:.", - "chr21\t39661403\tG\tT\t120\t128\t4.06504e-02\t9.99999e-07\t9.99999e-07\t9.99639e-01\t3.58902e-04\t1.00000e+00\t2.32249e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t126\t1\tN\t115\t4\t126\t0\tT\t0/1:133:126,5:13,24:2\t0/0:133:131,0:13,0:.", - "chr21\t40338362\tG\tT\t62\t84\t4.76190e-02\t9.99999e-07\t9.99999e-07\t9.99460e-01\t5.38124e-04\t1.00000e+00\t2.53917e-04\t1.19048e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t83\t1\tN\t58\t3\t83\t1\tT\t0/1:67:63,3:13,25:2\t0/0:89:88,1:13,23:.", - "chr21\t41494394\tG\tT\t55\t63\t7.27273e-02\t9.99999e-07\t9.99999e-07\t9.98213e-01\t1.78518e-03\t1.00000e+00\t7.96975e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t63\t1\tN\t51\t4\t63\t0\tT\t0/1:59:55,4:11,24:2\t0/0:69:69,0:11,0:.", - "chr21\t42076112\tG\tT\t53\t50\t7.40741e-02\t9.99999e-07\t9.99999e-07\t9.98446e-01\t1.55196e-03\t1.00000e+00\t6.80690e-04\t2.00000e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t49\t1\tN\t49\t4\t49\t1\tT\t0/1:55:51,4:12,24:2\t0/0:53:52,1:11,23:.", - "chr21\t42099216\tG\tT\t110\t87\t3.53982e-02\t9.99999e-07\t9.99999e-07\t9.99735e-01\t2.62657e-04\t1.00000e+00\t1.62359e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t85\t1\tN\t104\t4\t85\t0\tT\t0/1:122:116,4:14,24:2\t0/0:93:91,0:14,0:.", - "chr21\t42127034\tG\tT\t34\t44\t1.17647e-01\t9.99999e-07\t9.99999e-07\t9.97401e-01\t2.59663e-03\t1.00000e+00\t9.13452e-04\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t43\t1\tN\t30\t4\t43\t0\tT\t0/1:35:31,4:12,24:2\t0/0:47:46,0:11,0:.", - "chr21\t42288054\tG\tT\t64\t64\t6.15385e-02\t9.99999e-07\t9.99999e-07\t9.98679e-01\t1.31946e-03\t1.00000e+00\t6.34399e-04\t1.56250e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t63\t1\tN\t60\t4\t63\t1\tT\t0/1:71:66,5:13,24:2\t0/0:67:66,1:12,26:.", - "chr21\t42447147\tG\tT\t76\t74\t5.26316e-02\t9.99999e-07\t9.99999e-07\t9.98843e-01\t1.15527e-03\t1.00000e+00\t6.03609e-04\t1.35135e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t72\t1\tN\t72\t4\t72\t1\tT\t0/1:82:77,4:12,24:2\t0/0:84:82,1:12,24:.", - "chr21\t43719369\tG\tT\t77\t82\t6.41026e-02\t9.99999e-07\t9.99999e-07\t9.97895e-01\t2.10296e-03\t1.00000e+00\t1.10470e-03\t1.21951e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t81\t1\tN\t72\t5\t81\t1\tT\t0/1:87:81,5:11,24:2\t0/0:94:93,1:11,23:.", - "chr21\t44527385\tG\tT\t63\t67\t9.52381e-02\t9.99999e-07\t9.99999e-07\t9.96723e-01\t3.27471e-03\t1.00000e+00\t1.55576e-03\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t65\t1\tN\t57\t6\t65\t0\tT\t0/1:68:62,6:12,23:2\t0/0:70:68,0:11,0:.", - "chr21\t44539599\tG\tT\t88\t83\t5.68182e-02\t9.99999e-07\t9.99999e-07\t9.97878e-01\t2.11981e-03\t1.00000e+00\t1.18775e-03\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t82\t1\tN\t82\t5\t82\t0\tT\t0/1:95:88,6:13,24:2\t0/0:90:89,0:12,0:.", - "chr21\t44903401\tG\tT\t40\t38\t1.25000e-01\t9.99999e-07\t9.99999e-07\t9.96171e-01\t3.82668e-03\t1.00000e+00\t1.45159e-03\t2.63158e-02\t9.99999e-07\t9.99999e-07\t9.99997e-01\t9.99999e-07\t1.00000e+00\t1.00053e-08\t37\t1\tN\t35\t5\t37\t1\tT\t0/1:45:40,5:12,24:2\t0/0:40:39,1:11,23:.", - "chr21\t46002393\tG\tT\t85\t92\t5.88235e-02\t9.99999e-07\t9.99999e-07\t9.98018e-01\t1.97994e-03\t1.00000e+00\t1.09115e-03\t0.00000e+00\tNA\tNA\tNA\tNA\tNA\t1.00000e-08\t91\t1\tN\t80\t5\t91\t0\tT\t0/1:89:84,5:14,24:2\t0/0:99:98,0:14,0:." - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-04T11:48:09.865014" - } -} \ No newline at end of file diff --git a/modules/nf-core/muse/sump/tests/main.nf.test b/modules/nf-core/muse/sump/tests/main.nf.test deleted file mode 100644 index 1364090fc9..0000000000 --- a/modules/nf-core/muse/sump/tests/main.nf.test +++ /dev/null @@ -1,82 +0,0 @@ -nextflow_process { - - name "Test Process MUSE_SUMP" - script "../main.nf" - process "MUSE_SUMP" - - tag "modules" - tag "modules_nfcore" - tag "muse" - tag "muse/sump" - - test("human - txt") { - - config "./nextflow.config" - - when { - params { - module_args = '-E' // '-G' for WGS data - } - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/muse/MuSE-call.chr21.hg38.paired_end.recal.MuSE.txt', checkIfExists: true) - ] - input[1] = [ - [ id:'reference' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - path(process.out.vcf.get(0).get(1)).vcf.header.getColumnCount(), - path(process.out.vcf.get(0).get(1)).vcf.summary - ).match() - } - ) - } - - } - - test("human - txt - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/muse/MuSE-call.chr21.hg38.paired_end.recal.MuSE.txt', checkIfExists: true) - ] - input[1] = [ - [ id:'reference' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/germlineresources/dbsnp_138.hg38.vcf.gz.tbi', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() - } - ) - } - - } - -} diff --git a/modules/nf-core/muse/sump/tests/main.nf.test.snap b/modules/nf-core/muse/sump/tests/main.nf.test.snap deleted file mode 100644 index 18cff68b54..0000000000 --- a/modules/nf-core/muse/sump/tests/main.nf.test.snap +++ /dev/null @@ -1,71 +0,0 @@ -{ - "human - txt - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,83d9458549879e13641c6861a802aa31" - ], - "tbi": [ - [ - { - "id": "test" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,83d9458549879e13641c6861a802aa31" - ] - }, - { - "MUSE_SUMP": { - "MuSE": "2.1.2", - "bgzip": 1.21 - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-04T11:43:36.736512" - }, - "human - txt": { - "content": [ - [ - "versions.yml:md5,83d9458549879e13641c6861a802aa31" - ], - 11, - "VcfFile [chromosomes=[], sampleCount=2, variantCount=0, phased=true, phasedAutodetect=true]" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-04-04T11:57:11.337109" - } -} \ No newline at end of file diff --git a/modules/nf-core/muse/sump/tests/nextflow.config b/modules/nf-core/muse/sump/tests/nextflow.config deleted file mode 100644 index 96c26d581d..0000000000 --- a/modules/nf-core/muse/sump/tests/nextflow.config +++ /dev/null @@ -1,8 +0,0 @@ -process { - - withName: 'MUSE_SUMP' { - ext.args = params.module_args - stageInMode = 'copy' // to avoid that the dbsnp index is older than the dbsnp file - } - -} diff --git a/modules/nf-core/ngscheckmate/ncm/tests/bam.config b/modules/nf-core/ngscheckmate/ncm/tests/bam.config deleted file mode 100644 index 09805c1614..0000000000 --- a/modules/nf-core/ngscheckmate/ncm/tests/bam.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: NGSCHECKMATE_NCM { - ext.args = '-B' - } -} diff --git a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test b/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test deleted file mode 100644 index 9a2c17ebbd..0000000000 --- a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test +++ /dev/null @@ -1,180 +0,0 @@ -nextflow_process { - - name "Test Process NGSCHECKMATE_NCM" - script "../main.nf" - process "NGSCHECKMATE_NCM" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "ngscheckmate" - tag "ngscheckmate/ncm" - tag "bcftools/mpileup" - - setup { - - run("BCFTOOLS_MPILEUP", alias: "BCFTOOLS_MPILEUP1") { - script "../../../bcftools/mpileup/main.nf" - process { - """ - input[0] = [ - [ id:'test1' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = [ [ id:'sarscov2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = false - """ - } - } - - run("BCFTOOLS_MPILEUP", alias: "BCFTOOLS_MPILEUP2") { - script "../../../bcftools/mpileup/main.nf" - process { - """ - input[0] = [ - [ id:'test2' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - ] - input[1] = [ [ id:'sarscov2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - input[2] = false - """ - } - } - - } - - - test("sarscov2 - bam") { - config "./bam.config" - when { - process { - """ - bed_file = file('test_snp.bed') - bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" - - input[0] = [ [ id: 'combined_bams' ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam.bai', checkIfExists: true) - ] - ] - input[1] = Channel.of([ [id:'test_bed'], bed_file]) - input[2] = [ [ id:'sarscov2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - file(process.out.corr_matrix[0][1]).name, // Content md5 not stable under conda - file(process.out.matched[0][1]).name, // Content md5 not stable under conda - file(process.out.all[0][1]).name, // Content md5 not stable under conda - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - vcf") { - config "./vcf.config" - when { - process { - """ - bed_file = file('test_snp.bed') - bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" - - input[0] = BCFTOOLS_MPILEUP1.out.vcf.combine(BCFTOOLS_MPILEUP2.out.vcf.map{it[1]}).map{meta, one, two -> [meta, [one, two]]}.map{meta, stuff -> [meta, stuff.flatten()]} - input[1] = Channel.of([ [id:'test_bed'], bed_file]) - input[2] = [ [ id:'sarscov2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.corr_matrix, - file(process.out.matched[0][1]).name, - process.out.all, - file(process.out.pdf[0][1]).name, - process.out.versions - ).match() } - ) - } - - } - - test("sarscov2 - bam - stub") { - - options "-stub" - config "./bam.config" - when { - process { - """ - input[0] = [ [ id: 'combined_bams' ], - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam.bai', checkIfExists: true) - ] - ] - input[1] = [ [ id:'bed' ], []] - input[2] = [ [ id:'sarscov2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - vcf - stub") { - - options "-stub" - config "./vcf.config" - when { - process { - """ - input[0] = BCFTOOLS_MPILEUP1.out.vcf.combine(BCFTOOLS_MPILEUP2.out.vcf.map{it[1]}) - input[1] = [ [ id:'bed' ], []] - input[2] = [ [ id:'sarscov2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap b/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap deleted file mode 100644 index 46191dcaf0..0000000000 --- a/modules/nf-core/ngscheckmate/ncm/tests/main.nf.test.snap +++ /dev/null @@ -1,221 +0,0 @@ -{ - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "combined_bams" - }, - "combined_bams_output_corr_matrix.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "combined_bams" - }, - "combined_bams_matched.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "combined_bams" - }, - "combined_bams_all.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "combined_bams" - }, - "combined_bams.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - "versions.yml:md5,7ac92d9cbf4fc44b3253832f3a8b2a80" - ], - "all": [ - [ - { - "id": "combined_bams" - }, - "combined_bams_all.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "corr_matrix": [ - [ - { - "id": "combined_bams" - }, - "combined_bams_output_corr_matrix.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "matched": [ - [ - { - "id": "combined_bams" - }, - "combined_bams_matched.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "pdf": [ - [ - { - "id": "combined_bams" - }, - "combined_bams.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - - ], - "versions": [ - "versions.yml:md5,7ac92d9cbf4fc44b3253832f3a8b2a80" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" - }, - "timestamp": "2024-05-22T15:02:55.532427413" - }, - "sarscov2 - vcf": { - "content": [ - [ - [ - { - "id": "test1" - }, - "test1_output_corr_matrix.txt:md5,3a23347ff7071d5d8e273bfc29731d4a" - ] - ], - "test1_matched.txt", - [ - [ - { - "id": "test1" - }, - "test1_all.txt:md5,7e6ca5eb3daf6f589ea20fa117269edf" - ] - ], - "test1.pdf", - [ - "versions.yml:md5,7ac92d9cbf4fc44b3253832f3a8b2a80" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-05T15:40:36.013242151" - }, - "sarscov2 - bam": { - "content": [ - "combined_bams_output_corr_matrix.txt", - "combined_bams_matched.txt", - "combined_bams_all.txt", - [ - "versions.yml:md5,7ac92d9cbf4fc44b3253832f3a8b2a80" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-08-06T11:05:56.136156" - }, - "sarscov2 - vcf - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test1" - }, - "test1_output_corr_matrix.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test1" - }, - "test1_matched.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test1" - }, - "test1_all.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test1" - }, - "test1.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - "versions.yml:md5,7ac92d9cbf4fc44b3253832f3a8b2a80" - ], - "all": [ - [ - { - "id": "test1" - }, - "test1_all.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "corr_matrix": [ - [ - { - "id": "test1" - }, - "test1_output_corr_matrix.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "matched": [ - [ - { - "id": "test1" - }, - "test1_matched.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "pdf": [ - [ - { - "id": "test1" - }, - "test1.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - - ], - "versions": [ - "versions.yml:md5,7ac92d9cbf4fc44b3253832f3a8b2a80" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" - }, - "timestamp": "2024-05-22T15:20:40.816531052" - } -} \ No newline at end of file diff --git a/modules/nf-core/ngscheckmate/ncm/tests/nextflow.config b/modules/nf-core/ngscheckmate/ncm/tests/nextflow.config deleted file mode 100644 index cf3d42a0e9..0000000000 --- a/modules/nf-core/ngscheckmate/ncm/tests/nextflow.config +++ /dev/null @@ -1,15 +0,0 @@ -process { - withName: BEDTOOLS_MAKEWINDOWS { - ext.args = '-w 1' - ext.prefix = 'test_split' - } - withName: BCFTOOLS_MPILEUP1 { - ext.args2 = '--no-version --ploidy 1 --multiallelic-caller' - ext.args3 = '--no-version' - } - withName: BCFTOOLS_MPILEUP2 { - ext.args2 = '--no-version --ploidy 1 --multiallelic-caller' - ext.args3 = '--no-version' - } - -} diff --git a/modules/nf-core/ngscheckmate/ncm/tests/vcf.config b/modules/nf-core/ngscheckmate/ncm/tests/vcf.config deleted file mode 100644 index 67053c14da..0000000000 --- a/modules/nf-core/ngscheckmate/ncm/tests/vcf.config +++ /dev/null @@ -1,5 +0,0 @@ - process { - withName: NGSCHECKMATE_NCM { - ext.args = '-V' - } - } diff --git a/modules/nf-core/samblaster/tests/main.nf.test b/modules/nf-core/samblaster/tests/main.nf.test deleted file mode 100644 index 20d505bbef..0000000000 --- a/modules/nf-core/samblaster/tests/main.nf.test +++ /dev/null @@ -1,62 +0,0 @@ -nextflow_process { - - name "Test Process SAMBLASTER" - script "../main.nf" - process "SAMBLASTER" - - tag "modules" - tag "modules_nfcore" - tag "samblaster" - - test("homo_sapiens-test_paired_end_umi_unsorted_bam") { - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.umi_unsorted.bam', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getHeaderMD5(), - bam(process.out.bam[0][1]).getReadsMD5(), - process.out.versions - ).match() - } - ) - } - - } - - test("stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.umi_unsorted.bam', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/samblaster/tests/main.nf.test.snap b/modules/nf-core/samblaster/tests/main.nf.test.snap deleted file mode 100644 index 1a1481a1e3..0000000000 --- a/modules/nf-core/samblaster/tests/main.nf.test.snap +++ /dev/null @@ -1,51 +0,0 @@ -{ - "stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - "versions.yml:md5,8a70467f2dfc2e0d8e81787223d2fc77" - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,8a70467f2dfc2e0d8e81787223d2fc77" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-26T14:04:42.510824" - }, - "homo_sapiens-test_paired_end_umi_unsorted_bam": { - "content": [ - "e21efac7a4734b9b16f7210901cf02af", - "c1b74864f32583faf7d9bcd82217ff4c", - [ - "versions.yml:md5,8a70467f2dfc2e0d8e81787223d2fc77" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-29T20:15:04.264504" - } -} \ No newline at end of file diff --git a/modules/nf-core/samblaster/tests/nextflow.config b/modules/nf-core/samblaster/tests/nextflow.config deleted file mode 100644 index 605e74eb9c..0000000000 --- a/modules/nf-core/samblaster/tests/nextflow.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - withName: SAMBLASTER { - ext.args = '-M --addMateTags' - ext.prefix = { "${meta.id}.processed" } - } -} diff --git a/modules/nf-core/samtools/bam2fq/tests/main.nf.test b/modules/nf-core/samtools/bam2fq/tests/main.nf.test deleted file mode 100644 index 0601af8bc7..0000000000 --- a/modules/nf-core/samtools/bam2fq/tests/main.nf.test +++ /dev/null @@ -1,67 +0,0 @@ -nextflow_process { - - name "Test Process SAMTOOLS_BAM2FQ" - script "../main.nf" - process "SAMTOOLS_BAM2FQ" - - tag "modules" - tag "modules_nfcore" - tag "samtools" - tag "samtools/bam2fq" - - config "./nextflow.config" - - test("bam") { - - when { - process { - """ - split = false - - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.umi_converted.bam', checkIfExists: true) - ]) - input[1] = split - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(path(process.out.reads[0][1]).linesGzip[0..6]).match("bam_reads") }, - { assert snapshot(process.out.versions).match("bam_versions") } - ) - } - - } - - test("bam_split") { - - when { - process { - """ - split = true - - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.umi_converted.bam', checkIfExists: true) - ]) - input[1] = split - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out.reads[0][1].collect{ - if (it ==~ /.*(other|singleton)\.fq\.gz$/) return file(it).name - return path(it).linesGzip[0..6] - }).match("bam_split_reads") }, - { assert snapshot(process.out.versions).match("bam_split_versions") } - ) - } - } -} diff --git a/modules/nf-core/samtools/bam2fq/tests/main.nf.test.snap b/modules/nf-core/samtools/bam2fq/tests/main.nf.test.snap deleted file mode 100644 index 17ea1d4f90..0000000000 --- a/modules/nf-core/samtools/bam2fq/tests/main.nf.test.snap +++ /dev/null @@ -1,75 +0,0 @@ -{ - "bam_reads": { - "content": [ - [ - "@922332/1\tRX:Z:ATTTCAG-TATTATT", - "GAGAGGATCTCGTGTAGAAATTGCTTTGAGCTGTTCTTTGTCATTTTCCCTTAATTCATTGTCTCTAGCTAGTCTGTTACTCTGTAAAATAAAATAATAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGGTCAGTG", - "+", - "EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE | base64 -w 0) -} - -process { - withName: 'SENTIEON_BWAMEM' { - ext.args = "-R \"@RG\\tID:sample_lane\\tPU:lane\\tSM:patient_sample\\tLB:sample\\tDS:fasta\\tPL:seqplatform\"" - } -} diff --git a/modules/nf-core/sentieon/bwamem/tests/nextflow_out_cram.config b/modules/nf-core/sentieon/bwamem/tests/nextflow_out_cram.config deleted file mode 100644 index 07ae63d98e..0000000000 --- a/modules/nf-core/sentieon/bwamem/tests/nextflow_out_cram.config +++ /dev/null @@ -1,16 +0,0 @@ -env { - // NOTE This is how nf-core/sarek users will use Sentieon in real world use - SENTIEON_LICENSE = "$SENTIEON_LICSRVR_IP" - // NOTE This should only happen in GitHub actions or nf-core MegaTests - SENTIEON_AUTH_MECH = "$SENTIEON_AUTH_MECH" - SENTIEON_AUTH_DATA = secrets.SENTIEON_AUTH_DATA - // NOTE This is how nf-core/sarek users will test out Sentieon in Sarek with a license file - // nextflow secrets set SENTIEON_LICENSE_BASE64 \$(cat | base64 -w 0) -} - -process { - withName: 'SENTIEON_BWAMEM' { - ext.args = "-R \"@RG\\tID:sample_lane\\tPU:lane\\tSM:patient_sample\\tLB:sample\\tDS:fasta\\tPL:seqplatform\"" - ext.prefix = { "${meta.id}.cram" } - } -} diff --git a/modules/nf-core/sentieon/dedup/tests/main.nf.test b/modules/nf-core/sentieon/dedup/tests/main.nf.test deleted file mode 100644 index c842a4a00c..0000000000 --- a/modules/nf-core/sentieon/dedup/tests/main.nf.test +++ /dev/null @@ -1,90 +0,0 @@ -nextflow_process { - - name "Test Process SENTIEON_DEDUP" - tag "modules_nfcore" - tag "modules" - tag "sentieon" - tag "dedup" - tag "sentieon/dedup" - - script "../main.nf" - process "SENTIEON_DEDUP" - - test("Test marking duplicates") { - config "./nextflow.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) ] - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("Test removing duplicates") { - config "./nextflow_rmdup.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) ] - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("Test stub") { - config "./nextflow.config" - options "-stub" - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true) ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai', checkIfExists: true) ] - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } -} diff --git a/modules/nf-core/sentieon/dedup/tests/main.nf.test.snap b/modules/nf-core/sentieon/dedup/tests/main.nf.test.snap deleted file mode 100644 index 26117a7cdf..0000000000 --- a/modules/nf-core/sentieon/dedup/tests/main.nf.test.snap +++ /dev/null @@ -1,359 +0,0 @@ -{ - "Test marking duplicates": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.cram:md5,e46e97256846338e1cff32d862105491" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram.crai:md5,4b7b2152b33c5334f9477cc3650f8c91" - ] - ], - "2": [ - - ], - "3": [ - [ - { - "id": "test" - }, - "test.cram.bai:md5,889503338dc569b24e44e5e3aec815ea" - ] - ], - "4": [ - [ - { - "id": "test" - }, - "test.score:md5,835f05ecc5d3ef5d4e31ba7f831d9a8b" - ] - ], - "5": [ - [ - { - "id": "test" - }, - "test.cram.metrics:md5,208f7c5fa2f489cfaaffbce116fed0bc" - ] - ], - "6": [ - [ - { - "id": "test" - }, - "test.cram.metrics.multiqc.tsv:md5,208f7c5fa2f489cfaaffbce116fed0bc" - ] - ], - "7": [ - "versions.yml:md5,763463853476be96846b6da5aecfacf4" - ], - "bai": [ - [ - { - "id": "test" - }, - "test.cram.bai:md5,889503338dc569b24e44e5e3aec815ea" - ] - ], - "bam": [ - - ], - "crai": [ - [ - { - "id": "test" - }, - "test.cram.crai:md5,4b7b2152b33c5334f9477cc3650f8c91" - ] - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,e46e97256846338e1cff32d862105491" - ] - ], - "metrics": [ - [ - { - "id": "test" - }, - "test.cram.metrics:md5,208f7c5fa2f489cfaaffbce116fed0bc" - ] - ], - "metrics_multiqc_tsv": [ - [ - { - "id": "test" - }, - "test.cram.metrics.multiqc.tsv:md5,208f7c5fa2f489cfaaffbce116fed0bc" - ] - ], - "score": [ - [ - { - "id": "test" - }, - "test.score:md5,835f05ecc5d3ef5d4e31ba7f831d9a8b" - ] - ], - "versions": [ - "versions.yml:md5,763463853476be96846b6da5aecfacf4" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:28:10.570152622" - }, - "Test removing duplicates": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.cram:md5,8075d3e7c66d36fdbb81270eefc996d4" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram.crai:md5,c617398ead281c1339d78d5df0d606e9" - ] - ], - "2": [ - - ], - "3": [ - [ - { - "id": "test" - }, - "test.cram.bai:md5,a1ea729eca4732ca3a5dee946a70fbc8" - ] - ], - "4": [ - [ - { - "id": "test" - }, - "test.score:md5,835f05ecc5d3ef5d4e31ba7f831d9a8b" - ] - ], - "5": [ - [ - { - "id": "test" - }, - "test.cram.metrics:md5,2a41239de0275a8321f4658286d97d65" - ] - ], - "6": [ - [ - { - "id": "test" - }, - "test.cram.metrics.multiqc.tsv:md5,2a41239de0275a8321f4658286d97d65" - ] - ], - "7": [ - "versions.yml:md5,763463853476be96846b6da5aecfacf4" - ], - "bai": [ - [ - { - "id": "test" - }, - "test.cram.bai:md5,a1ea729eca4732ca3a5dee946a70fbc8" - ] - ], - "bam": [ - - ], - "crai": [ - [ - { - "id": "test" - }, - "test.cram.crai:md5,c617398ead281c1339d78d5df0d606e9" - ] - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,8075d3e7c66d36fdbb81270eefc996d4" - ] - ], - "metrics": [ - [ - { - "id": "test" - }, - "test.cram.metrics:md5,2a41239de0275a8321f4658286d97d65" - ] - ], - "metrics_multiqc_tsv": [ - [ - { - "id": "test" - }, - "test.cram.metrics.multiqc.tsv:md5,2a41239de0275a8321f4658286d97d65" - ] - ], - "score": [ - [ - { - "id": "test" - }, - "test.score:md5,835f05ecc5d3ef5d4e31ba7f831d9a8b" - ] - ], - "versions": [ - "versions.yml:md5,763463853476be96846b6da5aecfacf4" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:28:19.377946074" - }, - "Test stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - [ - { - "id": "test" - }, - "test.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test" - }, - "test.score:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "5": [ - [ - { - "id": "test" - }, - "test.cram.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - [ - { - "id": "test" - }, - "test.cram.metrics.multiqc.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "7": [ - "versions.yml:md5,763463853476be96846b6da5aecfacf4" - ], - "bai": [ - [ - { - "id": "test" - }, - "test.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "bam": [ - - ], - "crai": [ - [ - { - "id": "test" - }, - "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - [ - { - "id": "test" - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "metrics": [ - [ - { - "id": "test" - }, - "test.cram.metrics:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "metrics_multiqc_tsv": [ - [ - { - "id": "test" - }, - "test.cram.metrics.multiqc.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "score": [ - [ - { - "id": "test" - }, - "test.score:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,763463853476be96846b6da5aecfacf4" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:28:28.792696026" - } -} \ No newline at end of file diff --git a/modules/nf-core/sentieon/dedup/tests/nextflow.config b/modules/nf-core/sentieon/dedup/tests/nextflow.config deleted file mode 100644 index 09a068ee62..0000000000 --- a/modules/nf-core/sentieon/dedup/tests/nextflow.config +++ /dev/null @@ -1,9 +0,0 @@ -env { - // NOTE This is how nf-core/sarek users will use Sentieon in real world use - SENTIEON_LICENSE = "$SENTIEON_LICSRVR_IP" - // NOTE This should only happen in GitHub actions or nf-core MegaTests - SENTIEON_AUTH_MECH = "$SENTIEON_AUTH_MECH" - SENTIEON_AUTH_DATA = secrets.SENTIEON_AUTH_DATA - // NOTE This is how nf-core/sarek users will test out Sentieon in Sarek with a license file - // nextflow secrets set SENTIEON_LICENSE_BASE64 \$(cat | base64 -w 0) -} diff --git a/modules/nf-core/sentieon/dedup/tests/nextflow_rmdup.config b/modules/nf-core/sentieon/dedup/tests/nextflow_rmdup.config deleted file mode 100644 index 21e7b945d2..0000000000 --- a/modules/nf-core/sentieon/dedup/tests/nextflow_rmdup.config +++ /dev/null @@ -1,15 +0,0 @@ -env { - // NOTE This is how nf-core/sarek users will use Sentieon in real world use - SENTIEON_LICENSE = "$SENTIEON_LICSRVR_IP" - // NOTE This should only happen in GitHub actions or nf-core MegaTests - SENTIEON_AUTH_MECH = "$SENTIEON_AUTH_MECH" - SENTIEON_AUTH_DATA = secrets.SENTIEON_AUTH_DATA - // NOTE This is how nf-core/sarek users will test out Sentieon in Sarek with a license file - // nextflow secrets set SENTIEON_LICENSE_BASE64 \$(cat | base64 -w 0) -} - -process { - withName: 'SENTIEON_DEDUP' { - ext.args4 = '--rmdup' - } -} diff --git a/modules/nf-core/sentieon/gvcftyper/tests/main.nf.test b/modules/nf-core/sentieon/gvcftyper/tests/main.nf.test deleted file mode 100644 index 0f66feb681..0000000000 --- a/modules/nf-core/sentieon/gvcftyper/tests/main.nf.test +++ /dev/null @@ -1,212 +0,0 @@ -nextflow_process { - - name "Test Process SENTIEON_GVCFTYPER" - script "../main.nf" - process "SENTIEON_GVCFTYPER" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "sentieon" - tag "sentieon/gvcftyper" - - test("sentieon gvcftyper vcf") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics//homo_sapiens/illumina/gvcf/test.genome.vcf.idx', checkIfExists: true), - [] - ] - - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:], []] - input[4] = [[:], []] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_gz_tbi.get(0).get(1)).name, - path(process.out.vcf_gz[0][1]).vcf.variantsMD5 - ).match() - } - - ) - } - - } - - test("sentieon gvcftyper vcf.gz") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics//homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - [] - ] - - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:], []] - input[4] = [[:], []] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_gz_tbi.get(0).get(1)).name, - path(process.out.vcf_gz[0][1]).vcf.variantsMD5 - ).match() - } - - ) - } - - } - - test("sentieon gvcftyper dbsnp") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics//homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - [] - ] - - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)] - input[4] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_gz_tbi.get(0).get(1)).name, - path(process.out.vcf_gz[0][1]).vcf.variantsMD5 - ).match() - } - - ) - } - - } - - test("sentieon gvcftyper intervals") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics//homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:], []] - input[4] = [[:], []] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_gz_tbi.get(0).get(1)).name, - path(process.out.vcf_gz[0][1]).vcf.variantsMD5 - ).match() - } - - ) - } - - } - - test("sentieon gvcftyper dbsnp intervals") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/gvcf/test.genome.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics//homo_sapiens/illumina/gvcf/test.genome.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true) - ] - - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)] - input[4] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_gz_tbi.get(0).get(1)).name, - path(process.out.vcf_gz[0][1]).vcf.variantsMD5 - ).match() - } - - ) - } - - } - - test("sentieon gvcftyper - stub") { - - options "-stub" - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] // no intervals - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - """ - } - } - - then { - - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - - } - } - -} diff --git a/modules/nf-core/sentieon/gvcftyper/tests/main.nf.test.snap b/modules/nf-core/sentieon/gvcftyper/tests/main.nf.test.snap deleted file mode 100644 index 627b62fd87..0000000000 --- a/modules/nf-core/sentieon/gvcftyper/tests/main.nf.test.snap +++ /dev/null @@ -1,121 +0,0 @@ -{ - "sentieon gvcftyper dbsnp": { - "content": [ - [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ], - "test.genotyped.vcf.gz.tbi", - "21606383c760bf676d4c1f747b97d118" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:29:01.102534193" - }, - "sentieon gvcftyper dbsnp intervals": { - "content": [ - [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ], - "test.genotyped.vcf.gz.tbi", - "21606383c760bf676d4c1f747b97d118" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:29:20.933217951" - }, - "sentieon gvcftyper vcf.gz": { - "content": [ - [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ], - "test.genotyped.vcf.gz.tbi", - "d13216836f1452e200b215b796606671" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:28:50.937002394" - }, - "sentieon gvcftyper intervals": { - "content": [ - [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ], - "test.genotyped.vcf.gz.tbi", - "d13216836f1452e200b215b796606671" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:29:11.029924476" - }, - "sentieon gvcftyper - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.genotyped.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.genotyped.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ], - "vcf_gz": [ - [ - { - "id": "test" - }, - "test.genotyped.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "vcf_gz_tbi": [ - [ - { - "id": "test" - }, - "test.genotyped.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:29:30.788262037" - }, - "sentieon gvcftyper vcf": { - "content": [ - [ - "versions.yml:md5,03a2696e8be5117cccfe48a9bfd8c68a" - ], - "test.genotyped.vcf.gz.tbi", - "d13216836f1452e200b215b796606671" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:28:41.276698125" - } -} \ No newline at end of file diff --git a/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config b/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config deleted file mode 100644 index 0b55bb5ec2..0000000000 --- a/modules/nf-core/sentieon/gvcftyper/tests/nextflow.config +++ /dev/null @@ -1,15 +0,0 @@ -env { - // NOTE This is how pipeline users will use Sentieon in real world use - SENTIEON_LICENSE = "$SENTIEON_LICSRVR_IP" - // NOTE This should only happen in GitHub actions or nf-core MegaTests - SENTIEON_AUTH_MECH = "$SENTIEON_AUTH_MECH" - SENTIEON_AUTH_DATA = secrets.SENTIEON_AUTH_DATA - // NOTE This is how pipeline users will test out Sentieon with a license file - // nextflow secrets set SENTIEON_LICENSE_BASE64 \$(cat | base64 -w 0) -} - -process { - withName: SENTIEON_GVCFTYPER { - ext.prefix = { "${meta.id}.genotyped" } - } -} diff --git a/modules/nf-core/sentieon/haplotyper/tests/main.nf.test b/modules/nf-core/sentieon/haplotyper/tests/main.nf.test deleted file mode 100644 index c06ed17597..0000000000 --- a/modules/nf-core/sentieon/haplotyper/tests/main.nf.test +++ /dev/null @@ -1,327 +0,0 @@ -nextflow_process { - - name "Test Process SENTIEON_HAPLOTYPER" - script "../main.nf" - process "SENTIEON_HAPLOTYPER" - config "./nextflow.config" - - tag "modules" - tag "modules_nfcore" - tag "sentieon" - tag "sentieon/haplotyper" - tag "sentieon/qualcal" - - test("Sentieon Haplotyper VCF") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], // no intervals - [] // no recal table - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = 'variant' - input[6] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_tbi.get(0).get(1)).name, - path(process.out.vcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - - } - - test("Sentieon Haplotyper GVCF") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], // no intervals - [] // no recal table - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = '' - input[6] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.gvcf_tbi.get(0).get(1)).name, - path(process.out.gvcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - - } - - test("Sentieon Haplotyper BOTH") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], // no intervals - [] // no recal table - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = 'variant' - input[6] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.gvcf_tbi.get(0).get(1)).name, - path(process.out.gvcf[0][1]).vcf.variantsMD5, - file(process.out.vcf_tbi.get(0).get(1)).name, - path(process.out.vcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - - } - - test("Sentieon Haplotyper Intervals BOTH") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true), - [] - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = 'variant' - input[6] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.gvcf_tbi.get(0).get(1)).name, - path(process.out.gvcf[0][1]).vcf.variantsMD5, - file(process.out.vcf_tbi.get(0).get(1)).name, - path(process.out.vcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - - } - - test("Sentieon Haplotyper DBSNP BOTH") { - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true), - [] - ] - input[1] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true)] - input[4] = [[id: 'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true)] - input[5] = 'variant' - input[6] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.gvcf_tbi.get(0).get(1)).name, - path(process.out.gvcf[0][1]).vcf.variantsMD5, - file(process.out.vcf_tbi.get(0).get(1)).name, - path(process.out.vcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - } - - test("Sentieon Haplotyper Recalibration") { - - setup { - run("SENTIEON_QUALCAL") { - script "../../qualcal/main.nf" - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) - ] - input[1] = [ [ id:'fasta' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] - input[2] = [ [ id:'fasta' ], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ] - - input[3] = [ [ id:'knownSites' ],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz', checkIfExists: true) ] - input[4] = [ [ id:'knownSites' ],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz.tbi', checkIfExists: true) ] - input[5] = [[:],[]] - input[6] = false - """ - } - } - } - - when { - process { - """ - recal_table = SENTIEON_QUALCAL.out.table - bam = Channel.of([ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [] // no intervals - - ]) - input[0] = bam.join(recal_table) - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = 'variant' - input[6] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_tbi.get(0).get(1)).name, - path(process.out.vcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - - } - - test("Sentieon Haplotyper multiple CRAMs") { - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true), - ], - [ - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam.bai', checkIfExists: true), - ], - [], // no intervals - [] // no recal table - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = 'variant' - input[6] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.vcf_tbi.get(0).get(1)).name, - path(process.out.vcf[0][1]).vcf.variantsMD5 - ).match() - } - ) - } - - } - - test("Sentieon Haplotyper - stub") { - - options "-stub" - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true), - [], // no intervals - [] // no recal table - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)] - input[2] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)] - input[3] = [[:],[]] - input[4] = [[:],[]] - input[5] = 'variant' - input[6] = true - """ - } - } - - then { - - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - - } - } - -} diff --git a/modules/nf-core/sentieon/haplotyper/tests/main.nf.test.snap b/modules/nf-core/sentieon/haplotyper/tests/main.nf.test.snap deleted file mode 100644 index 0527f0fcbe..0000000000 --- a/modules/nf-core/sentieon/haplotyper/tests/main.nf.test.snap +++ /dev/null @@ -1,187 +0,0 @@ -{ - "Sentieon Haplotyper VCF": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.unfiltered.vcf.gz.tbi", - "cea0045051da7877b38a1e25df812a91" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:29:42.675527558" - }, - "Sentieon Haplotyper Recalibration": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.unfiltered.vcf.gz.tbi", - "10faa3b669c49826098e09784d8a4716" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:30:38.708688756" - }, - "Sentieon Haplotyper GVCF": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.g.vcf.gz.tbi", - "338fc3c37b208d6595948576833eb665" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:29:53.99302993" - }, - "Sentieon Haplotyper BOTH": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.g.vcf.gz.tbi", - "338fc3c37b208d6595948576833eb665", - "test.unfiltered.vcf.gz.tbi", - "cea0045051da7877b38a1e25df812a91" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:30:03.323463525" - }, - "Sentieon Haplotyper DBSNP BOTH": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.g.vcf.gz.tbi", - "228556b7921205f023fec51098feeb97", - "test.unfiltered.vcf.gz.tbi", - "cc1f3d4bd615f3640e7fd103cc39d2f8" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:30:25.917634004" - }, - "Sentieon Haplotyper Intervals BOTH": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.g.vcf.gz.tbi", - "338fc3c37b208d6595948576833eb665", - "test.unfiltered.vcf.gz.tbi", - "cea0045051da7877b38a1e25df812a91" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:30:14.249175276" - }, - "Sentieon Haplotyper - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.unfiltered.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.unfiltered.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.g.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test.g.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "gvcf": [ - [ - { - "id": "test" - }, - "test.g.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "gvcf_tbi": [ - [ - { - "id": "test" - }, - "test.g.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.unfiltered.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "vcf_tbi": [ - [ - { - "id": "test" - }, - "test.unfiltered.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:30:56.435076872" - }, - "Sentieon Haplotyper multiple CRAMs": { - "content": [ - [ - "versions.yml:md5,1a7b41acc44d0724c8dca247e6323877" - ], - "test.unfiltered.vcf.gz.tbi", - "b5d6e09e336438e38f7bf5531799e3a" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-02T10:30:49.266709749" - } -} \ No newline at end of file diff --git a/modules/nf-core/sentieon/haplotyper/tests/nextflow.config b/modules/nf-core/sentieon/haplotyper/tests/nextflow.config deleted file mode 100644 index 78f19cfb26..0000000000 --- a/modules/nf-core/sentieon/haplotyper/tests/nextflow.config +++ /dev/null @@ -1,16 +0,0 @@ -env { - // NOTE This is how pipeline users will use Sentieon in real world use - SENTIEON_LICENSE = "$SENTIEON_LICSRVR_IP" - // NOTE This should only happen in GitHub actions or nf-core MegaTests - SENTIEON_AUTH_MECH = "$SENTIEON_AUTH_MECH" - SENTIEON_AUTH_DATA = secrets.SENTIEON_AUTH_DATA - // NOTE This is how pipeline users will test out Sentieon with a license file - // nextflow secrets set SENTIEON_LICENSE_BASE64 \$(cat | base64 -w 0) -} - -process { - withName: 'SENTIEON_HAPLOTYPER' { - ext.args2 = "--genotype_model multinomial" - ext.args3 = "--genotype_model multinomial" - } -} diff --git a/modules/nf-core/snpeff/download/tests/main.nf.test b/modules/nf-core/snpeff/download/tests/main.nf.test deleted file mode 100644 index ef547c6f2e..0000000000 --- a/modules/nf-core/snpeff/download/tests/main.nf.test +++ /dev/null @@ -1,51 +0,0 @@ - -nextflow_process { - - name "Test Process SNPEFF_DOWNLOAD" - script "../main.nf" - process "SNPEFF_DOWNLOAD" - - tag "modules" - tag "modules_nfcore" - tag "snpeff" - tag "snpeff/download" - - test("test-snpeff-download") { - - when { - process { - """ - input[0] = [ [ id:"WBcel235.105" ], "WBcel235.105" ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test-snpeff-download-stub") { - options '-stub' - when { - process { - """ - input[0] = [ [ id:"WBcel235.105" ], "WBcel235.105" ] - - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/snpeff/download/tests/main.nf.test.snap b/modules/nf-core/snpeff/download/tests/main.nf.test.snap deleted file mode 100644 index 5bccdd8ad3..0000000000 --- a/modules/nf-core/snpeff/download/tests/main.nf.test.snap +++ /dev/null @@ -1,100 +0,0 @@ -{ - "test-snpeff-download-stub": { - "content": [ - { - "0": [ - [ - { - "id": "WBcel235.105" - }, - [ - [ - "sequence.I.bin:md5,d41d8cd98f00b204e9800998ecf8427e", - "sequence.bin:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ] - ], - "1": [ - "versions.yml:md5,5fc7ed9f548eccf5fac9fdefc12ef56e" - ], - "cache": [ - [ - { - "id": "WBcel235.105" - }, - [ - [ - "sequence.I.bin:md5,d41d8cd98f00b204e9800998ecf8427e", - "sequence.bin:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ] - ], - "versions": [ - "versions.yml:md5,5fc7ed9f548eccf5fac9fdefc12ef56e" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-19T12:48:45.183665736" - }, - "test-snpeff-download": { - "content": [ - { - "0": [ - [ - { - "id": "WBcel235.105" - }, - [ - [ - "sequence.I.bin:md5,2fd1694bd91cf7952cbad8cfed161e53", - "sequence.II.bin:md5,bacedbdea89508e108223767fa260a4c", - "sequence.III.bin:md5,444118a9fb9d0a03c37e86094d8e52a9", - "sequence.IV.bin:md5,ff756628faa0b71cd65495668c3d82b5", - "sequence.V.bin:md5,d6ad5476162ac45829f719dd4ee3f4e7", - "sequence.X.bin:md5,b79bec6cc8f96b8373dac56bab5d0a6c", - "sequence.bin:md5,ec2bc2ae81755ab90fcf1848bc7ce41f", - "snpEffectPredictor.bin:md5,1d99251d0405f0a42913ed8b5b2c2fa7" - ] - ] - ] - ], - "1": [ - "versions.yml:md5,5fc7ed9f548eccf5fac9fdefc12ef56e" - ], - "cache": [ - [ - { - "id": "WBcel235.105" - }, - [ - [ - "sequence.I.bin:md5,2fd1694bd91cf7952cbad8cfed161e53", - "sequence.II.bin:md5,bacedbdea89508e108223767fa260a4c", - "sequence.III.bin:md5,444118a9fb9d0a03c37e86094d8e52a9", - "sequence.IV.bin:md5,ff756628faa0b71cd65495668c3d82b5", - "sequence.V.bin:md5,d6ad5476162ac45829f719dd4ee3f4e7", - "sequence.X.bin:md5,b79bec6cc8f96b8373dac56bab5d0a6c", - "sequence.bin:md5,ec2bc2ae81755ab90fcf1848bc7ce41f", - "snpEffectPredictor.bin:md5,1d99251d0405f0a42913ed8b5b2c2fa7" - ] - ] - ] - ], - "versions": [ - "versions.yml:md5,5fc7ed9f548eccf5fac9fdefc12ef56e" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-29T14:27:47.123555" - } -} \ No newline at end of file diff --git a/modules/nf-core/snpeff/snpeff/tests/main.nf.test b/modules/nf-core/snpeff/snpeff/tests/main.nf.test deleted file mode 100644 index 661e9672a7..0000000000 --- a/modules/nf-core/snpeff/snpeff/tests/main.nf.test +++ /dev/null @@ -1,87 +0,0 @@ -nextflow_process { - - name "Test Process SNPEFF_SNPEFF" - script "../main.nf" - process "SNPEFF_SNPEFF" - config "./nextflow.config" - tag "modules" - tag "modules_nfcore" - tag "modules_snpeff" - tag "snpeff" - tag "snpeff/download" - tag "snpeff/snpeff" - - test("test_SNPEFF_SNPEFF") { - - setup { - run("SNPEFF_DOWNLOAD") { - script "../../download/main.nf" - process { - """ - input[0] = Channel.of([[id:params.snpeff_db], params.snpeff_db]) - """ - } - } - } - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ]) - input[1] = params.snpeff_db - input[2] = SNPEFF_DOWNLOAD.out.cache - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.report[0][1]).exists() }, - { assert path(process.out.summary_html[0][1]).exists() }, - { assert path(process.out.vcf[0][1]).exists() }, - { assert snapshot(process.out.genes_txt).match("genes_txt") }, - { assert snapshot(process.out.versions).match("versions") } - ) - } - } - - test("test_SNPEFF_SNPEFF - stub") { - - options "-stub" - - setup { - run("SNPEFF_DOWNLOAD") { - script "../../download/main.nf" - process { - """ - input[0] = Channel.of([[id:params.snpeff_db], params.snpeff_db]) - """ - } - } - } - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ]) - input[1] = params.snpeff_db - input[2] = SNPEFF_DOWNLOAD.out.cache - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() }, - ) - } - } -} diff --git a/modules/nf-core/snpeff/snpeff/tests/main.nf.test.snap b/modules/nf-core/snpeff/snpeff/tests/main.nf.test.snap deleted file mode 100644 index 9fc0c9f520..0000000000 --- a/modules/nf-core/snpeff/snpeff/tests/main.nf.test.snap +++ /dev/null @@ -1,112 +0,0 @@ -{ - "versions": { - "content": [ - [ - "versions.yml:md5,25d44a118d558b331d51ec00be0d997c" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.02.0" - }, - "timestamp": "2024-03-18T17:37:18.879477" - }, - "genes_txt": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.genes.txt:md5,130536bf0237d7f3f746d32aaa32840a" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.02.0" - }, - "timestamp": "2024-03-18T17:37:18.874822" - }, - "test_SNPEFF_SNPEFF - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.ann.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.csv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test.genes.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,25d44a118d558b331d51ec00be0d997c" - ], - "genes_txt": [ - [ - { - "id": "test" - }, - "test.genes.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "report": [ - [ - { - "id": "test" - }, - "test.csv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "summary_html": [ - [ - { - "id": "test" - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.ann.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,25d44a118d558b331d51ec00be0d997c" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-03-05T14:55:15.626663647" - } -} \ No newline at end of file diff --git a/modules/nf-core/snpeff/snpeff/tests/nextflow.config b/modules/nf-core/snpeff/snpeff/tests/nextflow.config deleted file mode 100644 index a950a0475d..0000000000 --- a/modules/nf-core/snpeff/snpeff/tests/nextflow.config +++ /dev/null @@ -1,3 +0,0 @@ -params { - snpeff_db = "WBcel235.105" -} diff --git a/modules/nf-core/spring/decompress/tests/main.nf.test b/modules/nf-core/spring/decompress/tests/main.nf.test deleted file mode 100644 index c7ac2b1f3e..0000000000 --- a/modules/nf-core/spring/decompress/tests/main.nf.test +++ /dev/null @@ -1,154 +0,0 @@ -nextflow_process { - - name "Test Process SPRING_DECOMPRESS" - tag "modules_nfcore" - tag "modules" - tag "spring" - tag "spring/compress" - tag "spring/decompress" - script "../main.nf" - process "SPRING_DECOMPRESS" - - test("Write-One-File") { - - setup { - run("SPRING_COMPRESS") { - script "../../compress/main.nf" - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - [] - ] - """ - } - } - } - - when { - process { - """ - input[0] = SPRING_COMPRESS.out.spring - input[1] = true // write_one_fastq_gz - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Write-Two-Files") { - - setup { - run("SPRING_COMPRESS") { - script "../../compress/main.nf" - process { - """ - input[0] = [ - [ id:'test2' ], // meta map - file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - ] - """ - } - } - } - - when { - process { - """ - input[0] = SPRING_COMPRESS.out.spring - input[1] = false // write_one_fastq_gz - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Write-One-File-stub") { - - options "-stub" - - setup { - run("SPRING_COMPRESS") { - options "-stub" - script "../../compress/main.nf" - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - [] - ] - """ - } - } - } - - when { - process { - """ - input[0] = SPRING_COMPRESS.out.spring - input[1] = true // write_one_fastq_gz - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("Write-Two-Files-stub") { - - options "-stub" - - setup { - run("SPRING_COMPRESS") { - options "-stub" - script "../../compress/main.nf" - process { - """ - input[0] = [ - [ id:'test2' ], // meta map - file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - ] - """ - } - } - } - - when { - process { - """ - input[0] = SPRING_COMPRESS.out.spring - input[1] = false // write_one_fastq_gz - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} \ No newline at end of file diff --git a/modules/nf-core/spring/decompress/tests/main.nf.test.snap b/modules/nf-core/spring/decompress/tests/main.nf.test.snap deleted file mode 100644 index 7dcadbab61..0000000000 --- a/modules/nf-core/spring/decompress/tests/main.nf.test.snap +++ /dev/null @@ -1,218 +0,0 @@ -{ - "Write-One-File stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "/home/ramprasad.neethiraj/nextflow/modules/.nf-test/tests/2a6cfab794852e23e6324eb4955668b2/work/42/aee6c82c1ca502c3b02339f597188b/test.fastq.gz" - ] - ], - "1": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ], - "fastq": [ - [ - { - "id": "test" - }, - "/home/ramprasad.neethiraj/nextflow/modules/.nf-test/tests/2a6cfab794852e23e6324eb4955668b2/work/42/aee6c82c1ca502c3b02339f597188b/test.fastq.gz" - ] - ], - "versions": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-08T10:03:50.626223289" - }, - "Write-Two-Files stub": { - "content": [ - { - "0": [ - [ - { - "id": "test2" - }, - [ - "/home/ramprasad.neethiraj/nextflow/modules/.nf-test/tests/528557b5a81e4bffb57c38b19c7aa351/work/74/fc5d116d011bcd47d6f7de8d42ac34/test2_R1.fastq.gz", - "/home/ramprasad.neethiraj/nextflow/modules/.nf-test/tests/528557b5a81e4bffb57c38b19c7aa351/work/74/fc5d116d011bcd47d6f7de8d42ac34/test2_R2.fastq.gz" - ] - ] - ], - "1": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ], - "fastq": [ - [ - { - "id": "test2" - }, - [ - "/home/ramprasad.neethiraj/nextflow/modules/.nf-test/tests/528557b5a81e4bffb57c38b19c7aa351/work/74/fc5d116d011bcd47d6f7de8d42ac34/test2_R1.fastq.gz", - "/home/ramprasad.neethiraj/nextflow/modules/.nf-test/tests/528557b5a81e4bffb57c38b19c7aa351/work/74/fc5d116d011bcd47d6f7de8d42ac34/test2_R2.fastq.gz" - ] - ] - ], - "versions": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-08T10:03:57.417015606" - }, - "Write-Two-Files": { - "content": [ - { - "0": [ - [ - { - "id": "test2" - }, - [ - "test2_R1.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec", - "test2_R2.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" - ] - ] - ], - "1": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ], - "fastq": [ - [ - { - "id": "test2" - }, - [ - "test2_R1.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec", - "test2_R2.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" - ] - ] - ], - "versions": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-21T13:41:46.090761471" - }, - "Write-One-File": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" - ] - ], - "1": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ], - "fastq": [ - [ - { - "id": "test" - }, - "test.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" - ] - ], - "versions": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-21T13:02:07.466039653" - }, - "Write-One-File-stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ], - "fastq": [ - [ - { - "id": "test" - }, - "test.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-08T13:55:53.594615215" - }, - "Write-Two-Files-stub": { - "content": [ - { - "0": [ - [ - { - "id": "test2" - }, - [ - "test2_R1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test2_R2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ], - "fastq": [ - [ - { - "id": "test2" - }, - [ - "test2_R1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test2_R2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "versions": [ - "versions.yml:md5,4711df5941f1464e3693d24dd29c705b" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-08T13:56:01.212228909" - } -} \ No newline at end of file diff --git a/modules/nf-core/spring/decompress/tests/nextflow.config b/modules/nf-core/spring/decompress/tests/nextflow.config deleted file mode 100644 index 50f50a7a35..0000000000 --- a/modules/nf-core/spring/decompress/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - - publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } - -} \ No newline at end of file diff --git a/modules/nf-core/strelka/germline/tests/main.nf.test b/modules/nf-core/strelka/germline/tests/main.nf.test deleted file mode 100644 index e2be9e1830..0000000000 --- a/modules/nf-core/strelka/germline/tests/main.nf.test +++ /dev/null @@ -1,94 +0,0 @@ -nextflow_process { - - name "Test Process STRELKA_GERMLINE" - script "../main.nf" - process "STRELKA_GERMLINE" - - tag "modules" - tag "modules_nfcore" - tag "strelka" - tag "strelka/germline" - - test("human - cram") { - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [], [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.genome_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("human - cram - target") { - config "./nextflow.config" - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.genome_vcf.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.versions).match() } - ) - } - - } - - test("human - cram - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [], [] - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/strelka/germline/tests/main.nf.test.snap b/modules/nf-core/strelka/germline/tests/main.nf.test.snap deleted file mode 100644 index 2085fdbfaa..0000000000 --- a/modules/nf-core/strelka/germline/tests/main.nf.test.snap +++ /dev/null @@ -1,107 +0,0 @@ -{ - "human - cram - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.variants.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.variants.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.genome.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test.genome.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,5f72393fd2ab4358e3f0ad16d1937f65" - ], - "genome_vcf": [ - [ - { - "id": "test" - }, - "test.genome.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "genome_vcf_tbi": [ - [ - { - "id": "test" - }, - "test.genome.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.variants.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "vcf_tbi": [ - [ - { - "id": "test" - }, - "test.variants.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,5f72393fd2ab4358e3f0ad16d1937f65" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-20T16:07:30.81195" - }, - "human - cram": { - "content": [ - [ - "versions.yml:md5,5f72393fd2ab4358e3f0ad16d1937f65" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-28T16:50:28.337512" - }, - "human - cram - target": { - "content": [ - [ - "versions.yml:md5,5f72393fd2ab4358e3f0ad16d1937f65" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.4" - }, - "timestamp": "2024-08-28T16:51:35.930772" - } -} diff --git a/modules/nf-core/strelka/germline/tests/nextflow.config b/modules/nf-core/strelka/germline/tests/nextflow.config deleted file mode 100644 index 7e1bcab953..0000000000 --- a/modules/nf-core/strelka/germline/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: STRELKA_GERMLINE { - ext.args = '--exome' - } -} diff --git a/modules/nf-core/strelka/somatic/tests/main.nf.test b/modules/nf-core/strelka/somatic/tests/main.nf.test deleted file mode 100644 index 2203e6eea4..0000000000 --- a/modules/nf-core/strelka/somatic/tests/main.nf.test +++ /dev/null @@ -1,106 +0,0 @@ -nextflow_process { - - name "Test Process STRELKA_SOMATIC" - script "../main.nf" - process "STRELKA_SOMATIC" - - tag "modules" - tag "modules_nfcore" - tag "strelka" - tag "strelka/somatic" - - test("human - cram") { - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [],[], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf_indels.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.vcf_snvs.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("version") } - ) - } - - } - - test("human - cram - best-practise") { - config "./nextflow.config" - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/test.genome_21.somatic_sv.vcf.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/test.genome_21.somatic_sv.vcf.gz.tbi', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf_indels.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert path(process.out.vcf_snvs.get(0).get(1)).linesGzip.contains("##fileformat=VCFv4.1") }, - { assert snapshot(process.out.version).match("bp_version") } - ) - } - - } - - test("human - cram - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true), - [],[], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi', checkIfExists: true) - ] - input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) - input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/strelka/somatic/tests/main.nf.test.snap b/modules/nf-core/strelka/somatic/tests/main.nf.test.snap deleted file mode 100644 index 2594277d9b..0000000000 --- a/modules/nf-core/strelka/somatic/tests/main.nf.test.snap +++ /dev/null @@ -1,107 +0,0 @@ -{ - "bp_version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T15:14:10.142709768" - }, - "human - cram - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_snvs.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_snvs.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - "versions.yml:md5,97860fb8f9cda9494819160f7cf6e35b" - ], - "vcf_indels": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_indels.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "vcf_indels_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_indels.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf_snvs": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_snvs.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "vcf_snvs_tbi": [ - [ - { - "id": "test", - "single_end": false - }, - "test.somatic_snvs.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,97860fb8f9cda9494819160f7cf6e35b" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T15:08:42.361540303" - }, - "version": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T15:11:29.631209445" - } -} \ No newline at end of file diff --git a/modules/nf-core/strelka/somatic/tests/nextflow.config b/modules/nf-core/strelka/somatic/tests/nextflow.config deleted file mode 100644 index 3ee62247a5..0000000000 --- a/modules/nf-core/strelka/somatic/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: STRELKA_SOMATIC { - ext.args = '--exome' - } -} diff --git a/modules/nf-core/svdb/merge/tests/main.nf.test b/modules/nf-core/svdb/merge/tests/main.nf.test deleted file mode 100644 index 6a79d7a09a..0000000000 --- a/modules/nf-core/svdb/merge/tests/main.nf.test +++ /dev/null @@ -1,360 +0,0 @@ -nextflow_process { - - name "Test Process SVDB_MERGE" - script "modules/nf-core/svdb/merge/main.nf" - config "./nextflow.config" - process "SVDB_MERGE" - tag "modules" - tag "modules_nfcore" - tag "svdb" - tag "svdb/merge" - - test("1 sample, [], []") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ]) - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--vcf test.vcf") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("1 sample, [], true") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ]) - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--vcf test.vcf") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("1 sample, ['tiddit'], []") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ]) - input[1] = ['tiddit'] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--priority tiddit --vcf test.vcf:tiddit") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("1 sample, ['tiddit'], true") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ]) - input[1] = ['tiddit'] - input[2] = true - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--priority tiddit --vcf test.vcf:tiddit") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("2 samples, [], []") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--vcf test2.vcf test.vcf") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("2 samples, [], true") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = [] - input[2] = true - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--vcf test.vcf test2.vcf") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("2 samples, ['tiddit', 'cnvnator'], []") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = ['tiddit', 'cnvnator'] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--priority tiddit,cnvnator --vcf test2.vcf:tiddit test.vcf:cnvnator") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("2 samples, ['tiddit', 'cnvnator'], true") { - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = ['tiddit', 'cnvnator'] - input[2] = true - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).linesGzip[3].contains("--priority tiddit,cnvnator --vcf test.vcf:cnvnator test2.vcf:tiddit") }, // SVDB command line - { assert snapshot( - path(process.out.vcf.get(0).get(1)).vcf.summary, - path(process.out.vcf.get(0).get(1)).vcf.variantsMD5, - process.out.versions - ).match() } - ) - } - } - - test("2 samples, [], [] - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = [] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("2 samples, [], true - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = [] - input[2] = true - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("2 samples, ['tiddit', 'cnvnator'], [] - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = ['tiddit', 'cnvnator'] - input[2] = [] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("2 samples, ['tiddit', 'cnvnator'], true - stub") { - - options "-stub" - - when { - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test2.vcf', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - ]) - input[1] = ['tiddit', 'cnvnator'] - input[2] = true - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - -} diff --git a/modules/nf-core/svdb/merge/tests/main.nf.test.snap b/modules/nf-core/svdb/merge/tests/main.nf.test.snap deleted file mode 100644 index e86662e533..0000000000 --- a/modules/nf-core/svdb/merge/tests/main.nf.test.snap +++ /dev/null @@ -1,294 +0,0 @@ -{ - "1 sample, [], []": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=1, variantCount=9, phased=false, phasedAutodetect=false]", - "60fb4cab2aa891bebef8ffdbd0e41bc3", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:00:25.9277471" - }, - "2 samples, ['tiddit', 'cnvnator'], true - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:05:49.325618245" - }, - "2 samples, ['tiddit', 'cnvnator'], []": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=2, variantCount=9, phased=false, phasedAutodetect=false]", - "254e56e4fc8356d68424828438da66e3", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:02:27.964808463" - }, - "2 samples, [], []": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=2, variantCount=9, phased=false, phasedAutodetect=false]", - "7ad648266e57d405b5b01aaea4613d1c", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:02:11.013532413" - }, - "2 samples, ['tiddit', 'cnvnator'], true": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=2, variantCount=9, phased=false, phasedAutodetect=false]", - "254e56e4fc8356d68424828438da66e3", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:02:35.956320871" - }, - "1 sample, ['tiddit'], []": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=1, variantCount=9, phased=false, phasedAutodetect=false]", - "9dd588cd870672b78192f48ad440b5d", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:00:42.064583463" - }, - "1 sample, [], true": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=1, variantCount=9, phased=false, phasedAutodetect=false]", - "60fb4cab2aa891bebef8ffdbd0e41bc3", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:00:33.88572601" - }, - "1 sample, ['tiddit'], true": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=1, variantCount=9, phased=false, phasedAutodetect=false]", - "9dd588cd870672b78192f48ad440b5d", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:00:50.18149857" - }, - "2 samples, [], true": { - "content": [ - "VcfFile [chromosomes=[MT192765.1], sampleCount=2, variantCount=9, phased=false, phasedAutodetect=false]", - "de0a3b56cdee89e4c9cd4fbb4ad3391d", - [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:02:19.556799178" - }, - "2 samples, ['tiddit', 'cnvnator'], [] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:05:40.427970257" - }, - "2 samples, [], [] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:05:24.34471465" - }, - "2 samples, [], true - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - - ], - "2": [ - - ], - "3": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ], - "csi": [ - - ], - "tbi": [ - - ], - "vcf": [ - [ - { - "id": "test" - }, - "merged.vcf.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,bf8271626d334b2a827f94a2daacadd0" - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-10-24T09:05:32.529261733" - } -} \ No newline at end of file diff --git a/modules/nf-core/svdb/merge/tests/nextflow.config b/modules/nf-core/svdb/merge/tests/nextflow.config deleted file mode 100644 index c267037ca0..0000000000 --- a/modules/nf-core/svdb/merge/tests/nextflow.config +++ /dev/null @@ -1,6 +0,0 @@ -process { - withName: 'SVDB_MERGE' { - ext.prefix = "merged" - ext.args2 = '--output-type z --no-version' - } -} diff --git a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test deleted file mode 100644 index cdb016e5de..0000000000 --- a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test +++ /dev/null @@ -1,123 +0,0 @@ -nextflow_process { - - name "Test Process TABIX_BGZIPTABIX" - script "../main.nf" - process "TABIX_BGZIPTABIX" - - tag "modules" - tag "modules_nfcore" - tag "tabix" - tag "tabix/bgziptabix" - - test("sarscov2_bed_tbi") { - config "./tabix_tbi.config" - - when { - process { - """ - input[0] = [ - [ id:'tbi_test' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert snapshot( - file(process.out.gz_tbi[0][1]).name - ).match("tbi_test") - } - ) - } - } - - test("sarscov2_bed_csi") { - config "./tabix_csi.config" - - when { - process { - """ - input[0] = [ - [ id:'csi_test' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert snapshot( - file(process.out.gz_csi[0][1]).name - ).match("csi_test") - } - ) - } - - } - - test("sarscov2_bed_csi_stub") { - config "./tabix_csi.config" - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert snapshot( - file(process.out.gz_csi[0][1]).name - ).match("csi_stub") - } - ) - } - - } - - test("sarscov2_bed_tbi_stub") { - config "./tabix_tbi.config" - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - { assert snapshot( - file(process.out.gz_tbi[0][1]).name - ).match("tbi_stub") - } - ) - } - - } - -} diff --git a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap deleted file mode 100644 index 5f81804535..0000000000 --- a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap +++ /dev/null @@ -1,206 +0,0 @@ -{ - "sarscov2_bed_tbi": { - "content": [ - { - "0": [ - [ - { - "id": "tbi_test" - }, - "tbi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", - "tbi_test.bed.gz.tbi:md5,ca06caf88b1e3c67d5fcba0a1460b52c" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ], - "gz_csi": [ - - ], - "gz_tbi": [ - [ - { - "id": "tbi_test" - }, - "tbi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", - "tbi_test.bed.gz.tbi:md5,ca06caf88b1e3c67d5fcba0a1460b52c" - ] - ], - "versions": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:30.53305451" - }, - "sarscov2_bed_csi": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "csi_test" - }, - "csi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", - "csi_test.bed.gz.csi:md5,c9c0377de58fdc89672bb3005a0d69f5" - ] - ], - "2": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ], - "gz_csi": [ - [ - { - "id": "csi_test" - }, - "csi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", - "csi_test.bed.gz.csi:md5,c9c0377de58fdc89672bb3005a0d69f5" - ] - ], - "gz_tbi": [ - - ], - "versions": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:34.152301569" - }, - "csi_test": { - "content": [ - "csi_test.bed.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-02-19T14:51:00.548801" - }, - "sarscov2_bed_tbi_stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ], - "gz_csi": [ - - ], - "gz_tbi": [ - [ - { - "id": "test" - }, - "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:41.271812789" - }, - "csi_stub": { - "content": [ - "test.bed.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-02-19T14:51:09.218454" - }, - "tbi_stub": { - "content": [ - "test.bed.gz" - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.4" - }, - "timestamp": "2024-09-25T14:45:18.550930179" - }, - "tbi_test": { - "content": [ - "tbi_test.bed.gz" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-02-19T14:50:51.579654" - }, - "sarscov2_bed_csi_stub": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test" - }, - "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ], - "gz_csi": [ - [ - { - "id": "test" - }, - "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "gz_tbi": [ - - ], - "versions": [ - "versions.yml:md5,9a7904908d7400fc67ef0412a925e9fc" - ] - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:37.709221651" - } -} \ No newline at end of file diff --git a/modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config b/modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config deleted file mode 100644 index fb41a31424..0000000000 --- a/modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: TABIX_BGZIPTABIX { - ext.args2 = '-p vcf --csi' - } -} diff --git a/modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config b/modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config deleted file mode 100644 index c1915dc4b0..0000000000 --- a/modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: TABIX_BGZIPTABIX { - ext.args2 = '-p vcf' - } -} \ No newline at end of file diff --git a/modules/nf-core/tabix/tabix/tests/main.nf.test b/modules/nf-core/tabix/tabix/tests/main.nf.test deleted file mode 100644 index e74afd926d..0000000000 --- a/modules/nf-core/tabix/tabix/tests/main.nf.test +++ /dev/null @@ -1,136 +0,0 @@ -nextflow_process { - - name "Test Process TABIX_TABIX" - script "../main.nf" - process "TABIX_TABIX" - - tag "modules" - tag "modules_nfcore" - tag "tabix" - tag "tabix/tabix" - - test("sarscov2_bedgz_tbi") { - config "./tabix_bed.config" - when { - process { - """ - input[0] = [ - [ id:'tbi_bed' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed.gz', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out, - file(process.out.tbi[0][1]).name - ).match() } - ) - } - } - - test("sarscov2_gff_tbi") { - config "./tabix_gff.config" - when { - process { - """ - input[0] = [ - [ id:'tbi_gff' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out, - file(process.out.tbi[0][1]).name).match() } - ) - } - - } - - test("sarscov2_vcf_tbi") { - config "./tabix_vcf_tbi.config" - when { - process { - """ - input[0] = [ - [ id:'tbi_vcf' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out, - file(process.out.tbi[0][1]).name - ).match() } - ) - } - - } - - test("sarscov2_vcf_csi") { - config "./tabix_vcf_csi.config" - when { - process { - """ - input[0] = [ - [ id:'vcf_csi' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out, - file(process.out.csi[0][1]).name - ).match() } - ) - } - - } - - test("sarscov2_vcf_csi_stub") { - config "./tabix_vcf_csi.config" - options "-stub" - when { - process { - """ - input[0] = [ - [ id:'vcf_csi_stub' ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) ] - ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot( - process.out, - file(process.out.csi[0][1]).name - ).match() } - ) - } - - } - -} diff --git a/modules/nf-core/tabix/tabix/tests/main.nf.test.snap b/modules/nf-core/tabix/tabix/tests/main.nf.test.snap deleted file mode 100644 index 67b8e3c2f9..0000000000 --- a/modules/nf-core/tabix/tabix/tests/main.nf.test.snap +++ /dev/null @@ -1,212 +0,0 @@ -{ - "sarscov2_gff_tbi": { - "content": [ - { - "0": [ - [ - { - "id": "tbi_gff" - }, - "genome.gff3.gz.tbi:md5,f79a67d95a98076e04fbe0455d825926" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "tbi_gff" - }, - "genome.gff3.gz.tbi:md5,f79a67d95a98076e04fbe0455d825926" - ] - ], - "versions": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ] - }, - "genome.gff3.gz.tbi" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:48.638506004" - }, - "sarscov2_bedgz_tbi": { - "content": [ - { - "0": [ - [ - { - "id": "tbi_bed" - }, - "test.bed.gz.tbi:md5,9a761d51cc81835fd1199201fdbcdd5d" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "tbi_bed" - }, - "test.bed.gz.tbi:md5,9a761d51cc81835fd1199201fdbcdd5d" - ] - ], - "versions": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ] - }, - "test.bed.gz.tbi" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:44.910707349" - }, - "sarscov2_vcf_tbi": { - "content": [ - { - "0": [ - [ - { - "id": "tbi_vcf" - }, - "test.vcf.gz.tbi:md5,d22e5b84e4fcd18792179f72e6da702e" - ] - ], - "1": [ - - ], - "2": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ], - "csi": [ - - ], - "tbi": [ - [ - { - "id": "tbi_vcf" - }, - "test.vcf.gz.tbi:md5,d22e5b84e4fcd18792179f72e6da702e" - ] - ], - "versions": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ] - }, - "test.vcf.gz.tbi" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:52.405662623" - }, - "sarscov2_vcf_csi_stub": { - "content": [ - { - "0": [ - [ - { - "id": "vcf_csi_stub" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "vcf_csi_stub" - }, - "test.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ], - "csi": [ - [ - { - "id": "vcf_csi_stub" - }, - "test.vcf.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tbi": [ - [ - { - "id": "vcf_csi_stub" - }, - "test.vcf.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ] - }, - "test.vcf.gz.csi" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:59.633992323" - }, - "sarscov2_vcf_csi": { - "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "vcf_csi" - }, - "test.vcf.gz.csi:md5,04b41c1efd9ab3c6b1e008a286e27d2b" - ] - ], - "2": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ], - "csi": [ - [ - { - "id": "vcf_csi" - }, - "test.vcf.gz.csi:md5,04b41c1efd9ab3c6b1e008a286e27d2b" - ] - ], - "tbi": [ - - ], - "versions": [ - "versions.yml:md5,3bfeccaff5f93fb7fca5f6dc0f0975d5" - ] - }, - "test.vcf.gz.csi" - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-03-26T13:52:56.083553332" - } -} \ No newline at end of file diff --git a/modules/nf-core/tabix/tabix/tests/tabix_bed.config b/modules/nf-core/tabix/tabix/tests/tabix_bed.config deleted file mode 100644 index 7ff0590566..0000000000 --- a/modules/nf-core/tabix/tabix/tests/tabix_bed.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: TABIX_TABIX { - ext.args = '-p bed' - } -} \ No newline at end of file diff --git a/modules/nf-core/tabix/tabix/tests/tabix_gff.config b/modules/nf-core/tabix/tabix/tests/tabix_gff.config deleted file mode 100644 index 20c0a1e349..0000000000 --- a/modules/nf-core/tabix/tabix/tests/tabix_gff.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: TABIX_TABIX { - ext.args = '-p gff' - } -} \ No newline at end of file diff --git a/modules/nf-core/tabix/tabix/tests/tabix_vcf_csi.config b/modules/nf-core/tabix/tabix/tests/tabix_vcf_csi.config deleted file mode 100644 index eb4f2d7e2a..0000000000 --- a/modules/nf-core/tabix/tabix/tests/tabix_vcf_csi.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: TABIX_TABIX { - ext.args = '-p vcf --csi' - } -} diff --git a/modules/nf-core/tabix/tabix/tests/tabix_vcf_tbi.config b/modules/nf-core/tabix/tabix/tests/tabix_vcf_tbi.config deleted file mode 100644 index 2774c8a906..0000000000 --- a/modules/nf-core/tabix/tabix/tests/tabix_vcf_tbi.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: TABIX_TABIX { - ext.args = '-p vcf' - } -} \ No newline at end of file diff --git a/modules/nf-core/tiddit/sv/tests/main.nf.test b/modules/nf-core/tiddit/sv/tests/main.nf.test deleted file mode 100644 index 6e32b9e1cf..0000000000 --- a/modules/nf-core/tiddit/sv/tests/main.nf.test +++ /dev/null @@ -1,193 +0,0 @@ -nextflow_process { - - name "Test Process TIDDIT_SV" - script "../main.nf" - process "TIDDIT_SV" - - tag "modules" - tag "modules_nfcore" - tag "tiddit" - tag "tiddit/sv" - tag "bwa/index" - - test("sarscov2 - bam - bwa") { - - setup { - - run("BWA_INDEX") { - script "../../../../nf-core/bwa/index/main.nf" - process { - """ - input[0] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) - ] - // fasta - input[1] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - // bwa_index - input[2] = BWA_INDEX.out.index - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).readLines().contains("##fileformat=VCFv4.1") }, - { assert path(process.out.ploidy.get(0).get(1)).readLines().contains("Chromosome Ploidy Ploidy_rounded Mean_coverage") }, - { assert snapshot(process.out.versions).match("bam_bwa_version") } - ) - } - - } - - test("sarscov2 - bam - no_bwa") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) - ] - // fasta - input[1] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - // bwa_index - input[2] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).readLines().contains("##fileformat=VCFv4.1") }, - { assert path(process.out.ploidy.get(0).get(1)).readLines().contains("Chromosome Ploidy Ploidy_rounded Mean_coverage") }, - { assert snapshot(process.out.versions).match("bam_version") } - ) - } - - } - - test("human - cram - bwa") { - - setup { - - run("BWA_INDEX") { - script "../../../../nf-core/bwa/index/main.nf" - process { - """ - input[0] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) - ] - // fasta - input[1] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - // bwa_index - input[2] = BWA_INDEX.out.index - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).readLines().contains("##fileformat=VCFv4.1") }, - { assert path(process.out.ploidy.get(0).get(1)).readLines().contains("Chromosome Ploidy Ploidy_rounded Mean_coverage") }, - { assert snapshot(process.out.versions).match("cram_bwa_version") }) - } - - } - - test("human - cram - no_bwa") { - - config "./nextflow.config" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) - ] - // fasta - input[1] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ] - // bwa_index - input[2] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.vcf.get(0).get(1)).readLines().contains("##fileformat=VCFv4.1") }, - { assert path(process.out.ploidy.get(0).get(1)).readLines().contains("Chromosome Ploidy Ploidy_rounded Mean_coverage") }, - { assert snapshot(process.out.versions).match("cram_version") }) - } - - } - - test("sarscov2 - bam - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) - ] - // fasta - input[1] = [ [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - // bwa_index - input[2] = [ [], [] ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/tiddit/sv/tests/main.nf.test.snap b/modules/nf-core/tiddit/sv/tests/main.nf.test.snap deleted file mode 100644 index 541c48bbdd..0000000000 --- a/modules/nf-core/tiddit/sv/tests/main.nf.test.snap +++ /dev/null @@ -1,99 +0,0 @@ -{ - "cram_bwa_version": { - "content": [ - [ - "versions.yml:md5,0ffcce416e40bcc98da2243f1d7e348a" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T10:33:01.300519" - }, - "cram_version": { - "content": [ - [ - "versions.yml:md5,0ffcce416e40bcc98da2243f1d7e348a" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T10:27:12.52902" - }, - "sarscov2 - bam - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.ploidies.tab:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,0ffcce416e40bcc98da2243f1d7e348a" - ], - "ploidy": [ - [ - { - "id": "test" - }, - "test.ploidies.tab:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,0ffcce416e40bcc98da2243f1d7e348a" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T10:21:51.950503" - }, - "bam_bwa_version": { - "content": [ - [ - "versions.yml:md5,0ffcce416e40bcc98da2243f1d7e348a" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T10:31:40.918479" - }, - "bam_version": { - "content": [ - [ - "versions.yml:md5,0ffcce416e40bcc98da2243f1d7e348a" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T10:21:38.449053" - } -} \ No newline at end of file diff --git a/modules/nf-core/tiddit/sv/tests/nextflow.config b/modules/nf-core/tiddit/sv/tests/nextflow.config deleted file mode 100644 index 9bbd0bee51..0000000000 --- a/modules/nf-core/tiddit/sv/tests/nextflow.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: 'TIDDIT_SV' { - ext.args = '--skip_assembly' - } -} diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test deleted file mode 100644 index c957517aaa..0000000000 --- a/modules/nf-core/untar/tests/main.nf.test +++ /dev/null @@ -1,85 +0,0 @@ -nextflow_process { - - name "Test Process UNTAR" - script "../main.nf" - process "UNTAR" - tag "modules" - tag "modules_nfcore" - tag "untar" - - test("test_untar") { - - when { - process { - """ - input[0] = [ [], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/db/kraken2.tar.gz', checkIfExists: true) ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - ) - } - } - - test("test_untar_onlyfiles") { - - when { - process { - """ - input[0] = [ [], file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - ) - } - } - - test("test_untar - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/db/kraken2.tar.gz', checkIfExists: true) ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - ) - } - } - - test("test_untar_onlyfiles - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ [], file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) ] - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() }, - ) - } - } -} diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap deleted file mode 100644 index ceb91b7925..0000000000 --- a/modules/nf-core/untar/tests/main.nf.test.snap +++ /dev/null @@ -1,158 +0,0 @@ -{ - "test_untar_onlyfiles": { - "content": [ - { - "0": [ - [ - [ - - ], - [ - "hello.txt:md5,e59ff97941044f85df5297e1c302d260" - ] - ] - ], - "1": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ], - "untar": [ - [ - [ - - ], - [ - "hello.txt:md5,e59ff97941044f85df5297e1c302d260" - ] - ] - ], - "versions": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-10T12:04:28.231047" - }, - "test_untar_onlyfiles - stub": { - "content": [ - { - "0": [ - [ - [ - - ], - [ - "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "1": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ], - "untar": [ - [ - [ - - ], - [ - "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "versions": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-10T12:04:45.773103" - }, - "test_untar - stub": { - "content": [ - { - "0": [ - [ - [ - - ], - [ - "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", - "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", - "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "1": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ], - "untar": [ - [ - [ - - ], - [ - "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", - "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", - "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "versions": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-10T12:04:36.777441" - }, - "test_untar": { - "content": [ - { - "0": [ - [ - [ - - ], - [ - "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", - "opts.k2d:md5,a033d00cf6759407010b21700938f543", - "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" - ] - ] - ], - "1": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ], - "untar": [ - [ - [ - - ], - [ - "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", - "opts.k2d:md5,a033d00cf6759407010b21700938f543", - "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" - ] - ] - ], - "versions": [ - "versions.yml:md5,6063247258c56fd271d076bb04dd7536" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-10T12:04:19.377674" - } -} \ No newline at end of file diff --git a/modules/nf-core/unzip/tests/main.nf.test b/modules/nf-core/unzip/tests/main.nf.test deleted file mode 100644 index 238b68d8ba..0000000000 --- a/modules/nf-core/unzip/tests/main.nf.test +++ /dev/null @@ -1,54 +0,0 @@ -nextflow_process { - - name "Test Process UNZIP" - script "../main.nf" - process "UNZIP" - - tag "modules" - tag "modules_nfcore" - tag "unzip" - - test("generic [tar] [tar_gz]") { - - when { - process { - """ - input[0] = [ - [ id: 'hello' ], - file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("generic [tar] [tar_gz] stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id: 'hello' ], - file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) - ] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } -} diff --git a/modules/nf-core/unzip/tests/main.nf.test.snap b/modules/nf-core/unzip/tests/main.nf.test.snap deleted file mode 100644 index cdd2ab1641..0000000000 --- a/modules/nf-core/unzip/tests/main.nf.test.snap +++ /dev/null @@ -1,76 +0,0 @@ -{ - "generic [tar] [tar_gz] stub": { - "content": [ - { - "0": [ - [ - { - "id": "hello" - }, - [ - - ] - ] - ], - "1": [ - "versions.yml:md5,52c55ce814e8bc9edc5a6c625ed794b8" - ], - "unzipped_archive": [ - [ - { - "id": "hello" - }, - [ - - ] - ] - ], - "versions": [ - "versions.yml:md5,52c55ce814e8bc9edc5a6c625ed794b8" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-30T19:16:37.11550986" - }, - "generic [tar] [tar_gz]": { - "content": [ - { - "0": [ - [ - { - "id": "hello" - }, - [ - "hello.tar:md5,80c66db79a773bc87b3346035ff9593e" - ] - ] - ], - "1": [ - "versions.yml:md5,52c55ce814e8bc9edc5a6c625ed794b8" - ], - "unzipped_archive": [ - [ - { - "id": "hello" - }, - [ - "hello.tar:md5,80c66db79a773bc87b3346035ff9593e" - ] - ] - ], - "versions": [ - "versions.yml:md5,52c55ce814e8bc9edc5a6c625ed794b8" - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-30T19:16:25.120242571" - } -} \ No newline at end of file diff --git a/modules/nf-core/vcftools/tests/base.config b/modules/nf-core/vcftools/tests/base.config deleted file mode 100644 index 2b749b66c8..0000000000 --- a/modules/nf-core/vcftools/tests/base.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: VCFTOOLS { - ext.args = '--freq' - } -} diff --git a/modules/nf-core/vcftools/tests/bed.config b/modules/nf-core/vcftools/tests/bed.config deleted file mode 100644 index 14c0aea867..0000000000 --- a/modules/nf-core/vcftools/tests/bed.config +++ /dev/null @@ -1,5 +0,0 @@ -process { - withName: VCFTOOLS { - ext.args = '--freq --exclude-bed' - } -} diff --git a/modules/nf-core/vcftools/tests/main.nf.test b/modules/nf-core/vcftools/tests/main.nf.test deleted file mode 100644 index d8f578dac1..0000000000 --- a/modules/nf-core/vcftools/tests/main.nf.test +++ /dev/null @@ -1,151 +0,0 @@ -nextflow_process { - - name "Test Process VCFTOOLS" - script "../main.nf" - process "VCFTOOLS" - - tag "modules" - tag "modules_nfcore" - tag "vcftools" - - test("sarscov2 - vcf") { - - config "./base.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - // bed - input[1] = [] - // diff_variant_file - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - vcfgz") { - - config "./base.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) - ] - // bed - input[1] = [] - // diff_variant_file - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - vcf - bed") { - - config "./bed.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf', checkIfExists: true) - ] - // bed - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - // diff_variant_file - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - vcfgz - bed") { - - config "./bed.config" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) - ] - // bed - input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) - // diff_variant_file - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - - test("sarscov2 - vcfgz - stub") { - - options "-stub" - - when { - process { - """ - input[0] = [ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) - ] - // bed - input[1] = [] - // diff_variant_file - input[2] = [] - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - - } - -} diff --git a/modules/nf-core/vcftools/tests/main.nf.test.snap b/modules/nf-core/vcftools/tests/main.nf.test.snap deleted file mode 100644 index e17865541f..0000000000 --- a/modules/nf-core/vcftools/tests/main.nf.test.snap +++ /dev/null @@ -1,2623 +0,0 @@ -{ - "sarscov2 - vcfgz - bed": { - "content": [ - { - "0": [ - - ], - "1": [ - - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - - ], - "13": [ - - ], - "14": [ - - ], - "15": [ - - ], - "16": [ - - ], - "17": [ - - ], - "18": [ - - ], - "19": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "20": [ - - ], - "21": [ - - ], - "22": [ - - ], - "23": [ - - ], - "24": [ - - ], - "25": [ - - ], - "26": [ - - ], - "27": [ - - ], - "28": [ - - ], - "29": [ - - ], - "3": [ - - ], - "30": [ - - ], - "31": [ - - ], - "32": [ - - ], - "33": [ - - ], - "34": [ - - ], - "35": [ - - ], - "36": [ - - ], - "37": [ - - ], - "38": [ - - ], - "39": [ - - ], - "4": [ - - ], - "40": [ - - ], - "41": [ - - ], - "42": [ - - ], - "43": [ - - ], - "44": [ - - ], - "45": [ - - ], - "46": [ - - ], - "47": [ - - ], - "48": [ - - ], - "49": [ - - ], - "5": [ - - ], - "50": [ - - ], - "51": [ - - ], - "52": [ - - ], - "53": [ - - ], - "54": [ - - ], - "55": [ - - ], - "56": [ - - ], - "57": [ - - ], - "58": [ - - ], - "59": [ - - ], - "6": [ - - ], - "60": [ - - ], - "61": [ - - ], - "62": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "7": [ - - ], - "8": [ - - ], - "9": [ - - ], - "bcf": [ - - ], - "beagle_gl": [ - - ], - "beagle_pl": [ - - ], - "diff_discd_matrix": [ - - ], - "diff_indv": [ - - ], - "diff_indv_in_files": [ - - ], - "diff_sites": [ - - ], - "diff_sites_in_files": [ - - ], - "diff_switch_error": [ - - ], - "filter_summary": [ - - ], - "format": [ - - ], - "freq_burden": [ - - ], - "frq": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "frq_count": [ - - ], - "gdepth": [ - - ], - "geno_chisq": [ - - ], - "geno_ld": [ - - ], - "genotypes_matrix": [ - - ], - "genotypes_matrix_individual": [ - - ], - "genotypes_matrix_position": [ - - ], - "hap_ld": [ - - ], - "hapcount": [ - - ], - "heterozygosity": [ - - ], - "hwe": [ - - ], - "idepth": [ - - ], - "impute_hap": [ - - ], - "impute_hap_indv": [ - - ], - "impute_hap_legend": [ - - ], - "indel_hist": [ - - ], - "info": [ - - ], - "interchrom_geno_ld": [ - - ], - "interchrom_hap_ld": [ - - ], - "kept_sites": [ - - ], - "ldepth": [ - - ], - "ldepth_mean": [ - - ], - "ldhat_locs": [ - - ], - "ldhat_sites": [ - - ], - "list_geno_ld": [ - - ], - "list_hap_ld": [ - - ], - "lqual": [ - - ], - "lroh": [ - - ], - "map_": [ - - ], - "mendel": [ - - ], - "missing_individual": [ - - ], - "missing_site": [ - - ], - "ped": [ - - ], - "relatedness": [ - - ], - "relatedness2": [ - - ], - "removed_sites": [ - - ], - "singeltons": [ - - ], - "sites_pi": [ - - ], - "snp_density": [ - - ], - "tajima_d": [ - - ], - "tfam": [ - - ], - "tped": [ - - ], - "tstv": [ - - ], - "tstv_count": [ - - ], - "tstv_qual": [ - - ], - "tstv_summary": [ - - ], - "vcf": [ - - ], - "versions": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "weir_fst": [ - - ], - "windowed_pi": [ - - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T13:07:26.598512" - }, - "sarscov2 - vcf": { - "content": [ - { - "0": [ - - ], - "1": [ - - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - - ], - "13": [ - - ], - "14": [ - - ], - "15": [ - - ], - "16": [ - - ], - "17": [ - - ], - "18": [ - - ], - "19": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "20": [ - - ], - "21": [ - - ], - "22": [ - - ], - "23": [ - - ], - "24": [ - - ], - "25": [ - - ], - "26": [ - - ], - "27": [ - - ], - "28": [ - - ], - "29": [ - - ], - "3": [ - - ], - "30": [ - - ], - "31": [ - - ], - "32": [ - - ], - "33": [ - - ], - "34": [ - - ], - "35": [ - - ], - "36": [ - - ], - "37": [ - - ], - "38": [ - - ], - "39": [ - - ], - "4": [ - - ], - "40": [ - - ], - "41": [ - - ], - "42": [ - - ], - "43": [ - - ], - "44": [ - - ], - "45": [ - - ], - "46": [ - - ], - "47": [ - - ], - "48": [ - - ], - "49": [ - - ], - "5": [ - - ], - "50": [ - - ], - "51": [ - - ], - "52": [ - - ], - "53": [ - - ], - "54": [ - - ], - "55": [ - - ], - "56": [ - - ], - "57": [ - - ], - "58": [ - - ], - "59": [ - - ], - "6": [ - - ], - "60": [ - - ], - "61": [ - - ], - "62": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "7": [ - - ], - "8": [ - - ], - "9": [ - - ], - "bcf": [ - - ], - "beagle_gl": [ - - ], - "beagle_pl": [ - - ], - "diff_discd_matrix": [ - - ], - "diff_indv": [ - - ], - "diff_indv_in_files": [ - - ], - "diff_sites": [ - - ], - "diff_sites_in_files": [ - - ], - "diff_switch_error": [ - - ], - "filter_summary": [ - - ], - "format": [ - - ], - "freq_burden": [ - - ], - "frq": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "frq_count": [ - - ], - "gdepth": [ - - ], - "geno_chisq": [ - - ], - "geno_ld": [ - - ], - "genotypes_matrix": [ - - ], - "genotypes_matrix_individual": [ - - ], - "genotypes_matrix_position": [ - - ], - "hap_ld": [ - - ], - "hapcount": [ - - ], - "heterozygosity": [ - - ], - "hwe": [ - - ], - "idepth": [ - - ], - "impute_hap": [ - - ], - "impute_hap_indv": [ - - ], - "impute_hap_legend": [ - - ], - "indel_hist": [ - - ], - "info": [ - - ], - "interchrom_geno_ld": [ - - ], - "interchrom_hap_ld": [ - - ], - "kept_sites": [ - - ], - "ldepth": [ - - ], - "ldepth_mean": [ - - ], - "ldhat_locs": [ - - ], - "ldhat_sites": [ - - ], - "list_geno_ld": [ - - ], - "list_hap_ld": [ - - ], - "lqual": [ - - ], - "lroh": [ - - ], - "map_": [ - - ], - "mendel": [ - - ], - "missing_individual": [ - - ], - "missing_site": [ - - ], - "ped": [ - - ], - "relatedness": [ - - ], - "relatedness2": [ - - ], - "removed_sites": [ - - ], - "singeltons": [ - - ], - "sites_pi": [ - - ], - "snp_density": [ - - ], - "tajima_d": [ - - ], - "tfam": [ - - ], - "tped": [ - - ], - "tstv": [ - - ], - "tstv_count": [ - - ], - "tstv_qual": [ - - ], - "tstv_summary": [ - - ], - "vcf": [ - - ], - "versions": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "weir_fst": [ - - ], - "windowed_pi": [ - - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T13:07:10.654082" - }, - "sarscov2 - vcfgz": { - "content": [ - { - "0": [ - - ], - "1": [ - - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - - ], - "13": [ - - ], - "14": [ - - ], - "15": [ - - ], - "16": [ - - ], - "17": [ - - ], - "18": [ - - ], - "19": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "20": [ - - ], - "21": [ - - ], - "22": [ - - ], - "23": [ - - ], - "24": [ - - ], - "25": [ - - ], - "26": [ - - ], - "27": [ - - ], - "28": [ - - ], - "29": [ - - ], - "3": [ - - ], - "30": [ - - ], - "31": [ - - ], - "32": [ - - ], - "33": [ - - ], - "34": [ - - ], - "35": [ - - ], - "36": [ - - ], - "37": [ - - ], - "38": [ - - ], - "39": [ - - ], - "4": [ - - ], - "40": [ - - ], - "41": [ - - ], - "42": [ - - ], - "43": [ - - ], - "44": [ - - ], - "45": [ - - ], - "46": [ - - ], - "47": [ - - ], - "48": [ - - ], - "49": [ - - ], - "5": [ - - ], - "50": [ - - ], - "51": [ - - ], - "52": [ - - ], - "53": [ - - ], - "54": [ - - ], - "55": [ - - ], - "56": [ - - ], - "57": [ - - ], - "58": [ - - ], - "59": [ - - ], - "6": [ - - ], - "60": [ - - ], - "61": [ - - ], - "62": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "7": [ - - ], - "8": [ - - ], - "9": [ - - ], - "bcf": [ - - ], - "beagle_gl": [ - - ], - "beagle_pl": [ - - ], - "diff_discd_matrix": [ - - ], - "diff_indv": [ - - ], - "diff_indv_in_files": [ - - ], - "diff_sites": [ - - ], - "diff_sites_in_files": [ - - ], - "diff_switch_error": [ - - ], - "filter_summary": [ - - ], - "format": [ - - ], - "freq_burden": [ - - ], - "frq": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "frq_count": [ - - ], - "gdepth": [ - - ], - "geno_chisq": [ - - ], - "geno_ld": [ - - ], - "genotypes_matrix": [ - - ], - "genotypes_matrix_individual": [ - - ], - "genotypes_matrix_position": [ - - ], - "hap_ld": [ - - ], - "hapcount": [ - - ], - "heterozygosity": [ - - ], - "hwe": [ - - ], - "idepth": [ - - ], - "impute_hap": [ - - ], - "impute_hap_indv": [ - - ], - "impute_hap_legend": [ - - ], - "indel_hist": [ - - ], - "info": [ - - ], - "interchrom_geno_ld": [ - - ], - "interchrom_hap_ld": [ - - ], - "kept_sites": [ - - ], - "ldepth": [ - - ], - "ldepth_mean": [ - - ], - "ldhat_locs": [ - - ], - "ldhat_sites": [ - - ], - "list_geno_ld": [ - - ], - "list_hap_ld": [ - - ], - "lqual": [ - - ], - "lroh": [ - - ], - "map_": [ - - ], - "mendel": [ - - ], - "missing_individual": [ - - ], - "missing_site": [ - - ], - "ped": [ - - ], - "relatedness": [ - - ], - "relatedness2": [ - - ], - "removed_sites": [ - - ], - "singeltons": [ - - ], - "sites_pi": [ - - ], - "snp_density": [ - - ], - "tajima_d": [ - - ], - "tfam": [ - - ], - "tped": [ - - ], - "tstv": [ - - ], - "tstv_count": [ - - ], - "tstv_qual": [ - - ], - "tstv_summary": [ - - ], - "vcf": [ - - ], - "versions": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "weir_fst": [ - - ], - "windowed_pi": [ - - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T13:07:15.930382" - }, - "sarscov2 - vcf - bed": { - "content": [ - { - "0": [ - - ], - "1": [ - - ], - "10": [ - - ], - "11": [ - - ], - "12": [ - - ], - "13": [ - - ], - "14": [ - - ], - "15": [ - - ], - "16": [ - - ], - "17": [ - - ], - "18": [ - - ], - "19": [ - - ], - "2": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "20": [ - - ], - "21": [ - - ], - "22": [ - - ], - "23": [ - - ], - "24": [ - - ], - "25": [ - - ], - "26": [ - - ], - "27": [ - - ], - "28": [ - - ], - "29": [ - - ], - "3": [ - - ], - "30": [ - - ], - "31": [ - - ], - "32": [ - - ], - "33": [ - - ], - "34": [ - - ], - "35": [ - - ], - "36": [ - - ], - "37": [ - - ], - "38": [ - - ], - "39": [ - - ], - "4": [ - - ], - "40": [ - - ], - "41": [ - - ], - "42": [ - - ], - "43": [ - - ], - "44": [ - - ], - "45": [ - - ], - "46": [ - - ], - "47": [ - - ], - "48": [ - - ], - "49": [ - - ], - "5": [ - - ], - "50": [ - - ], - "51": [ - - ], - "52": [ - - ], - "53": [ - - ], - "54": [ - - ], - "55": [ - - ], - "56": [ - - ], - "57": [ - - ], - "58": [ - - ], - "59": [ - - ], - "6": [ - - ], - "60": [ - - ], - "61": [ - - ], - "62": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "7": [ - - ], - "8": [ - - ], - "9": [ - - ], - "bcf": [ - - ], - "beagle_gl": [ - - ], - "beagle_pl": [ - - ], - "diff_discd_matrix": [ - - ], - "diff_indv": [ - - ], - "diff_indv_in_files": [ - - ], - "diff_sites": [ - - ], - "diff_sites_in_files": [ - - ], - "diff_switch_error": [ - - ], - "filter_summary": [ - - ], - "format": [ - - ], - "freq_burden": [ - - ], - "frq": [ - [ - { - "id": "test" - }, - "test.frq:md5,7f126655f17268fd1a338734f62868e9" - ] - ], - "frq_count": [ - - ], - "gdepth": [ - - ], - "geno_chisq": [ - - ], - "geno_ld": [ - - ], - "genotypes_matrix": [ - - ], - "genotypes_matrix_individual": [ - - ], - "genotypes_matrix_position": [ - - ], - "hap_ld": [ - - ], - "hapcount": [ - - ], - "heterozygosity": [ - - ], - "hwe": [ - - ], - "idepth": [ - - ], - "impute_hap": [ - - ], - "impute_hap_indv": [ - - ], - "impute_hap_legend": [ - - ], - "indel_hist": [ - - ], - "info": [ - - ], - "interchrom_geno_ld": [ - - ], - "interchrom_hap_ld": [ - - ], - "kept_sites": [ - - ], - "ldepth": [ - - ], - "ldepth_mean": [ - - ], - "ldhat_locs": [ - - ], - "ldhat_sites": [ - - ], - "list_geno_ld": [ - - ], - "list_hap_ld": [ - - ], - "lqual": [ - - ], - "lroh": [ - - ], - "map_": [ - - ], - "mendel": [ - - ], - "missing_individual": [ - - ], - "missing_site": [ - - ], - "ped": [ - - ], - "relatedness": [ - - ], - "relatedness2": [ - - ], - "removed_sites": [ - - ], - "singeltons": [ - - ], - "sites_pi": [ - - ], - "snp_density": [ - - ], - "tajima_d": [ - - ], - "tfam": [ - - ], - "tped": [ - - ], - "tstv": [ - - ], - "tstv_count": [ - - ], - "tstv_qual": [ - - ], - "tstv_summary": [ - - ], - "vcf": [ - - ], - "versions": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "weir_fst": [ - - ], - "windowed_pi": [ - - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.0" - }, - "timestamp": "2024-03-22T13:07:21.295463" - }, - "sarscov2 - vcfgz - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test" - }, - "test.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test" - }, - "test.bcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "10": [ - [ - { - "id": "test" - }, - "test.geno.chisq:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "11": [ - [ - { - "id": "test" - }, - "test.list.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "12": [ - [ - { - "id": "test" - }, - "test.list.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "13": [ - [ - { - "id": "test" - }, - "test.interchrom.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "14": [ - [ - { - "id": "test" - }, - "test.interchrom.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "15": [ - [ - { - "id": "test" - }, - "test.TsTv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "16": [ - [ - { - "id": "test" - }, - "test.TsTv.summary:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "17": [ - [ - { - "id": "test" - }, - "test.TsTv.count:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "18": [ - [ - { - "id": "test" - }, - "test.TsTv.qual:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "19": [ - [ - { - "id": "test" - }, - "test.FILTER.summary:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test" - }, - "test.frq:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "20": [ - [ - { - "id": "test" - }, - "test.sites.pi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "21": [ - [ - { - "id": "test" - }, - "test.windowed.pi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "22": [ - [ - { - "id": "test" - }, - "test.weir.fst:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "23": [ - [ - { - "id": "test" - }, - "test.het:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "24": [ - [ - { - "id": "test" - }, - "test.hwe:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "25": [ - [ - { - "id": "test" - }, - "test.Tajima.D:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "26": [ - [ - { - "id": "test" - }, - "test.ifreqburden:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "27": [ - [ - { - "id": "test" - }, - "test.LROH:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "28": [ - [ - { - "id": "test" - }, - "test.relatedness:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "29": [ - [ - { - "id": "test" - }, - "test.relatedness2:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test" - }, - "test.frq.count:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "30": [ - [ - { - "id": "test" - }, - "test.lqual:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "31": [ - [ - { - "id": "test" - }, - "test.imiss:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "32": [ - [ - { - "id": "test" - }, - "test.lmiss:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "33": [ - [ - { - "id": "test" - }, - "test.snpden:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "34": [ - [ - { - "id": "test" - }, - "test.kept.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "35": [ - [ - { - "id": "test" - }, - "test.removed.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "36": [ - [ - { - "id": "test" - }, - "test.singletons:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "37": [ - [ - { - "id": "test" - }, - "test.indel.hist:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "38": [ - [ - { - "id": "test" - }, - "test.hapcount:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "39": [ - [ - { - "id": "test" - }, - "test.mendel:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test" - }, - "test.idepth:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "40": [ - [ - { - "id": "test" - }, - "test.FORMAT:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "41": [ - [ - { - "id": "test" - }, - "test.INFO:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "42": [ - [ - { - "id": "test" - }, - "test.012:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "43": [ - [ - { - "id": "test" - }, - "test.012.indv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "44": [ - [ - { - "id": "test" - }, - "test.012.pos:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "45": [ - [ - { - "id": "test" - }, - "test.impute.hap:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "46": [ - [ - { - "id": "test" - }, - "test.impute.hap.legend:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "47": [ - [ - { - "id": "test" - }, - "test.impute.hap.indv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "48": [ - [ - { - "id": "test" - }, - "test.ldhat.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "49": [ - [ - { - "id": "test" - }, - "test.ldhat.locs:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "5": [ - [ - { - "id": "test" - }, - "test.ldepth:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "50": [ - [ - { - "id": "test" - }, - "test.BEAGLE.GL:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "51": [ - [ - { - "id": "test" - }, - "test.BEAGLE.PL:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "52": [ - [ - { - "id": "test" - }, - "test.ped:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "53": [ - [ - { - "id": "test" - }, - "test.map:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "54": [ - [ - { - "id": "test" - }, - "test.tped:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "55": [ - [ - { - "id": "test" - }, - "test.tfam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "56": [ - [ - { - "id": "test" - }, - "test.diff.sites_in_files:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "57": [ - [ - { - "id": "test" - }, - "test.diff.indv_in_files:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "58": [ - [ - { - "id": "test" - }, - "test.diff.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "59": [ - [ - { - "id": "test" - }, - "test.diff.indv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "6": [ - [ - { - "id": "test" - }, - "test.ldepth.mean:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "60": [ - [ - { - "id": "test" - }, - "test.diff.discordance.matrix:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "61": [ - [ - { - "id": "test" - }, - "test.diff.switch:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "62": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "7": [ - [ - { - "id": "test" - }, - "test.gdepth:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "8": [ - [ - { - "id": "test" - }, - [ - "test.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.interchrom.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.list.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "9": [ - [ - { - "id": "test" - }, - [ - "test.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.interchrom.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.list.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "bcf": [ - [ - { - "id": "test" - }, - "test.bcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "beagle_gl": [ - [ - { - "id": "test" - }, - "test.BEAGLE.GL:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "beagle_pl": [ - [ - { - "id": "test" - }, - "test.BEAGLE.PL:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diff_discd_matrix": [ - [ - { - "id": "test" - }, - "test.diff.discordance.matrix:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diff_indv": [ - [ - { - "id": "test" - }, - "test.diff.indv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diff_indv_in_files": [ - [ - { - "id": "test" - }, - "test.diff.indv_in_files:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diff_sites": [ - [ - { - "id": "test" - }, - "test.diff.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diff_sites_in_files": [ - [ - { - "id": "test" - }, - "test.diff.sites_in_files:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "diff_switch_error": [ - [ - { - "id": "test" - }, - "test.diff.switch:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "filter_summary": [ - [ - { - "id": "test" - }, - "test.FILTER.summary:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "format": [ - [ - { - "id": "test" - }, - "test.FORMAT:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "freq_burden": [ - [ - { - "id": "test" - }, - "test.ifreqburden:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "frq": [ - [ - { - "id": "test" - }, - "test.frq:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "frq_count": [ - [ - { - "id": "test" - }, - "test.frq.count:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "gdepth": [ - [ - { - "id": "test" - }, - "test.gdepth:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "geno_chisq": [ - [ - { - "id": "test" - }, - "test.geno.chisq:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "geno_ld": [ - [ - { - "id": "test" - }, - [ - "test.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.interchrom.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.list.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "genotypes_matrix": [ - [ - { - "id": "test" - }, - "test.012:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "genotypes_matrix_individual": [ - [ - { - "id": "test" - }, - "test.012.indv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "genotypes_matrix_position": [ - [ - { - "id": "test" - }, - "test.012.pos:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "hap_ld": [ - [ - { - "id": "test" - }, - [ - "test.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.interchrom.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.list.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - ], - "hapcount": [ - [ - { - "id": "test" - }, - "test.hapcount:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "heterozygosity": [ - [ - { - "id": "test" - }, - "test.het:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "hwe": [ - [ - { - "id": "test" - }, - "test.hwe:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "idepth": [ - [ - { - "id": "test" - }, - "test.idepth:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "impute_hap": [ - [ - { - "id": "test" - }, - "test.impute.hap:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "impute_hap_indv": [ - [ - { - "id": "test" - }, - "test.impute.hap.indv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "impute_hap_legend": [ - [ - { - "id": "test" - }, - "test.impute.hap.legend:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "indel_hist": [ - [ - { - "id": "test" - }, - "test.indel.hist:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "info": [ - [ - { - "id": "test" - }, - "test.INFO:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "interchrom_geno_ld": [ - [ - { - "id": "test" - }, - "test.interchrom.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "interchrom_hap_ld": [ - [ - { - "id": "test" - }, - "test.interchrom.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "kept_sites": [ - [ - { - "id": "test" - }, - "test.kept.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "ldepth": [ - [ - { - "id": "test" - }, - "test.ldepth:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "ldepth_mean": [ - [ - { - "id": "test" - }, - "test.ldepth.mean:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "ldhat_locs": [ - [ - { - "id": "test" - }, - "test.ldhat.locs:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "ldhat_sites": [ - [ - { - "id": "test" - }, - "test.ldhat.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "list_geno_ld": [ - [ - { - "id": "test" - }, - "test.list.geno.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "list_hap_ld": [ - [ - { - "id": "test" - }, - "test.list.hap.ld:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "lqual": [ - [ - { - "id": "test" - }, - "test.lqual:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "lroh": [ - [ - { - "id": "test" - }, - "test.LROH:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "map_": [ - [ - { - "id": "test" - }, - "test.map:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "mendel": [ - [ - { - "id": "test" - }, - "test.mendel:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "missing_individual": [ - [ - { - "id": "test" - }, - "test.imiss:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "missing_site": [ - [ - { - "id": "test" - }, - "test.lmiss:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "ped": [ - [ - { - "id": "test" - }, - "test.ped:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "relatedness": [ - [ - { - "id": "test" - }, - "test.relatedness:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "relatedness2": [ - [ - { - "id": "test" - }, - "test.relatedness2:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "removed_sites": [ - [ - { - "id": "test" - }, - "test.removed.sites:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "singeltons": [ - [ - { - "id": "test" - }, - "test.singletons:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "sites_pi": [ - [ - { - "id": "test" - }, - "test.sites.pi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "snp_density": [ - [ - { - "id": "test" - }, - "test.snpden:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tajima_d": [ - [ - { - "id": "test" - }, - "test.Tajima.D:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tfam": [ - [ - { - "id": "test" - }, - "test.tfam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tped": [ - [ - { - "id": "test" - }, - "test.tped:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tstv": [ - [ - { - "id": "test" - }, - "test.TsTv:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tstv_count": [ - [ - { - "id": "test" - }, - "test.TsTv.count:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tstv_qual": [ - [ - { - "id": "test" - }, - "test.TsTv.qual:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "tstv_summary": [ - [ - { - "id": "test" - }, - "test.TsTv.summary:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "vcf": [ - [ - { - "id": "test" - }, - "test.vcf:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,577abe71f1ed8b94c633e71dc2cfc491" - ], - "weir_fst": [ - [ - { - "id": "test" - }, - "test.weir.fst:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "windowed_pi": [ - [ - { - "id": "test" - }, - "test.windowed.pi:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-24T13:34:42.814188" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test b/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test deleted file mode 100644 index 8aabc9bfbf..0000000000 --- a/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test +++ /dev/null @@ -1,147 +0,0 @@ -nextflow_workflow { - - name "Test Subworkflow BAM_NGSCHECKMATE" - script "../main.nf" - workflow "BAM_NGSCHECKMATE" - - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/bam_ngscheckmate" - tag "samtools" - tag "samtools/sort" - tag "samtools/index" - tag "ngscheckmate/ncm" - tag "bcftools/mpileup" - - config "./nextflow.config" - - test("sarscov2 - bam") { - - when { - - workflow { - """ - - bed_file = file('test_snp.bed') - bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" - - input[0] = Channel.fromList([ - [ - [ id:'test1' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ], - [ - [ id:'test2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam', checkIfExists: true) - ] - ]) - input[1] = Channel.of([ [id:'test_bed'], bed_file]) - input[2] = Channel.of([ - [ id:'sarscov2'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert snapshot( - workflow.out.corr_matrix, - file(workflow.out.matched[0][1]).name, - workflow.out.all, - workflow.out.vcf.collect {meta, vcf -> path(vcf).vcf.variantsMD5 }, - file(workflow.out.pdf[0][1]).name, - workflow.out.versions - ).match()} - ) - } - } - - test("sarscov2 - cram") { - - when { - - workflow { - """ - bed_file = file('test_snp.bed') - bed_file.text = "chr22\t1981\t1982\\nchr22\t2122\t2123\\nchr22\t3139\t3140\\nchr22\t3265\t3266\\nchr22\t3412\t3413" - - input[0] = Channel.fromList([[ - [ id:'test1' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) - ],[ - [ id:'test2' ], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test2.paired_end.sorted.cram', checkIfExists: true) - ] - ]) - input[1] = Channel.of([ [id:'test_bed'], bed_file]) - input[2] = Channel.of([ - [ id:'homo_sapiens'], - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert snapshot( - workflow.out.corr_matrix, - workflow.out.matched, - workflow.out.all, - workflow.out.vcf.collect {meta, vcf -> path(vcf).vcf.variantsMD5 }, - file(workflow.out.pdf[0][1]).name, - workflow.out.versions - ).match()} - ) - } - } - - test("sarscov2 - bam - stub") { - options "-stub" - when { - - workflow { - """ - - bed_file = file('test_snp.bed') - bed_file.text = "MT192765.1\t1262\t1263\\nMT192765.1\t1263\t1264\\nMT192765.1\t1575\t1576" - - input[0] = Channel.fromList([ - [ - [ id:'test1' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ], - [ - [ id:'test2' ], - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.methylated.sorted.bam', checkIfExists: true) - ] - ]) - input[1] = Channel.of([ [id:'test_bed'], bed_file]) - input[2] = Channel.of([ - [ id:'sarscov2'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll( - { assert workflow.success}, - { assert snapshot( - file(workflow.out.corr_matrix[0][1]).name, - file(workflow.out.matched[0][1]).name, - file(workflow.out.all[0][1]).name, - // workflow.out.vcf.collect {meta, vcf -> path(vcf).vcf.variantsMD5 }, - file(workflow.out.pdf[0][1]).name, - workflow.out.versions - ).match()} - ) - } - } - -} diff --git a/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap b/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap deleted file mode 100644 index 872274ec58..0000000000 --- a/subworkflows/nf-core/bam_ngscheckmate/tests/main.nf.test.snap +++ /dev/null @@ -1,99 +0,0 @@ -{ - "sarscov2 - bam - stub": { - "content": [ - "test_bed_output_corr_matrix.txt", - "test_bed_matched.txt", - "test_bed_all.txt", - "test_bed.pdf", - [ - "versions.yml:md5,73d5516e0d2dd84537b11e5eabcbe3ab", - "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8", - "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T17:50:34.789565772" - }, - "sarscov2 - cram": { - "content": [ - [ - [ - { - "id": "test_bed" - }, - "test_bed_output_corr_matrix.txt:md5,640035b6c072a17ef24ae89845109763" - ] - ], - [ - [ - { - "id": "test_bed" - }, - "test_bed_matched.txt:md5,35339268c624c8bfda5d48d80ac6fbbc" - ] - ], - [ - [ - { - "id": "test_bed" - }, - "test_bed_all.txt:md5,35339268c624c8bfda5d48d80ac6fbbc" - ] - ], - [ - "d5b1e887b104cd33f18747abd377f47a", - "30feeb598a3730af169e3d14c56a05c2" - ], - "test_bed.pdf", - [ - "versions.yml:md5,73d5516e0d2dd84537b11e5eabcbe3ab", - "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8", - "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T16:46:55.771293323" - }, - "sarscov2 - bam": { - "content": [ - [ - [ - { - "id": "test_bed" - }, - "test_bed_output_corr_matrix.txt:md5,3a23347ff7071d5d8e273bfc29731d4a" - ] - ], - "test_bed_matched.txt", - [ - [ - { - "id": "test_bed" - }, - "test_bed_all.txt:md5,7e6ca5eb3daf6f589ea20fa117269edf" - ] - ], - [ - "9341ed6b9cca02d6b0b822308f4a48c6", - "3d6ba59b24dc0a699d9bd5a78bc76869" - ], - "test_bed.pdf", - [ - "versions.yml:md5,73d5516e0d2dd84537b11e5eabcbe3ab", - "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8", - "versions.yml:md5,d0f4716ff5035090e3129d50d029e7c8" - ] - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.5" - }, - "timestamp": "2025-04-01T17:45:22.458317234" - } -} diff --git a/subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config b/subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config deleted file mode 100644 index 7871837f5c..0000000000 --- a/subworkflows/nf-core/bam_ngscheckmate/tests/nextflow.config +++ /dev/null @@ -1,9 +0,0 @@ -process { - withName: ".*BAM_NGSCHECKMATE:BCFTOOLS_MPILEUP" { - ext.args2 = '--no-version --ploidy 1 -c' - ext.args3 = '--no-version' - } - withName: ".*BAM_NGSCHECKMATE:NGSCHECKMATE_NCM" { - ext.args = '-V' - } -} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test deleted file mode 100644 index 68718e4f59..0000000000 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test +++ /dev/null @@ -1,54 +0,0 @@ - -nextflow_function { - - name "Test Functions" - script "subworkflows/nf-core/utils_nextflow_pipeline/main.nf" - config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" - tag 'subworkflows' - tag 'utils_nextflow_pipeline' - tag 'subworkflows/utils_nextflow_pipeline' - - test("Test Function getWorkflowVersion") { - - function "getWorkflowVersion" - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function dumpParametersToJSON") { - - function "dumpParametersToJSON" - - when { - function { - """ - // define inputs of the function here. Example: - input[0] = "$outputDir" - """.stripIndent() - } - } - - then { - assertAll( - { assert function.success } - ) - } - } - - test("Test Function checkCondaChannels") { - - function "checkCondaChannels" - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap deleted file mode 100644 index e3f0baf473..0000000000 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap +++ /dev/null @@ -1,20 +0,0 @@ -{ - "Test Function getWorkflowVersion": { - "content": [ - "v9.9.9" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:02:05.308243" - }, - "Test Function checkCondaChannels": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:02:12.425833" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test deleted file mode 100644 index ca964ce8e1..0000000000 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test +++ /dev/null @@ -1,111 +0,0 @@ -nextflow_workflow { - - name "Test Workflow UTILS_NEXTFLOW_PIPELINE" - script "../main.nf" - config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" - workflow "UTILS_NEXTFLOW_PIPELINE" - tag 'subworkflows' - tag 'utils_nextflow_pipeline' - tag 'subworkflows/utils_nextflow_pipeline' - - test("Should run no inputs") { - - when { - workflow { - """ - print_version = false - dump_parameters = false - outdir = null - check_conda_channels = false - - input[0] = print_version - input[1] = dump_parameters - input[2] = outdir - input[3] = check_conda_channels - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should print version") { - - when { - workflow { - """ - print_version = true - dump_parameters = false - outdir = null - check_conda_channels = false - - input[0] = print_version - input[1] = dump_parameters - input[2] = outdir - input[3] = check_conda_channels - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.stdout.contains("nextflow_workflow v9.9.9") } - ) - } - } - - test("Should dump params") { - - when { - workflow { - """ - print_version = false - dump_parameters = true - outdir = 'results' - check_conda_channels = false - - input[0] = false - input[1] = true - input[2] = outdir - input[3] = false - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should not create params JSON if no output directory") { - - when { - workflow { - """ - print_version = false - dump_parameters = true - outdir = null - check_conda_channels = false - - input[0] = false - input[1] = true - input[2] = outdir - input[3] = false - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config deleted file mode 100644 index a09572e5bb..0000000000 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config +++ /dev/null @@ -1,9 +0,0 @@ -manifest { - name = 'nextflow_workflow' - author = """nf-core""" - homePage = 'https://127.0.0.1' - description = """Dummy pipeline""" - nextflowVersion = '!>=23.04.0' - version = '9.9.9' - doi = 'https://doi.org/10.5281/zenodo.5070524' -} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml deleted file mode 100644 index f84761125a..0000000000 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/utils_nextflow_pipeline: - - subworkflows/nf-core/utils_nextflow_pipeline/** diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test deleted file mode 100644 index 1dc317f8f7..0000000000 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test +++ /dev/null @@ -1,134 +0,0 @@ - -nextflow_function { - - name "Test Functions" - script "../main.nf" - config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "utils_nfcore_pipeline" - tag "subworkflows/utils_nfcore_pipeline" - - test("Test Function checkConfigProvided") { - - function "checkConfigProvided" - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function checkProfileProvided") { - - function "checkProfileProvided" - - when { - function { - """ - input[0] = [] - """ - } - } - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function workflowCitation") { - - function "workflowCitation" - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function nfCoreLogo") { - - function "nfCoreLogo" - - when { - function { - """ - input[0] = false - """ - } - } - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function dashedLine") { - - function "dashedLine" - - when { - function { - """ - input[0] = false - """ - } - } - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function without logColours") { - - function "logColours" - - when { - function { - """ - input[0] = true - """ - } - } - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function with logColours") { - function "logColours" - - when { - function { - """ - input[0] = false - """ - } - } - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap deleted file mode 100644 index 1037232c9e..0000000000 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap +++ /dev/null @@ -1,166 +0,0 @@ -{ - "Test Function checkProfileProvided": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:03.360873" - }, - "Test Function checkConfigProvided": { - "content": [ - true - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:02:59.729647" - }, - "Test Function nfCoreLogo": { - "content": [ - "\n\n-\u001b[2m----------------------------------------------------\u001b[0m-\n \u001b[0;32m,--.\u001b[0;30m/\u001b[0;32m,-.\u001b[0m\n\u001b[0;34m ___ __ __ __ ___ \u001b[0;32m/,-._.--~'\u001b[0m\n\u001b[0;34m |\\ | |__ __ / ` / \\ |__) |__ \u001b[0;33m} {\u001b[0m\n\u001b[0;34m | \\| | \\__, \\__/ | \\ |___ \u001b[0;32m\\`-._,-`-,\u001b[0m\n \u001b[0;32m`._,._,'\u001b[0m\n\u001b[0;35m nextflow_workflow v9.9.9\u001b[0m\n-\u001b[2m----------------------------------------------------\u001b[0m-\n" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:10.562934" - }, - "Test Function workflowCitation": { - "content": [ - "If you use nextflow_workflow for your analysis please cite:\n\n* The pipeline\n https://doi.org/10.5281/zenodo.5070524\n\n* The nf-core framework\n https://doi.org/10.1038/s41587-020-0439-x\n\n* Software dependencies\n https://github.com/nextflow_workflow/blob/master/CITATIONS.md" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:07.019761" - }, - "Test Function without logColours": { - "content": [ - { - "reset": "", - "bold": "", - "dim": "", - "underlined": "", - "blink": "", - "reverse": "", - "hidden": "", - "black": "", - "red": "", - "green": "", - "yellow": "", - "blue": "", - "purple": "", - "cyan": "", - "white": "", - "bblack": "", - "bred": "", - "bgreen": "", - "byellow": "", - "bblue": "", - "bpurple": "", - "bcyan": "", - "bwhite": "", - "ublack": "", - "ured": "", - "ugreen": "", - "uyellow": "", - "ublue": "", - "upurple": "", - "ucyan": "", - "uwhite": "", - "iblack": "", - "ired": "", - "igreen": "", - "iyellow": "", - "iblue": "", - "ipurple": "", - "icyan": "", - "iwhite": "", - "biblack": "", - "bired": "", - "bigreen": "", - "biyellow": "", - "biblue": "", - "bipurple": "", - "bicyan": "", - "biwhite": "" - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:17.969323" - }, - "Test Function dashedLine": { - "content": [ - "-\u001b[2m----------------------------------------------------\u001b[0m-" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:14.366181" - }, - "Test Function with logColours": { - "content": [ - { - "reset": "\u001b[0m", - "bold": "\u001b[1m", - "dim": "\u001b[2m", - "underlined": "\u001b[4m", - "blink": "\u001b[5m", - "reverse": "\u001b[7m", - "hidden": "\u001b[8m", - "black": "\u001b[0;30m", - "red": "\u001b[0;31m", - "green": "\u001b[0;32m", - "yellow": "\u001b[0;33m", - "blue": "\u001b[0;34m", - "purple": "\u001b[0;35m", - "cyan": "\u001b[0;36m", - "white": "\u001b[0;37m", - "bblack": "\u001b[1;30m", - "bred": "\u001b[1;31m", - "bgreen": "\u001b[1;32m", - "byellow": "\u001b[1;33m", - "bblue": "\u001b[1;34m", - "bpurple": "\u001b[1;35m", - "bcyan": "\u001b[1;36m", - "bwhite": "\u001b[1;37m", - "ublack": "\u001b[4;30m", - "ured": "\u001b[4;31m", - "ugreen": "\u001b[4;32m", - "uyellow": "\u001b[4;33m", - "ublue": "\u001b[4;34m", - "upurple": "\u001b[4;35m", - "ucyan": "\u001b[4;36m", - "uwhite": "\u001b[4;37m", - "iblack": "\u001b[0;90m", - "ired": "\u001b[0;91m", - "igreen": "\u001b[0;92m", - "iyellow": "\u001b[0;93m", - "iblue": "\u001b[0;94m", - "ipurple": "\u001b[0;95m", - "icyan": "\u001b[0;96m", - "iwhite": "\u001b[0;97m", - "biblack": "\u001b[1;90m", - "bired": "\u001b[1;91m", - "bigreen": "\u001b[1;92m", - "biyellow": "\u001b[1;93m", - "biblue": "\u001b[1;94m", - "bipurple": "\u001b[1;95m", - "bicyan": "\u001b[1;96m", - "biwhite": "\u001b[1;97m" - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:21.714424" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test deleted file mode 100644 index 8940d32d1e..0000000000 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test +++ /dev/null @@ -1,29 +0,0 @@ -nextflow_workflow { - - name "Test Workflow UTILS_NFCORE_PIPELINE" - script "../main.nf" - config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" - workflow "UTILS_NFCORE_PIPELINE" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "utils_nfcore_pipeline" - tag "subworkflows/utils_nfcore_pipeline" - - test("Should run without failures") { - - when { - workflow { - """ - input[0] = [] - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert snapshot(workflow.out).match() } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap deleted file mode 100644 index 859d1030fb..0000000000 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap +++ /dev/null @@ -1,19 +0,0 @@ -{ - "Should run without failures": { - "content": [ - { - "0": [ - true - ], - "valid_config": [ - true - ] - } - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:25.726491" - } -} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config deleted file mode 100644 index d0a926bf6d..0000000000 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config +++ /dev/null @@ -1,9 +0,0 @@ -manifest { - name = 'nextflow_workflow' - author = """nf-core""" - homePage = 'https://127.0.0.1' - description = """Dummy pipeline""" - nextflowVersion = '!>=23.04.0' - version = '9.9.9' - doi = 'https://doi.org/10.5281/zenodo.5070524' -} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml deleted file mode 100644 index ac8523c9a2..0000000000 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/utils_nfcore_pipeline: - - subworkflows/nf-core/utils_nfcore_pipeline/** diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test deleted file mode 100644 index 8fb3016487..0000000000 --- a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test +++ /dev/null @@ -1,117 +0,0 @@ -nextflow_workflow { - - name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" - script "../main.nf" - workflow "UTILS_NFSCHEMA_PLUGIN" - - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/utils_nfschema_plugin" - tag "plugin/nf-schema" - - config "./nextflow.config" - - test("Should run nothing") { - - when { - - params { - test_data = '' - } - - workflow { - """ - validate_params = false - input[0] = workflow - input[1] = validate_params - input[2] = "" - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should validate params") { - - when { - - params { - test_data = '' - outdir = null - } - - workflow { - """ - validate_params = true - input[0] = workflow - input[1] = validate_params - input[2] = "" - """ - } - } - - then { - assertAll( - { assert workflow.failed }, - { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } - ) - } - } - - test("Should run nothing - custom schema") { - - when { - - params { - test_data = '' - } - - workflow { - """ - validate_params = false - input[0] = workflow - input[1] = validate_params - input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should validate params - custom schema") { - - when { - - params { - test_data = '' - outdir = null - } - - workflow { - """ - validate_params = true - input[0] = workflow - input[1] = validate_params - input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" - """ - } - } - - then { - assertAll( - { assert workflow.failed }, - { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config deleted file mode 100644 index 0907ac58f0..0000000000 --- a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config +++ /dev/null @@ -1,8 +0,0 @@ -plugins { - id "nf-schema@2.1.0" -} - -validation { - parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" - monochromeLogs = true -} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json deleted file mode 100644 index 331e0d2f44..0000000000 --- a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json +++ /dev/null @@ -1,96 +0,0 @@ -{ - "$schema": "https://json-schema.org/draft/2020-12/schema", - "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", - "title": ". pipeline parameters", - "description": "", - "type": "object", - "$defs": { - "input_output_options": { - "title": "Input/output options", - "type": "object", - "fa_icon": "fas fa-terminal", - "description": "Define where the pipeline should find input data and save output data.", - "required": ["outdir"], - "properties": { - "validate_params": { - "type": "boolean", - "description": "Validate parameters?", - "default": true, - "hidden": true - }, - "outdir": { - "type": "string", - "format": "directory-path", - "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", - "fa_icon": "fas fa-folder-open" - }, - "test_data_base": { - "type": "string", - "default": "https://raw.githubusercontent.com/nf-core/test-datasets/modules", - "description": "Base for test data directory", - "hidden": true - }, - "test_data": { - "type": "string", - "description": "Fake test data param", - "hidden": true - } - } - }, - "generic_options": { - "title": "Generic options", - "type": "object", - "fa_icon": "fas fa-file-import", - "description": "Less common options for the pipeline, typically set in a config file.", - "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", - "properties": { - "help": { - "type": "boolean", - "description": "Display help text.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, - "version": { - "type": "boolean", - "description": "Display version and exit.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, - "logo": { - "type": "boolean", - "default": true, - "description": "Display nf-core logo in console output.", - "fa_icon": "fas fa-image", - "hidden": true - }, - "singularity_pull_docker_container": { - "type": "boolean", - "description": "Pull Singularity container from Docker?", - "hidden": true - }, - "publish_dir_mode": { - "type": "string", - "default": "copy", - "description": "Method used to save pipeline results to output directory.", - "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", - "fa_icon": "fas fa-copy", - "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], - "hidden": true - }, - "monochrome_logs": { - "type": "boolean", - "description": "Use monochrome_logs", - "hidden": true - } - } - } - }, - "allOf": [ - { - "$ref": "#/$defs/input_output_options" - }, - { - "$ref": "#/$defs/generic_options" - } - ] -} From 3271777eb87b1e34eb964fa0b551ee41265cd497 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 17:54:29 +0200 Subject: [PATCH 03/38] update modules --- modules.json | 16 +- modules/nf-core/bcftools/norm/environment.yml | 4 +- modules/nf-core/bcftools/norm/main.nf | 4 +- modules/nf-core/fastqc/main.nf | 22 +- modules/nf-core/multiqc/environment.yml | 4 - modules/nf-core/multiqc/main.nf | 42 +-- modules/nf-core/parabricks/fq2bam/meta.yml | 2 +- .../parabricks/fq2bam/tests/main.nf.test | 308 ----------------- .../parabricks/fq2bam/tests/main.nf.test.snap | 323 ------------------ .../parabricks/fq2bam/tests/nextflow.config | 7 - modules/nf-core/sentieon/applyvarcal/main.nf | 17 +- .../nf-core/sentieon/dnamodelapply/main.nf | 8 +- .../nf-core/sentieon/dnamodelapply/meta.yml | 2 +- modules/nf-core/sentieon/dnascope/main.nf | 31 +- modules/nf-core/sentieon/varcal/main.nf | 7 +- 15 files changed, 81 insertions(+), 716 deletions(-) delete mode 100644 modules/nf-core/parabricks/fq2bam/tests/main.nf.test delete mode 100644 modules/nf-core/parabricks/fq2bam/tests/main.nf.test.snap delete mode 100644 modules/nf-core/parabricks/fq2bam/tests/nextflow.config diff --git a/modules.json b/modules.json index f7b0e0574c..19ef5b63ec 100644 --- a/modules.json +++ b/modules.json @@ -28,7 +28,7 @@ }, "bcftools/norm": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", "installed_by": ["modules"] }, "bcftools/sort": { @@ -159,7 +159,7 @@ }, "fastqc": { "branch": "master", - "git_sha": "08108058ea36a63f141c25c4e75f9f872a5b2296", + "git_sha": "b1966f36ec9de31927b2603d8f499960b2a4c294", "installed_by": ["modules"] }, "fgbio/callmolecularconsensusreads": { @@ -355,7 +355,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "f0719ae309075ae4a291533883847c3f7c441dad", + "git_sha": "7b50cb7be890e4b28cffb82e438cc6a8d7805d3f", "installed_by": ["modules"] }, "muse/call": { @@ -375,7 +375,7 @@ }, "parabricks/fq2bam": { "branch": "master", - "git_sha": "5d0cf64bd1ad528926b5c6313ed82f59d8121e73", + "git_sha": "083667c2f0d3b57aa373ffa8891d04b3c839b0b4", "installed_by": ["modules"] }, "samblaster": { @@ -430,7 +430,7 @@ }, "sentieon/applyvarcal": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", "installed_by": ["modules"] }, "sentieon/bwamem": { @@ -445,12 +445,12 @@ }, "sentieon/dnamodelapply": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", "installed_by": ["modules"] }, "sentieon/dnascope": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", "installed_by": ["modules"] }, "sentieon/gvcftyper": { @@ -465,7 +465,7 @@ }, "sentieon/varcal": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", "installed_by": ["modules"] }, "snpeff/download": { diff --git a/modules/nf-core/bcftools/norm/environment.yml b/modules/nf-core/bcftools/norm/environment.yml index 5c00b116ad..557488607c 100644 --- a/modules/nf-core/bcftools/norm/environment.yml +++ b/modules/nf-core/bcftools/norm/environment.yml @@ -1,5 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda dependencies: - - bioconda::bcftools=1.20 + - bioconda::bcftools=1.21 diff --git a/modules/nf-core/bcftools/norm/main.nf b/modules/nf-core/bcftools/norm/main.nf index bd7a250127..3b226f2748 100644 --- a/modules/nf-core/bcftools/norm/main.nf +++ b/modules/nf-core/bcftools/norm/main.nf @@ -4,8 +4,8 @@ process BCFTOOLS_NORM { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.20--h8b25389_0': - 'biocontainers/bcftools:1.20--h8b25389_0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/5a/5acacb55c52bec97c61fd34ffa8721fce82ce823005793592e2a80bf71632cd0/data': + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: tuple val(meta), path(vcf), path(tbi) diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 70ebca3c31..23e16634c3 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -3,33 +3,33 @@ process FASTQC { label 'process_medium' conda "${moduleDir}/environment.yml" - container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container - ? 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' - : 'biocontainers/fastqc:0.12.1--hdfd78af_0'}" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" input: tuple val(meta), path(reads) output: tuple val(meta), path("*.html"), emit: html - tuple val(meta), path("*.zip"), emit: zip - path "versions.yml", emit: versions + tuple val(meta), path("*.zip") , emit: zip + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" // Make list of old name and new name pairs to use for renaming in the bash while loop - def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[reads, "${prefix}.${reads.extension}"]] : reads.withIndex().collect { entry, index -> [entry, "${prefix}_${index + 1}.${entry.extension}"] } - def rename_to = old_new_pairs*.join(' ').join(' ') - def renamed_files = old_new_pairs.collect { _old_name, new_name -> new_name }.join(' ') + def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } + def rename_to = old_new_pairs*.join(' ').join(' ') + def renamed_files = old_new_pairs.collect{ _old_name, new_name -> new_name }.join(' ') // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label - def memory_in_mb = task.memory ? task.memory.toUnit('MB').toFloat() / task.cpus : null + def memory_in_mb = task.memory ? task.memory.toUnit('MB') / task.cpus : null // FastQC memory value allowed range (100 - 10000) def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index 2a00fe3176..d430da5f7c 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -4,8 +4,4 @@ channels: - conda-forge - bioconda dependencies: -<<<<<<< HEAD - bioconda::multiqc=1.28 -======= - - bioconda::multiqc=1.27 ->>>>>>> dev diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 809f61820a..f3b5704720 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -2,23 +2,23 @@ process MULTIQC { label 'process_single' conda "${moduleDir}/environment.yml" - container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container - ? 'https://depot.galaxyproject.org/singularity/multiqc:1.27--pyhdfd78af_0' - : 'biocontainers/multiqc:1.27--pyhdfd78af_0'}" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/multiqc:1.28--pyhdfd78af_0' : + 'biocontainers/multiqc:1.28--pyhdfd78af_0' }" input: - path multiqc_files, stageAs: "?/*" - path multiqc_config - path extra_multiqc_config - path multiqc_logo - path replace_names - path sample_names + path multiqc_files, stageAs: "?/*" + path(multiqc_config) + path(extra_multiqc_config) + path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report - path "*_data", emit: data - path "*_plots", optional: true, emit: plots - path "versions.yml", emit: versions + path "*_data" , emit: data + path "*_plots" , optional:true, emit: plots + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -26,21 +26,21 @@ process MULTIQC { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' - def config = multiqc_config ? "--config ${multiqc_config}" : '' - def extra_config = extra_multiqc_config ? "--config ${extra_multiqc_config}" : '' + def config = multiqc_config ? "--config $multiqc_config" : '' + def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' def replace = replace_names ? "--replace-names ${replace_names}" : '' def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ - ${args} \\ - ${config} \\ - ${prefix} \\ - ${extra_config} \\ - ${logo} \\ - ${replace} \\ - ${samples} \\ + $args \\ + $config \\ + $prefix \\ + $extra_config \\ + $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/parabricks/fq2bam/meta.yml b/modules/nf-core/parabricks/fq2bam/meta.yml index 75b508cd5c..29db756200 100644 --- a/modules/nf-core/parabricks/fq2bam/meta.yml +++ b/modules/nf-core/parabricks/fq2bam/meta.yml @@ -11,7 +11,7 @@ tools: - "parabricks": description: "NVIDIA Clara Parabricks GPU-accelerated genomics tools" homepage: "https://www.nvidia.com/en-us/clara/genomics/" - documentation: "https://docs.nvidia.com/clara/parabricks/4.0.1/Documentation/" + documentation: "https://docs.nvidia.com/clara/parabricks/latest/index.html" licence: ["custom"] identifier: "" input: diff --git a/modules/nf-core/parabricks/fq2bam/tests/main.nf.test b/modules/nf-core/parabricks/fq2bam/tests/main.nf.test deleted file mode 100644 index afa16c7292..0000000000 --- a/modules/nf-core/parabricks/fq2bam/tests/main.nf.test +++ /dev/null @@ -1,308 +0,0 @@ -nextflow_process { - - name "Test Process PARABRICKS_FQ2BAM" - script "../main.nf" - process "PARABRICKS_FQ2BAM" - - tag "bwa/index" - tag "modules" - tag "parabricks/fq2bam" - tag "modules_nfcore" - tag "parabricks" - tag "gpu" - - config './nextflow.config' - - setup { - run("BWA_INDEX") { - script "../../../bwa/index/main.nf" - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file('https://github.com/nf-core/test-datasets/raw/methylseq/reference/genome.fa', checkIfExists: true) - ]) - """ - } - } - - run("BWA_INDEX", alias: 'BWA_INDEX_PE') { - script "../../../bwa/index/main.nf" - process { - """ - input[0] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - """ - } - } - - run("BWA_INDEX", alias: 'BWA_INDEX_CRAM') { - script "../../../bwa/index/main.nf" - process { - """ - input[0] = [ - [id: 'test'], - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ] - """ - } - } - } - - test("SRR389222 - fastq - se") { - - config './nextflow.config' - - when { - params { - module_args = '--low-memory' - // Ref: https://forums.developer.nvidia.com/t/problem-with-gpu/256825/6 - // Parabricks’s fq2bam requires 24GB of memory. - // Using --low-memory for testing - } - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ - file('https://github.com/nf-core/test-datasets/raw/methylseq/testdata/SRR389222_sub1.fastq.gz', checkIfExists: true) - ] - ]) - input[1] = Channel.of([ - [ id:'test' ], // meta map - file('https://github.com/nf-core/test-datasets/raw/methylseq/reference/genome.fa', checkIfExists: true) - ]) - input[2] = BWA_INDEX.out.index - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = 'bam' - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getReadsMD5(), - file(process.out.bai[0][1]).name, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("SRR389222 - fastq - se - stub") { - - options '-stub' - - when { - params { - module_args = '' - } - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ - file('https://github.com/nf-core/test-datasets/raw/methylseq/testdata/SRR389222_sub1.fastq.gz', checkIfExists: true) - ] - ]) - input[1] = Channel.of([ - [ id:'test' ], // meta map - file('https://github.com/nf-core/test-datasets/raw/methylseq/reference/genome.fa', checkIfExists: true) - ]) - input[2] = BWA_INDEX.out.index - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = 'bam' - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - } - - test("sarscov2 - fastq - pe") { - - when { - params { - module_args = '--low-memory' - // Ref: https://forums.developer.nvidia.com/t/problem-with-gpu/256825/6 - // Parabricks’s fq2bam requires 24GB of memory. - // Using --low-memory for testing - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - input[2] = BWA_INDEX_PE.out.index - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = 'bam' - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - bam(process.out.bam[0][1]).getReadsMD5(), - file(process.out.bai[0][1]).name, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - fastq - pe - stub") { - - options '-stub' - - when { - params { - module_args = '' - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - input[2] = BWA_INDEX_PE.out.index - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = 'bam' - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - fastq - se - cram") { - - when { - params { - module_args = '--low-memory' - // Ref: https://forums.developer.nvidia.com/t/problem-with-gpu/256825/6 - // Parabricks’s fq2bam requires 24GB of memory. - // Using --low-memory for testing - } - process { - """ - input[0] = [ - [ id:'test', single_end:true ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ] - ] - input[1] = [[id: 'test'],file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] - input[2] = BWA_INDEX_CRAM.out.index - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = 'cram' - """ - } - } - - then { - def fasta = "https://raw.githubusercontent.com/nf-core/test-datasets/refs/heads/modules/data/genomics/sarscov2/genome/genome.fasta" - assertAll( - { assert process.success }, - { assert snapshot( - cram( - process.out.cram[0][1], - fasta, - ).getReadsMD5(), - file(process.out.crai[0][1]).name, - process.out.versions, - path(process.out.versions[0]).yaml - ).match() } - ) - } - - } - - test("sarscov2 - fastq - pe - cram - stub") { - - options '-stub' - - when { - params { - module_args = '' - } - process { - """ - input[0] = [ - [ id:'test', single_end:false ], // meta map - [ - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) - ] - ] - input[1] = Channel.of([ - [ id:'test' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) - ]) - input[2] = BWA_INDEX_PE.out.index - input[3] = [ [], [] ] - input[4] = [ [], [] ] - input[5] = 'cram' - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out, - path(process.out.versions[0]).yaml - ).match() - } - ) - } - - } - -} \ No newline at end of file diff --git a/modules/nf-core/parabricks/fq2bam/tests/main.nf.test.snap b/modules/nf-core/parabricks/fq2bam/tests/main.nf.test.snap deleted file mode 100644 index 57d6bb78ba..0000000000 --- a/modules/nf-core/parabricks/fq2bam/tests/main.nf.test.snap +++ /dev/null @@ -1,323 +0,0 @@ -{ - "SRR389222 - fastq - se - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - - ], - "7": [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ], - "bai": [ - [ - { - "id": "test", - "single_end": true - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "bam": [ - [ - { - "id": "test", - "single_end": true - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "bqsr_table": [ - - ], - "crai": [ - - ], - "cram": [ - - ], - "duplicate_metrics": [ - - ], - "qc_metrics": [ - - ], - "versions": [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ] - }, - { - "PARABRICKS_FQ2BAM": { - "pbrun": "4.4.0-1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-27T11:46:55.631178258" - }, - "sarscov2 - fastq - pe - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - - ], - "3": [ - - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - - ], - "7": [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ], - "bai": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "bam": [ - [ - { - "id": "test", - "single_end": false - }, - "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "bqsr_table": [ - - ], - "crai": [ - - ], - "cram": [ - - ], - "duplicate_metrics": [ - - ], - "qc_metrics": [ - - ], - "versions": [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ] - }, - { - "PARABRICKS_FQ2BAM": { - "pbrun": "4.4.0-1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-27T11:48:09.468174786" - }, - "sarscov2 - fastq - pe": { - "content": [ - "2d64e4363d9f3c0e2167fce49d5087cf", - "test.bam.bai", - [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ], - { - "PARABRICKS_FQ2BAM": { - "pbrun": "4.4.0-1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.2" - }, - "timestamp": "2024-12-16T12:25:23.63061876" - }, - "sarscov2 - fastq - se - cram": { - "content": [ - "30c325e1e032eb1782a280d34c0fb1c7", - "test.cram.crai", - [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ], - { - "PARABRICKS_FQ2BAM": { - "pbrun": "4.4.0-1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-20T15:28:05.839124732" - }, - "sarscov2 - fastq - pe - cram - stub": { - "content": [ - { - "0": [ - - ], - "1": [ - - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - - ], - "7": [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ], - "bai": [ - - ], - "bam": [ - - ], - "bqsr_table": [ - - ], - "crai": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "cram": [ - [ - { - "id": "test", - "single_end": false - }, - "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "duplicate_metrics": [ - - ], - "qc_metrics": [ - - ], - "versions": [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ] - }, - { - "PARABRICKS_FQ2BAM": { - "pbrun": "4.4.0-1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.4" - }, - "timestamp": "2025-02-27T11:49:34.618772489" - }, - "SRR389222 - fastq - se": { - "content": [ - "3d5b94990c7fdf90a682edb5ee0f59de", - "test.bam.bai", - [ - "versions.yml:md5,55d1e67ef8fa9d0ea3065363a653ffef" - ], - { - "PARABRICKS_FQ2BAM": { - "pbrun": "4.4.0-1" - } - } - ], - "meta": { - "nf-test": "0.9.2", - "nextflow": "24.10.2" - }, - "timestamp": "2024-12-16T12:24:32.45197929" - } -} \ No newline at end of file diff --git a/modules/nf-core/parabricks/fq2bam/tests/nextflow.config b/modules/nf-core/parabricks/fq2bam/tests/nextflow.config deleted file mode 100644 index 6f58b220de..0000000000 --- a/modules/nf-core/parabricks/fq2bam/tests/nextflow.config +++ /dev/null @@ -1,7 +0,0 @@ -process { - - withName: 'PARABRICKS_FQ2BAM' { - ext.args = params.module_args - } - -} diff --git a/modules/nf-core/sentieon/applyvarcal/main.nf b/modules/nf-core/sentieon/applyvarcal/main.nf index 724912d689..6427b13392 100644 --- a/modules/nf-core/sentieon/applyvarcal/main.nf +++ b/modules/nf-core/sentieon/applyvarcal/main.nf @@ -22,19 +22,24 @@ process SENTIEON_APPLYVARCAL { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' + def prefix = task.ext.prefix ?: "${meta.id}_applyvarcal" def sentieonLicense = secrets.SENTIEON_LICENSE_BASE64 ? "export SENTIEON_LICENSE=\$(mktemp);echo -e \"${secrets.SENTIEON_LICENSE_BASE64}\" | base64 -d > \$SENTIEON_LICENSE; " : "" """ $sentieonLicense - sentieon driver -r ${fasta} --algo ApplyVarCal \\ + sentieon driver \\ + -r ${fasta} \\ + -t $task.cpus \\ + $args \\ + --algo ApplyVarCal \\ -v $vcf \\ --recal $recal \\ --tranches_file $tranches \\ - $args \\ + $args2 \\ ${prefix}.vcf.gz cat <<-END_VERSIONS > versions.yml @@ -44,9 +49,9 @@ process SENTIEON_APPLYVARCAL { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}_applyvarcal" """ - touch ${prefix}.vcf.gz + echo | gzip > ${prefix}.vcf.gz touch ${prefix}.vcf.gz.tbi cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/sentieon/dnamodelapply/main.nf b/modules/nf-core/sentieon/dnamodelapply/main.nf index 85fd601b39..b74e65a09f 100644 --- a/modules/nf-core/sentieon/dnamodelapply/main.nf +++ b/modules/nf-core/sentieon/dnamodelapply/main.nf @@ -16,7 +16,7 @@ process SENTIEON_DNAMODELAPPLY { output: tuple val(meta), path("*.vcf.gz") , emit: vcf - tuple val(meta), path("*.vcf.gz.tbi"), emit: index + tuple val(meta), path("*.vcf.gz.tbi"), emit: tbi path "versions.yml" , emit: versions when: @@ -24,7 +24,7 @@ process SENTIEON_DNAMODELAPPLY { script: def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}_applied" def sentieonLicense = secrets.SENTIEON_LICENSE_BASE64 ? "export SENTIEON_LICENSE=\$(mktemp);echo -e \"${secrets.SENTIEON_LICENSE_BASE64}\" | base64 -d > \$SENTIEON_LICENSE; " : "" @@ -47,9 +47,9 @@ process SENTIEON_DNAMODELAPPLY { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}_applied" """ - touch ${prefix}.vcf.gz + echo | gzip > ${prefix}.vcf.gz touch ${prefix}.vcf.gz.tbi cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/sentieon/dnamodelapply/meta.yml b/modules/nf-core/sentieon/dnamodelapply/meta.yml index 2505aff74e..b730641112 100644 --- a/modules/nf-core/sentieon/dnamodelapply/meta.yml +++ b/modules/nf-core/sentieon/dnamodelapply/meta.yml @@ -65,7 +65,7 @@ output: type: file description: INPUT VCF file pattern: "*.{vcf,vcf.gz}" - - index: + - tbi: - meta: type: map description: | diff --git a/modules/nf-core/sentieon/dnascope/main.nf b/modules/nf-core/sentieon/dnascope/main.nf index bdeb62521a..c15b4c3dd8 100644 --- a/modules/nf-core/sentieon/dnascope/main.nf +++ b/modules/nf-core/sentieon/dnascope/main.nf @@ -30,17 +30,17 @@ process SENTIEON_DNASCOPE { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' // options for the driver - def args2 = task.ext.args2 ?: '' // options for the vcf generation - def args3 = task.ext.args3 ?: '' // options for the gvcf generation - def interval = intervals ? "--interval ${intervals}" : '' - def dbsnp_cmd = dbsnp ? "-d ${dbsnp}" : '' - def model_cmd = ml_model ? " --model ${ml_model}" : '' - def pcr_indel_model_cmd = pcr_indel_model ? " --pcr_indel_model ${pcr_indel_model}" : '' - def prefix = task.ext.prefix ?: "${meta.id}" - def vcf_cmd = "" - def gvcf_cmd = "" - def base_cmd = '--algo DNAscope ' + dbsnp_cmd + ' ' + def args = task.ext.args ?: '' // options for the driver + def args2 = task.ext.args2 ?: '' // options for the vcf generation + def args3 = task.ext.args3 ?: '' // options for the gvcf generation + def interval = intervals ? "--interval ${intervals}" : '' + def dbsnp_cmd = dbsnp ? "-d ${dbsnp}" : '' + def model_cmd = ml_model ? " --model ${ml_model}" : '' + def pcr_indel_model_cmd = pcr_indel_model ? " --pcr_indel_model ${pcr_indel_model}" : '' + def prefix = task.ext.prefix ?: "${meta.id}" + def vcf_cmd = "" + def gvcf_cmd = "" + def base_cmd = '--algo DNAscope ' + dbsnp_cmd + ' ' if (emit_vcf) { // emit_vcf can be the empty string, 'variant', 'confident' or 'all' but NOT 'gvcf' vcf_cmd = base_cmd + args2 + ' ' + model_cmd + pcr_indel_model_cmd + ' --emit_mode ' + emit_vcf + ' ' + prefix + '.unfiltered.vcf.gz' @@ -65,12 +65,13 @@ process SENTIEON_DNASCOPE { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}" + def gvcf_cmd = emit_gvcf ? "echo | gzip > ${prefix}.g.vcf.gz; touch ${prefix}.g.vcf.gz.tbi": "" + """ - touch ${prefix}.unfiltered.vcf.gz + echo | gzip > ${prefix}.unfiltered.vcf.gz touch ${prefix}.unfiltered.vcf.gz.tbi - touch ${prefix}.g.vcf.gz - touch ${prefix}.g.vcf.gz.tbi + $gvcf_cmd cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/sentieon/varcal/main.nf b/modules/nf-core/sentieon/varcal/main.nf index d78eacb44a..fb841c9117 100644 --- a/modules/nf-core/sentieon/varcal/main.nf +++ b/modules/nf-core/sentieon/varcal/main.nf @@ -20,16 +20,15 @@ process SENTIEON_VARCAL { tuple val(meta), path("*.recal") , emit: recal tuple val(meta), path("*.idx") , emit: idx tuple val(meta), path("*.tranches"), emit: tranches - tuple val(meta), path("*plots.R") , emit: plots, optional:true + tuple val(meta), path("*plots.R") , emit: plots , optional:true path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def reference_command = fasta ? "--reference $fasta " : '' + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" def labels_command = '' // labels is a list. Here is an example of what labels might look like: From c04147086fb1416eb90b4fde8af73ca7e6287319 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 18:27:24 +0200 Subject: [PATCH 04/38] fix usage and update default tests --- .../nf-core/gatk4/intervallisttobed/main.nf | 4 +-- .../local/bam_baserecalibrator/main.nf | 2 +- .../local/bam_convert_samtools/main.nf | 24 ++++++------- subworkflows/local/prepare_genome/main.nf | 36 +++++++++---------- tests/default.nf.test.snap | 28 +++++++-------- 5 files changed, 45 insertions(+), 49 deletions(-) diff --git a/modules/nf-core/gatk4/intervallisttobed/main.nf b/modules/nf-core/gatk4/intervallisttobed/main.nf index 3d8a4689dc..b10765b2ae 100644 --- a/modules/nf-core/gatk4/intervallisttobed/main.nf +++ b/modules/nf-core/gatk4/intervallisttobed/main.nf @@ -19,7 +19,7 @@ process GATK4_INTERVALLISTTOBED { script: def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + prefix = task.ext.prefix ?: "${meta.id}" def avail_mem = 3072 if (!task.memory) { @@ -42,7 +42,7 @@ process GATK4_INTERVALLISTTOBED { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" + prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.bed diff --git a/subworkflows/local/bam_baserecalibrator/main.nf b/subworkflows/local/bam_baserecalibrator/main.nf index 285ad6b856..f5105e4630 100644 --- a/subworkflows/local/bam_baserecalibrator/main.nf +++ b/subworkflows/local/bam_baserecalibrator/main.nf @@ -26,7 +26,7 @@ workflow BAM_BASERECALIBRATOR { .map{ meta, cram, crai, intervals, num_intervals -> [ meta + [ num_intervals:num_intervals ], cram, crai, intervals ] } // RUN BASERECALIBRATOR - GATK4_BASERECALIBRATOR(cram_intervals, fasta.map{ meta, it -> [ it ] }, fasta_fai.map{ meta, it -> [ it ] }, dict.map{ meta, it -> [ it ] }, known_sites, known_sites_tbi) + GATK4_BASERECALIBRATOR(cram_intervals, fasta, fasta_fai, dict, known_sites, known_sites_tbi) // Figuring out if there is one or more table(s) from the same sample table_to_merge = GATK4_BASERECALIBRATOR.out.table.map{ meta, table -> [ groupKey(meta, meta.num_intervals), table ] }.groupTuple().branch{ diff --git a/subworkflows/local/bam_convert_samtools/main.nf b/subworkflows/local/bam_convert_samtools/main.nf index 5b057e45ae..c20001d087 100644 --- a/subworkflows/local/bam_convert_samtools/main.nf +++ b/subworkflows/local/bam_convert_samtools/main.nf @@ -2,14 +2,14 @@ // BAM/CRAM to FASTQ conversion, paired end only // -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_MAP_MAP } from '../../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_UNMAP_UNMAP } from '../../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_UNMAP_MAP } from '../../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_MAP_UNMAP } from '../../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_MERGE as SAMTOOLS_MERGE_UNMAP } from '../../../modules/nf-core/samtools/merge/main' -include { SAMTOOLS_COLLATEFASTQ as COLLATE_FASTQ_UNMAP } from '../../../modules/nf-core/samtools/collatefastq/main' -include { SAMTOOLS_COLLATEFASTQ as COLLATE_FASTQ_MAP } from '../../../modules/nf-core/samtools/collatefastq/main' -include { CAT_FASTQ } from '../../../modules/nf-core/cat/fastq/main' +include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_MAP_MAP } from '../../../modules/nf-core/samtools/view' +include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_UNMAP_UNMAP } from '../../../modules/nf-core/samtools/view' +include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_UNMAP_MAP } from '../../../modules/nf-core/samtools/view' +include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_MAP_UNMAP } from '../../../modules/nf-core/samtools/view' +include { SAMTOOLS_MERGE as SAMTOOLS_MERGE_UNMAP } from '../../../modules/nf-core/samtools/merge' +include { SAMTOOLS_COLLATEFASTQ as COLLATE_FASTQ_UNMAP } from '../../../modules/nf-core/samtools/collatefastq' +include { SAMTOOLS_COLLATEFASTQ as COLLATE_FASTQ_MAP } from '../../../modules/nf-core/samtools/collatefastq' +include { CAT_FASTQ } from '../../../modules/nf-core/cat/fastq' workflow BAM_CONVERT_SAMTOOLS { take: @@ -24,16 +24,16 @@ workflow BAM_CONVERT_SAMTOOLS { // Index File if not PROVIDED -> this also requires updates to samtools view possibly URGH // MAP - MAP - SAMTOOLS_VIEW_MAP_MAP(input, fasta, []) + SAMTOOLS_VIEW_MAP_MAP(input, fasta, [], []) // UNMAP - UNMAP - SAMTOOLS_VIEW_UNMAP_UNMAP(input, fasta, []) + SAMTOOLS_VIEW_UNMAP_UNMAP(input, fasta, [], []) // UNMAP - MAP - SAMTOOLS_VIEW_UNMAP_MAP(input, fasta, []) + SAMTOOLS_VIEW_UNMAP_MAP(input, fasta, [], []) // MAP - UNMAP - SAMTOOLS_VIEW_MAP_UNMAP(input, fasta, []) + SAMTOOLS_VIEW_MAP_UNMAP(input, fasta, [], []) // Merge UNMAP all_unmapped_bam = SAMTOOLS_VIEW_UNMAP_UNMAP.out.bam diff --git a/subworkflows/local/prepare_genome/main.nf b/subworkflows/local/prepare_genome/main.nf index 772af47b37..288e493691 100644 --- a/subworkflows/local/prepare_genome/main.nf +++ b/subworkflows/local/prepare_genome/main.nf @@ -8,23 +8,23 @@ // Condition is based on params.step and params.tools // If and extra condition exists, it's specified in comments -include { BWA_INDEX as BWAMEM1_INDEX } from '../../../modules/nf-core/bwa/index/main' -include { BWAMEM2_INDEX } from '../../../modules/nf-core/bwamem2/index/main' -include { DRAGMAP_HASHTABLE } from '../../../modules/nf-core/dragmap/hashtable/main' -include { GATK4_CREATESEQUENCEDICTIONARY } from '../../../modules/nf-core/gatk4/createsequencedictionary/main' -include { MSISENSORPRO_SCAN } from '../../../modules/nf-core/msisensorpro/scan/main' -include { SAMTOOLS_FAIDX } from '../../../modules/nf-core/samtools/faidx/main' -include { TABIX_TABIX as TABIX_BCFTOOLS_ANNOTATIONS } from '../../../modules/nf-core/tabix/tabix/main' -include { TABIX_TABIX as TABIX_DBSNP } from '../../../modules/nf-core/tabix/tabix/main' -include { TABIX_TABIX as TABIX_GERMLINE_RESOURCE } from '../../../modules/nf-core/tabix/tabix/main' -include { TABIX_TABIX as TABIX_KNOWN_INDELS } from '../../../modules/nf-core/tabix/tabix/main' -include { TABIX_TABIX as TABIX_KNOWN_SNPS } from '../../../modules/nf-core/tabix/tabix/main' -include { TABIX_TABIX as TABIX_PON } from '../../../modules/nf-core/tabix/tabix/main' -include { UNTAR as UNTAR_CHR_DIR } from '../../../modules/nf-core/untar/main' -include { UNZIP as UNZIP_ALLELES } from '../../../modules/nf-core/unzip/main' -include { UNZIP as UNZIP_GC } from '../../../modules/nf-core/unzip/main' -include { UNZIP as UNZIP_LOCI } from '../../../modules/nf-core/unzip/main' -include { UNZIP as UNZIP_RT } from '../../../modules/nf-core/unzip/main' +include { BWA_INDEX as BWAMEM1_INDEX } from '../../../modules/nf-core/bwa/index' +include { BWAMEM2_INDEX } from '../../../modules/nf-core/bwamem2/index' +include { DRAGMAP_HASHTABLE } from '../../../modules/nf-core/dragmap/hashtable' +include { GATK4_CREATESEQUENCEDICTIONARY } from '../../../modules/nf-core/gatk4/createsequencedictionary' +include { MSISENSORPRO_SCAN } from '../../../modules/nf-core/msisensorpro/scan' +include { SAMTOOLS_FAIDX } from '../../../modules/nf-core/samtools/faidx' +include { TABIX_TABIX as TABIX_BCFTOOLS_ANNOTATIONS } from '../../../modules/nf-core/tabix/tabix' +include { TABIX_TABIX as TABIX_DBSNP } from '../../../modules/nf-core/tabix/tabix' +include { TABIX_TABIX as TABIX_GERMLINE_RESOURCE } from '../../../modules/nf-core/tabix/tabix' +include { TABIX_TABIX as TABIX_KNOWN_INDELS } from '../../../modules/nf-core/tabix/tabix' +include { TABIX_TABIX as TABIX_KNOWN_SNPS } from '../../../modules/nf-core/tabix/tabix' +include { TABIX_TABIX as TABIX_PON } from '../../../modules/nf-core/tabix/tabix' +include { UNTAR as UNTAR_CHR_DIR } from '../../../modules/nf-core/untar' +include { UNZIP as UNZIP_ALLELES } from '../../../modules/nf-core/unzip' +include { UNZIP as UNZIP_GC } from '../../../modules/nf-core/unzip' +include { UNZIP as UNZIP_LOCI } from '../../../modules/nf-core/unzip' +include { UNZIP as UNZIP_RT } from '../../../modules/nf-core/unzip' workflow PREPARE_GENOME { take: @@ -51,7 +51,7 @@ workflow PREPARE_GENOME { GATK4_CREATESEQUENCEDICTIONARY(fasta) MSISENSORPRO_SCAN(fasta) - SAMTOOLS_FAIDX(fasta, [ [ id:'no_fai' ], [] ] ) + SAMTOOLS_FAIDX(fasta, [ [ id:'no_fai' ], [] ], false ) // the following are flattened and mapped in case the user supplies more than one value for the param // written for KNOWN_INDELS, but preemptively applied to the rest diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap index 53eb3a61cf..7b6d19058c 100644 --- a/tests/default.nf.test.snap +++ b/tests/default.nf.test.snap @@ -4,20 +4,20 @@ 23, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { "gatk4": "4.5.0.0", @@ -27,7 +27,7 @@ "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -65,7 +65,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -111,7 +110,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -143,7 +141,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -175,7 +172,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -279,18 +275,18 @@ "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "samtools-stats-dp.txt:md5,c94f4d3ffa3f510552f90e173fdd9f9d", "samtools_alignment_plot.txt:md5,717f499a3543e7ee4c7a8454bf80aeca", - "test.strelka.variants.bcftools_stats.txt:md5,86bd4938eed920d36f3f5937102a2967", + "test.strelka.variants.bcftools_stats.txt:md5,eeac00236f294b3801ed5e5b4f31c30f", "test.md.mosdepth.global.dist.txt:md5,b61e1acee11a6ddf7ce3232a5948a6a0", "test.md.mosdepth.region.dist.txt:md5,1a382f98d488d2ae3df83a0d87caafc1", "test.md.mosdepth.summary.txt:md5,839108358878ada89e1eaddf6e0541ba", "test.md.regions.bed.gz:md5,6fdaec99e739dc0f47fe55dd64dfe93e", - "test.md.regions.bed.gz.csi:md5,5f9c60279af78e3aeafc96a8c11fb35f", + "test.md.regions.bed.gz.csi:md5,544e02fcca548749a0af758d0a2df352", "test.recal.mosdepth.global.dist.txt:md5,b61e1acee11a6ddf7ce3232a5948a6a0", "test.recal.mosdepth.region.dist.txt:md5,1a382f98d488d2ae3df83a0d87caafc1", "test.recal.mosdepth.summary.txt:md5,839108358878ada89e1eaddf6e0541ba", "test.recal.regions.bed.gz:md5,6fdaec99e739dc0f47fe55dd64dfe93e", - "test.recal.regions.bed.gz.csi:md5,5f9c60279af78e3aeafc96a8c11fb35f", - "test.strelka.variants.FILTER.summary:md5,ad417bc96d31223f61170987975d8128", + "test.recal.regions.bed.gz.csi:md5,544e02fcca548749a0af758d0a2df352", + "test.strelka.variants.FILTER.summary:md5,4346265632669ea47be20b7cd52e3d20", "test.strelka.variants.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], "No BAM files", @@ -299,14 +295,14 @@ "test.recal.cram:md5,dbd6f40b1e6d72501dc034e62e9d54eb" ], [ - "test.strelka.genome.vcf.gz:md5,d23db2df1603e0949f7788a3c3640833", - "test.strelka.variants.vcf.gz:md5,48ca98a5c4b715b71241fea2ae740179" + "test.strelka.genome.vcf.gz:md5,3f9e494f9810624791c31a88b74083f3", + "test.strelka.variants.vcf.gz:md5,f269818d55a583fcec77b213b238d935" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T08:50:18.962269506" + "timestamp": "2025-05-05T18:24:51.02114859" } } \ No newline at end of file From 52a4a501ed25995baf04324727645b8a36767d2f Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 18:38:16 +0200 Subject: [PATCH 05/38] update snapshots --- tests/aligner-parabricks.nf.test.snap | 6 +----- tests/alignment_from_everything.nf.test.snap | 4 ---- tests/alignment_to_fastq.nf.test.snap | 4 ---- tests/fastp.nf.test.snap | 14 +++----------- tests/preprocessing_umi.nf.test.snap | 4 ---- tests/spark.nf.test.snap | 4 ---- tests/tumor-normal-pair.nf.test.snap | 4 ---- tests/variant_calling_freebayes.nf.test.snap | 16 ---------------- 8 files changed, 4 insertions(+), 52 deletions(-) diff --git a/tests/aligner-parabricks.nf.test.snap b/tests/aligner-parabricks.nf.test.snap index df05ec4251..3bd1ba6509 100644 --- a/tests/aligner-parabricks.nf.test.snap +++ b/tests/aligner-parabricks.nf.test.snap @@ -28,7 +28,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/multiqc.log", "multiqc/multiqc_data/multiqc_citations.txt", "multiqc/multiqc_data/multiqc_data.json", @@ -49,7 +48,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/general_stats_table.pdf", "multiqc/multiqc_plots/png", "multiqc/multiqc_plots/png/fastqc-status-check-heatmap.png", @@ -63,7 +61,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/general_stats_table.png", "multiqc/multiqc_plots/svg", "multiqc/multiqc_plots/svg/fastqc-status-check-heatmap.svg", @@ -77,7 +74,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/general_stats_table.svg", "multiqc/multiqc_report.html", "pipeline_info", @@ -148,7 +144,7 @@ "test-test_L1.recal.mosdepth.region.dist.txt:md5,51ea5f44541cba3a0c4084e66b3010b2", "test-test_L1.recal.mosdepth.summary.txt:md5,6199a81261f1d3b9d69b66ea4e1cb972", "test-test_L1.recal.regions.bed.gz:md5,6cc7cad2758603997e82d3b1272478d2", - "test-test_L1.recal.regions.bed.gz.csi:md5,a3ac5a5d620082a4a1061656742d8e30" + "test-test_L1.recal.regions.bed.gz.csi:md5,a5ad8f917979f62eacfff1461529dbaa" ], "No BAM files", [ diff --git a/tests/alignment_from_everything.nf.test.snap b/tests/alignment_from_everything.nf.test.snap index 5c2b63536b..ba365412f4 100644 --- a/tests/alignment_from_everything.nf.test.snap +++ b/tests/alignment_from_everything.nf.test.snap @@ -85,7 +85,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -124,7 +123,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -150,7 +148,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -176,7 +173,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", diff --git a/tests/alignment_to_fastq.nf.test.snap b/tests/alignment_to_fastq.nf.test.snap index 7888a92b80..be52b8d39e 100644 --- a/tests/alignment_to_fastq.nf.test.snap +++ b/tests/alignment_to_fastq.nf.test.snap @@ -84,7 +84,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -122,7 +121,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -147,7 +145,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -172,7 +169,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", diff --git a/tests/fastp.nf.test.snap b/tests/fastp.nf.test.snap index d72b555400..c438462999 100644 --- a/tests/fastp.nf.test.snap +++ b/tests/fastp.nf.test.snap @@ -67,7 +67,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -121,7 +120,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -161,7 +159,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -201,7 +198,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -413,7 +409,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -467,7 +462,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -507,7 +501,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -547,7 +540,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -695,12 +687,12 @@ "test.md.mosdepth.region.dist.txt:md5,1266123c1dd631e97aaf82a63162ed33", "test.md.mosdepth.summary.txt:md5,8d6d2a2d898fbf2e5bb4954c3a5857d9", "test.md.regions.bed.gz:md5,e8d15607e26a3d7c4f045fde542e129b", - "test.md.regions.bed.gz.csi:md5,a3ac5a5d620082a4a1061656742d8e30", + "test.md.regions.bed.gz.csi:md5,a5ad8f917979f62eacfff1461529dbaa", "test.recal.mosdepth.global.dist.txt:md5,5b1d05c1e4bee145233d363f02edd18b", "test.recal.mosdepth.region.dist.txt:md5,1266123c1dd631e97aaf82a63162ed33", "test.recal.mosdepth.summary.txt:md5,8d6d2a2d898fbf2e5bb4954c3a5857d9", "test.recal.regions.bed.gz:md5,e8d15607e26a3d7c4f045fde542e129b", - "test.recal.regions.bed.gz.csi:md5,a3ac5a5d620082a4a1061656742d8e30" + "test.recal.regions.bed.gz.csi:md5,a5ad8f917979f62eacfff1461529dbaa" ], "No BAM files", [ @@ -715,4 +707,4 @@ }, "timestamp": "2025-05-02T09:07:49.668978131" } -} \ No newline at end of file +} diff --git a/tests/preprocessing_umi.nf.test.snap b/tests/preprocessing_umi.nf.test.snap index 3a26bbe2fd..58941453e6 100644 --- a/tests/preprocessing_umi.nf.test.snap +++ b/tests/preprocessing_umi.nf.test.snap @@ -91,7 +91,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -130,7 +129,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -156,7 +154,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -182,7 +179,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", diff --git a/tests/spark.nf.test.snap b/tests/spark.nf.test.snap index 87b8e52e6e..fb3ba4beee 100644 --- a/tests/spark.nf.test.snap +++ b/tests/spark.nf.test.snap @@ -55,7 +55,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -88,7 +87,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -111,7 +109,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -134,7 +131,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", diff --git a/tests/tumor-normal-pair.nf.test.snap b/tests/tumor-normal-pair.nf.test.snap index 32b7299e39..d8abc308a0 100644 --- a/tests/tumor-normal-pair.nf.test.snap +++ b/tests/tumor-normal-pair.nf.test.snap @@ -68,7 +68,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -114,7 +113,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -146,7 +144,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -178,7 +175,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", diff --git a/tests/variant_calling_freebayes.nf.test.snap b/tests/variant_calling_freebayes.nf.test.snap index 3a6620e2d8..6d3b4d0c0f 100644 --- a/tests/variant_calling_freebayes.nf.test.snap +++ b/tests/variant_calling_freebayes.nf.test.snap @@ -227,7 +227,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -276,7 +275,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -311,7 +309,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -346,7 +343,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -629,7 +625,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -678,7 +673,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -713,7 +707,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -748,7 +741,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -975,7 +967,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -1024,7 +1015,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -1059,7 +1049,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -1094,7 +1083,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -1473,7 +1461,6 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", - "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -1522,7 +1509,6 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", - "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -1557,7 +1543,6 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", - "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -1592,7 +1577,6 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", - "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", From 2532e5557e7924005b20cf69f6f1708a66878261 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 18:49:05 +0200 Subject: [PATCH 06/38] update CHANGELOG --- CHANGELOG.md | 12 ++++++++---- 1 file changed, 8 insertions(+), 4 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index a6cf69f668..98457c990c 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -34,10 +34,14 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### Dependencies -| Dependency | Old version | New version | -| ---------- | ----------- | ----------- | -| `MultiQC` | 1.25.1 | 1.27 | -| `MuSE` | | 2.1.2 | +| Dependency | Old version | New version | +| ----------------------------- | ----------- | ----------- | +| `bcftools` | 1.2 | 1.21 | +| `gatk4` | 4.5 | 4.6 | +| `mosdepth` | 0.3.8 | 0.3.10 | +| `MuSE` | | 2.1.2 | +| `MultiQC` | 1.25.1 | 1.28 | +| `samtools` (in `BWAMEM1_MEM`) | 1.2 | 1.21 | ### Parameters From ae48a5437da3790896fd7e074410c4c074cc0897 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 18:49:16 +0200 Subject: [PATCH 07/38] update CHANGELOG --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 98457c990c..10a64cd22e 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -83,6 +83,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 - [1866](https://github.com/nf-core/sarek/pull/1866) - Migrate pipeline pytest deepvariant tests to nf-test - [1867](https://github.com/nf-core/sarek/pull/1867) - Migrate pipeline pytest gatk4spark tests to nf-test - [1868](https://github.com/nf-core/sarek/pull/1868) - Migrate pipeline pytest intervals tests to nf-test +- [1871](https://github.com/nf-core/sarek/pull/1871) - Update all modules - [1874](https://github.com/nf-core/sarek/pull/1874) - Migrate pipeline pytest joint_calling haplotypecaller tests to nf-test - [1874](https://github.com/nf-core/sarek/pull/1874) - Migrate pipeline pytest joint_calling mutect2 tests to nf-test - [1874](https://github.com/nf-core/sarek/pull/1874) - Migrate pipeline pytest mutect2 tests to nf-test From a355e79df468332846561c2e3f1fbd763d2ac5e8 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 19:04:29 +0200 Subject: [PATCH 08/38] update mosdepth and gatk4 in snapshots --- tests/alignment_from_everything.nf.test.snap | 10 ++--- tests/alignment_to_fastq.nf.test.snap | 10 ++--- tests/default.nf.test.snap | 4 +- tests/fastp.nf.test.snap | 16 +++---- ...joint_calling_haplotypecaller.nf.test.snap | 16 +++---- tests/joint_calling_mutect2.nf.test.snap | 10 ++--- tests/postprocess_concatenation.nf.test.snap | 12 ++--- ...s_concatenation_normalization.nf.test.snap | 12 ++--- tests/postprocess_normalization.nf.test.snap | 12 ++--- tests/preprocessing_umi.nf.test.snap | 8 ++-- tests/sentieon.nf.test.snap | 8 ++-- tests/spark.nf.test.snap | 18 ++++---- tests/start_from_markduplicates.nf.test.snap | 36 +++++++-------- ...art_from_preparerecalibration.nf.test.snap | 12 ++--- tests/start_from_recalibration.nf.test.snap | 8 ++-- tests/tumor-normal-pair.nf.test.snap | 10 ++--- .../variant_calling_deepvariant.nf.test.snap | 6 +-- tests/variant_calling_freebayes.nf.test.snap | 44 +++++++++---------- ...riant_calling_haplotypecaller.nf.test.snap | 22 +++++----- tests/variant_calling_mutect2.nf.test.snap | 18 ++++---- 20 files changed, 146 insertions(+), 146 deletions(-) diff --git a/tests/alignment_from_everything.nf.test.snap b/tests/alignment_from_everything.nf.test.snap index ba365412f4..0ab62613ce 100644 --- a/tests/alignment_from_everything.nf.test.snap +++ b/tests/alignment_from_everything.nf.test.snap @@ -26,13 +26,13 @@ "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { @@ -42,7 +42,7 @@ "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_MERGE_UNMAP": { "samtools": 1.21 @@ -417,4 +417,4 @@ }, "timestamp": "2025-05-02T09:12:19.059760493" } -} \ No newline at end of file +} diff --git a/tests/alignment_to_fastq.nf.test.snap b/tests/alignment_to_fastq.nf.test.snap index be52b8d39e..84c7d93d43 100644 --- a/tests/alignment_to_fastq.nf.test.snap +++ b/tests/alignment_to_fastq.nf.test.snap @@ -26,13 +26,13 @@ "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { @@ -42,7 +42,7 @@ "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_MERGE_UNMAP": { "samtools": 1.21 @@ -277,4 +277,4 @@ }, "timestamp": "2025-05-02T09:14:02.827954597" } -} \ No newline at end of file +} diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap index 7b6d19058c..e3f910aa37 100644 --- a/tests/default.nf.test.snap +++ b/tests/default.nf.test.snap @@ -20,7 +20,7 @@ "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { @@ -305,4 +305,4 @@ }, "timestamp": "2025-05-05T18:24:51.02114859" } -} \ No newline at end of file +} diff --git a/tests/fastp.nf.test.snap b/tests/fastp.nf.test.snap index c438462999..577ed89954 100644 --- a/tests/fastp.nf.test.snap +++ b/tests/fastp.nf.test.snap @@ -14,20 +14,20 @@ "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -356,20 +356,20 @@ "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 diff --git a/tests/joint_calling_haplotypecaller.nf.test.snap b/tests/joint_calling_haplotypecaller.nf.test.snap index cae9255a2d..7a78860e1c 100644 --- a/tests/joint_calling_haplotypecaller.nf.test.snap +++ b/tests/joint_calling_haplotypecaller.nf.test.snap @@ -7,16 +7,16 @@ "bcftools": 1.2 }, "GATK4_GENOMICSDBIMPORT": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_GENOTYPEGVCFS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MERGE_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -174,13 +174,13 @@ "bcftools": 1.2 }, "GATK4_GENOMICSDBIMPORT": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_GENOTYPEGVCFS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -330,4 +330,4 @@ }, "timestamp": "2025-04-28T12:50:12.209282297" } -} \ No newline at end of file +} diff --git a/tests/joint_calling_mutect2.nf.test.snap b/tests/joint_calling_mutect2.nf.test.snap index f71850da33..22ebd60aef 100644 --- a/tests/joint_calling_mutect2.nf.test.snap +++ b/tests/joint_calling_mutect2.nf.test.snap @@ -4,10 +4,10 @@ 13, { "LEARNREADORIENTATIONMODEL": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MUTECT2_PAIRED": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -110,10 +110,10 @@ 12, { "LEARNREADORIENTATIONMODEL": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MUTECT2": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -197,4 +197,4 @@ }, "timestamp": "2025-04-28T13:43:47.178040106" } -} \ No newline at end of file +} diff --git a/tests/postprocess_concatenation.nf.test.snap b/tests/postprocess_concatenation.nf.test.snap index cd3abf31b0..2c2a831961 100644 --- a/tests/postprocess_concatenation.nf.test.snap +++ b/tests/postprocess_concatenation.nf.test.snap @@ -13,16 +13,16 @@ "bcftools": 1.2 }, "CNNSCOREVARIANTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FILTERVARIANTTRANCHES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FREEBAYES": { "freebayes": "1.3.6" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GERMLINE_VCFS_CONCAT": { "bcftools": 1.2 @@ -194,12 +194,12 @@ "testN.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "testN.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "testN.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "testN.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "testN.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "testT.recal.mosdepth.global.dist.txt:md5,3106c114529adc4231badeb3bb38b6d1", "testT.recal.mosdepth.region.dist.txt:md5,ccf646922b05cb4759c4f89072be2b69", "testT.recal.mosdepth.summary.txt:md5,024649a659caff330dfbef4ac3560542", "testT.recal.regions.bed.gz:md5,14b36a2cf428840aab471f95cfbe399f", - "testT.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "testT.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "testN.freebayes.FILTER.summary:md5,2ec507a210cf7de0425b6c8028a6edf8", "testN.freebayes.TsTv.count:md5,4913577b275634ea33077dd023325dee", "testT.freebayes.FILTER.summary:md5,50f90bd0cdd1e95c10d7e5d88d0346f8", @@ -228,4 +228,4 @@ }, "timestamp": "2025-04-28T13:50:46.898425819" } -} \ No newline at end of file +} diff --git a/tests/postprocess_concatenation_normalization.nf.test.snap b/tests/postprocess_concatenation_normalization.nf.test.snap index 9e1a548087..9d5fe68ac6 100644 --- a/tests/postprocess_concatenation_normalization.nf.test.snap +++ b/tests/postprocess_concatenation_normalization.nf.test.snap @@ -13,16 +13,16 @@ "bcftools": 1.2 }, "CNNSCOREVARIANTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FILTERVARIANTTRANCHES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FREEBAYES": { "freebayes": "1.3.6" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GERMLINE_VCFS_CONCAT": { "bcftools": 1.2 @@ -238,12 +238,12 @@ "testN.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "testN.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "testN.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "testN.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "testN.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "testT.recal.mosdepth.global.dist.txt:md5,3106c114529adc4231badeb3bb38b6d1", "testT.recal.mosdepth.region.dist.txt:md5,ccf646922b05cb4759c4f89072be2b69", "testT.recal.mosdepth.summary.txt:md5,024649a659caff330dfbef4ac3560542", "testT.recal.regions.bed.gz:md5,14b36a2cf428840aab471f95cfbe399f", - "testT.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "testT.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "testN.freebayes.norm.FILTER.summary:md5,d621a188425df0da8babce002e2f34dc", "testN.freebayes.norm.TsTv.count:md5,232bb44db986854d3992bda0df08f54b", "testN.germline.FILTER.summary:md5,2ec507a210cf7de0425b6c8028a6edf8", @@ -288,4 +288,4 @@ }, "timestamp": "2025-05-02T09:52:39.069554463" } -} \ No newline at end of file +} diff --git a/tests/postprocess_normalization.nf.test.snap b/tests/postprocess_normalization.nf.test.snap index e00ef83a63..193c42e33b 100644 --- a/tests/postprocess_normalization.nf.test.snap +++ b/tests/postprocess_normalization.nf.test.snap @@ -13,16 +13,16 @@ "bcftools": 1.2 }, "CNNSCOREVARIANTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FILTERVARIANTTRANCHES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FREEBAYES": { "freebayes": "1.3.6" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "TABIX_EXT_VCF": { "tabix": 1.2 @@ -202,12 +202,12 @@ "testN.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "testN.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "testN.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "testN.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "testN.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "testT.recal.mosdepth.global.dist.txt:md5,3106c114529adc4231badeb3bb38b6d1", "testT.recal.mosdepth.region.dist.txt:md5,ccf646922b05cb4759c4f89072be2b69", "testT.recal.mosdepth.summary.txt:md5,024649a659caff330dfbef4ac3560542", "testT.recal.regions.bed.gz:md5,14b36a2cf428840aab471f95cfbe399f", - "testT.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "testT.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "testN.freebayes.norm.FILTER.summary:md5,d621a188425df0da8babce002e2f34dc", "testN.freebayes.norm.TsTv.count:md5,232bb44db986854d3992bda0df08f54b", "testT.freebayes.norm.FILTER.summary:md5,50f90bd0cdd1e95c10d7e5d88d0346f8", @@ -242,4 +242,4 @@ }, "timestamp": "2025-04-28T13:54:43.851615695" } -} \ No newline at end of file +} diff --git a/tests/preprocessing_umi.nf.test.snap b/tests/preprocessing_umi.nf.test.snap index 58941453e6..4af7ecde8f 100644 --- a/tests/preprocessing_umi.nf.test.snap +++ b/tests/preprocessing_umi.nf.test.snap @@ -29,13 +29,13 @@ "fgbio": "2.2.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "GROUPREADSBYUMI": { @@ -45,7 +45,7 @@ "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMBLASTER": { "samblaster": "0.1.26", diff --git a/tests/sentieon.nf.test.snap b/tests/sentieon.nf.test.snap index aad5687132..6a127a4273 100644 --- a/tests/sentieon.nf.test.snap +++ b/tests/sentieon.nf.test.snap @@ -7,20 +7,20 @@ "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 diff --git a/tests/spark.nf.test.snap b/tests/spark.nf.test.snap index fb3ba4beee..58fd9cd284 100644 --- a/tests/spark.nf.test.snap +++ b/tests/spark.nf.test.snap @@ -11,16 +11,16 @@ "fastqc": "0.12.1" }, "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_ESTIMATELIBRARYCOMPLEXITY": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "INDEX_CRAM": { "samtools": 1.21 @@ -29,7 +29,7 @@ "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -238,13 +238,13 @@ "samtools": 1.2 }, "GATK4SPARK_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4SPARK_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4SPARK_MARKDUPLICATES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "INDEX_CRAM": { "samtools": 1.21 @@ -291,4 +291,4 @@ }, "timestamp": "2025-04-28T14:37:02.314184198" } -} \ No newline at end of file +} diff --git a/tests/start_from_markduplicates.nf.test.snap b/tests/start_from_markduplicates.nf.test.snap index d0e13067e3..3ea4d1f93a 100644 --- a/tests/start_from_markduplicates.nf.test.snap +++ b/tests/start_from_markduplicates.nf.test.snap @@ -4,20 +4,20 @@ 13, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -175,20 +175,20 @@ 13, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -346,16 +346,16 @@ 12, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -465,12 +465,12 @@ "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "test.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "test.sorted.mosdepth.global.dist.txt:md5,bdb8f185c35dd1eec7ce2f69bce57972", "test.sorted.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.sorted.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.sorted.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.sorted.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d" + "test.sorted.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259" ], "No BAM files", [ @@ -489,13 +489,13 @@ 9, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -594,7 +594,7 @@ "test.sorted.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.sorted.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.sorted.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.sorted.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d" + "test.sorted.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259" ], "No BAM files", "No CRAM files", @@ -606,4 +606,4 @@ }, "timestamp": "2025-05-02T09:42:16.040955499" } -} \ No newline at end of file +} diff --git a/tests/start_from_preparerecalibration.nf.test.snap b/tests/start_from_preparerecalibration.nf.test.snap index d0db98a0f3..b5200ac63d 100644 --- a/tests/start_from_preparerecalibration.nf.test.snap +++ b/tests/start_from_preparerecalibration.nf.test.snap @@ -4,10 +4,10 @@ 7, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -293,10 +293,10 @@ 10, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "INDEX_CRAM": { "samtools": 1.21 @@ -363,7 +363,7 @@ "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d" + "test.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259" ], "No BAM files", [ @@ -377,4 +377,4 @@ }, "timestamp": "2025-04-28T14:50:25.563557393" } -} \ No newline at end of file +} diff --git a/tests/start_from_recalibration.nf.test.snap b/tests/start_from_recalibration.nf.test.snap index 5cdff6111d..efc519a5aa 100644 --- a/tests/start_from_recalibration.nf.test.snap +++ b/tests/start_from_recalibration.nf.test.snap @@ -4,7 +4,7 @@ 6, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -269,7 +269,7 @@ 9, { "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "INDEX_CRAM": { "samtools": 1.21 @@ -315,7 +315,7 @@ "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d" + "test.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259" ], "No BAM files", [ @@ -329,4 +329,4 @@ }, "timestamp": "2025-04-28T14:51:52.5491393" } -} \ No newline at end of file +} diff --git a/tests/tumor-normal-pair.nf.test.snap b/tests/tumor-normal-pair.nf.test.snap index d8abc308a0..f7db599300 100644 --- a/tests/tumor-normal-pair.nf.test.snap +++ b/tests/tumor-normal-pair.nf.test.snap @@ -14,20 +14,20 @@ "fastqc": "0.12.1" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -367,4 +367,4 @@ }, "timestamp": "2025-05-02T09:33:30.033068515" } -} \ No newline at end of file +} diff --git a/tests/variant_calling_deepvariant.nf.test.snap b/tests/variant_calling_deepvariant.nf.test.snap index e7e5418a40..2371cb36fa 100644 --- a/tests/variant_calling_deepvariant.nf.test.snap +++ b/tests/variant_calling_deepvariant.nf.test.snap @@ -110,7 +110,7 @@ "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "test.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "test.deepvariant.FILTER.summary:md5,d0fe196a8062d7d67d9018cb40f5490c", "test.deepvariant.TsTv.count:md5,2851ce55f9813280515c2fdcacb86844" ], @@ -668,7 +668,7 @@ "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", "test.recal.regions.bed.gz:md5,07bbc084a889f1cece4307fd00214a6e", - "test.recal.regions.bed.gz.csi:md5,c5d0be930ffc9e562f21519a0d488d5d", + "test.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", "test.deepvariant.FILTER.summary:md5,d0fe196a8062d7d67d9018cb40f5490c", "test.deepvariant.TsTv.count:md5,2851ce55f9813280515c2fdcacb86844" ], @@ -685,4 +685,4 @@ }, "timestamp": "2025-04-28T15:40:01.04644895" } -} \ No newline at end of file +} diff --git a/tests/variant_calling_freebayes.nf.test.snap b/tests/variant_calling_freebayes.nf.test.snap index 6d3b4d0c0f..06828df703 100644 --- a/tests/variant_calling_freebayes.nf.test.snap +++ b/tests/variant_calling_freebayes.nf.test.snap @@ -13,7 +13,7 @@ "freebayes": "1.3.6" }, "MERGE_FREEBAYES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -174,20 +174,20 @@ "freebayes": "1.3.6" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -566,16 +566,16 @@ "freebayes": "1.3.6" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_GATHERBQSRREPORTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { @@ -585,10 +585,10 @@ "samtools": 1.21 }, "MERGE_FREEBAYES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -914,20 +914,20 @@ "freebayes": "1.3.6" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { "samtools": 1.21 }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -1402,16 +1402,16 @@ "freebayes": "1.3.6" }, "GATK4_APPLYBQSR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_BASERECALIBRATOR": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_GATHERBQSRREPORTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_MARKDUPLICATES": { - "gatk4": "4.5.0.0", + "gatk4": "4.6.1.0", "samtools": "1.19.2" }, "INDEX_CRAM": { @@ -1421,10 +1421,10 @@ "samtools": 1.21 }, "MERGE_FREEBAYES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MOSDEPTH": { - "mosdepth": "0.3.8" + "mosdepth": "0.3.10" }, "SAMTOOLS_STATS": { "samtools": 1.21 @@ -1800,4 +1800,4 @@ }, "timestamp": "2025-05-02T09:22:24.20963219" } -} \ No newline at end of file +} diff --git a/tests/variant_calling_haplotypecaller.nf.test.snap b/tests/variant_calling_haplotypecaller.nf.test.snap index 2d3f64bdf7..c0af8b19e5 100644 --- a/tests/variant_calling_haplotypecaller.nf.test.snap +++ b/tests/variant_calling_haplotypecaller.nf.test.snap @@ -7,7 +7,7 @@ "bcftools": 1.2 }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -137,10 +137,10 @@ "bcftools": 1.2 }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MERGE_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -273,13 +273,13 @@ "bcftools": 1.2 }, "CNNSCOREVARIANTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FILTERVARIANTTRANCHES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -412,16 +412,16 @@ "bcftools": 1.2 }, "CNNSCOREVARIANTS": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "FILTERVARIANTTRANCHES": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "GATK4_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MERGE_HAPLOTYPECALLER": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -549,4 +549,4 @@ }, "timestamp": "2025-04-28T16:07:03.169192156" } -} \ No newline at end of file +} diff --git a/tests/variant_calling_mutect2.nf.test.snap b/tests/variant_calling_mutect2.nf.test.snap index 62dd93d8bd..9c834e87a9 100644 --- a/tests/variant_calling_mutect2.nf.test.snap +++ b/tests/variant_calling_mutect2.nf.test.snap @@ -4,10 +4,10 @@ 7, { "LEARNREADORIENTATIONMODEL": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MUTECT2": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -73,10 +73,10 @@ 11, { "LEARNREADORIENTATIONMODEL": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MUTECT2_PAIRED": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -162,10 +162,10 @@ 9, { "LEARNREADORIENTATIONMODEL": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MUTECT2_PAIRED": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -242,10 +242,10 @@ 10, { "LEARNREADORIENTATIONMODEL": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "MUTECT2": { - "gatk4": "4.5.0.0" + "gatk4": "4.6.1.0" }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -312,4 +312,4 @@ }, "timestamp": "2025-04-28T18:53:10.711560282" } -} \ No newline at end of file +} From 5d8c170a02858af514b51d6b44b148313ceddaf3 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 19:08:34 +0200 Subject: [PATCH 09/38] update versions --- CHANGELOG.md | 1 + tests/aligner-bwa-mem.nf.test.snap | 4 ++-- tests/alignment_from_everything.nf.test.snap | 2 +- tests/alignment_to_fastq.nf.test.snap | 2 +- tests/fastp.nf.test.snap | 4 ++-- tests/intervals.nf.test.snap | 14 +++++++------- tests/preprocessing_umi.nf.test.snap | 8 ++++---- tests/save_output_as_bam.nf.test.snap | 4 ++-- tests/saved_mapped.nf.test.snap | 4 ++-- tests/spark.nf.test.snap | 4 ++-- tests/tumor-normal-pair.nf.test.snap | 2 +- tests/variant_calling_freebayes.nf.test.snap | 8 ++++---- 12 files changed, 29 insertions(+), 28 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 10a64cd22e..f40c50fbbe 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -37,6 +37,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | Dependency | Old version | New version | | ----------------------------- | ----------- | ----------- | | `bcftools` | 1.2 | 1.21 | +| `fgbio` | 2.2.1 | 2.4.0 | | `gatk4` | 4.5 | 4.6 | | `mosdepth` | 0.3.8 | 0.3.10 | | `MuSE` | | 2.1.2 | diff --git a/tests/aligner-bwa-mem.nf.test.snap b/tests/aligner-bwa-mem.nf.test.snap index b474b91d81..a9743e0f74 100644 --- a/tests/aligner-bwa-mem.nf.test.snap +++ b/tests/aligner-bwa-mem.nf.test.snap @@ -8,7 +8,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -112,4 +112,4 @@ }, "timestamp": "2025-04-28T11:28:31.148875256" } -} \ No newline at end of file +} diff --git a/tests/alignment_from_everything.nf.test.snap b/tests/alignment_from_everything.nf.test.snap index 0ab62613ce..dfe6ff01eb 100644 --- a/tests/alignment_from_everything.nf.test.snap +++ b/tests/alignment_from_everything.nf.test.snap @@ -5,7 +5,7 @@ { "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "CAT_FASTQ": { "cat": 9.5 diff --git a/tests/alignment_to_fastq.nf.test.snap b/tests/alignment_to_fastq.nf.test.snap index 84c7d93d43..ad3733ddf0 100644 --- a/tests/alignment_to_fastq.nf.test.snap +++ b/tests/alignment_to_fastq.nf.test.snap @@ -5,7 +5,7 @@ { "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "CAT_FASTQ": { "cat": 9.5 diff --git a/tests/fastp.nf.test.snap b/tests/fastp.nf.test.snap index 577ed89954..71c2bd109d 100644 --- a/tests/fastp.nf.test.snap +++ b/tests/fastp.nf.test.snap @@ -5,7 +5,7 @@ { "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTP": { "fastp": "0.23.4" @@ -347,7 +347,7 @@ { "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTP": { "fastp": "0.23.4" diff --git a/tests/intervals.nf.test.snap b/tests/intervals.nf.test.snap index 891b487c94..b7b83afa06 100644 --- a/tests/intervals.nf.test.snap +++ b/tests/intervals.nf.test.snap @@ -8,7 +8,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -59,7 +59,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -128,7 +128,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -176,7 +176,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -244,7 +244,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -290,7 +290,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -330,4 +330,4 @@ }, "timestamp": "2025-04-28T17:43:12.251284585" } -} \ No newline at end of file +} diff --git a/tests/preprocessing_umi.nf.test.snap b/tests/preprocessing_umi.nf.test.snap index 4af7ecde8f..512aaa3462 100644 --- a/tests/preprocessing_umi.nf.test.snap +++ b/tests/preprocessing_umi.nf.test.snap @@ -8,10 +8,10 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "CALLUMICONSENSUS": { - "fgbio": "2.2.1" + "fgbio": "2.4.0" }, "CAT_FASTQ": { "cat": 9.5 @@ -26,7 +26,7 @@ "fastqc": "0.12.1" }, "FASTQTOBAM": { - "fgbio": "2.2.1" + "fgbio": "2.4.0" }, "GATK4_APPLYBQSR": { "gatk4": "4.6.1.0" @@ -39,7 +39,7 @@ "samtools": "1.19.2" }, "GROUPREADSBYUMI": { - "fgbio": "2.2.1" + "fgbio": "2.4.0" }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/save_output_as_bam.nf.test.snap b/tests/save_output_as_bam.nf.test.snap index 4fbfe194f6..8c27189f44 100644 --- a/tests/save_output_as_bam.nf.test.snap +++ b/tests/save_output_as_bam.nf.test.snap @@ -8,7 +8,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -45,4 +45,4 @@ }, "timestamp": "2025-04-28T14:19:26.894332207" } -} \ No newline at end of file +} diff --git a/tests/saved_mapped.nf.test.snap b/tests/saved_mapped.nf.test.snap index 3147cadfde..cc251c85ba 100644 --- a/tests/saved_mapped.nf.test.snap +++ b/tests/saved_mapped.nf.test.snap @@ -8,7 +8,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -45,4 +45,4 @@ }, "timestamp": "2025-04-28T14:22:21.021247713" } -} \ No newline at end of file +} diff --git a/tests/spark.nf.test.snap b/tests/spark.nf.test.snap index 58fd9cd284..5acb6e4fa4 100644 --- a/tests/spark.nf.test.snap +++ b/tests/spark.nf.test.snap @@ -5,7 +5,7 @@ { "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" @@ -235,7 +235,7 @@ { "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "GATK4SPARK_APPLYBQSR": { "gatk4": "4.6.1.0" diff --git a/tests/tumor-normal-pair.nf.test.snap b/tests/tumor-normal-pair.nf.test.snap index f7db599300..a703b790b0 100644 --- a/tests/tumor-normal-pair.nf.test.snap +++ b/tests/tumor-normal-pair.nf.test.snap @@ -8,7 +8,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" diff --git a/tests/variant_calling_freebayes.nf.test.snap b/tests/variant_calling_freebayes.nf.test.snap index 06828df703..775f07ff9c 100644 --- a/tests/variant_calling_freebayes.nf.test.snap +++ b/tests/variant_calling_freebayes.nf.test.snap @@ -165,7 +165,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" @@ -557,7 +557,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" @@ -905,7 +905,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" @@ -1393,7 +1393,7 @@ }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", - "samtools": 1.2 + "samtools": 1.21 }, "FASTQC": { "fastqc": "0.12.1" From 31ee4c6de9a1b46801361de92b04c0705e044d62 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 19:43:43 +0200 Subject: [PATCH 10/38] polish --- tests/aligner-bwa-mem.nf.test.snap | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tests/aligner-bwa-mem.nf.test.snap b/tests/aligner-bwa-mem.nf.test.snap index a9743e0f74..afe0a37da4 100644 --- a/tests/aligner-bwa-mem.nf.test.snap +++ b/tests/aligner-bwa-mem.nf.test.snap @@ -112,4 +112,4 @@ }, "timestamp": "2025-04-28T11:28:31.148875256" } -} +} \ No newline at end of file From 6e4a4cd5f4765640aecf8c21726b1b18c0f64f24 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 5 May 2025 19:49:25 +0200 Subject: [PATCH 11/38] bwamem2mem --- CHANGELOG.md | 1 + conf/test.config | 3 +++ tests/aligner-bwa-mem2.nf.test.snap | 4 ++-- 3 files changed, 6 insertions(+), 2 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index f40c50fbbe..123c0ab9c4 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -43,6 +43,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | `MuSE` | | 2.1.2 | | `MultiQC` | 1.25.1 | 1.28 | | `samtools` (in `BWAMEM1_MEM`) | 1.2 | 1.21 | +| `samtools` (in `BWAMEM2_MEM`) | 1.19.2 | 1.21 | ### Parameters diff --git a/conf/test.config b/conf/test.config index 6bb8c8edd0..555a077486 100644 --- a/conf/test.config +++ b/conf/test.config @@ -15,6 +15,9 @@ process { memory: '15.GB', time: '1.h' ] + withName:BWAMEM2_INDEX { + memory = { 6.GB } + } } params { diff --git a/tests/aligner-bwa-mem2.nf.test.snap b/tests/aligner-bwa-mem2.nf.test.snap index 68524cca8b..bcbef8528b 100644 --- a/tests/aligner-bwa-mem2.nf.test.snap +++ b/tests/aligner-bwa-mem2.nf.test.snap @@ -54,7 +54,7 @@ }, "BWAMEM2_MEM": { "bwamem2": "2.2.1", - "samtools": "1.19.2" + "samtools": 1.21 }, "INDEX_MERGE_BAM": { "samtools": 1.21 @@ -110,6 +110,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:08:06.242648273" + "timestamp": "2025-05-05T19:45:59.614482967" } } \ No newline at end of file From 01aafd2940c38294900b901778c2164d6341c291 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Wed, 7 May 2025 09:37:30 +0200 Subject: [PATCH 12/38] update modules --- modules.json | 2 +- .../nf-core/dragmap/align/dragmap-align.diff | 38 ------------------- .../dragmap/hashtable/dragmap-hashtable.diff | 31 --------------- .../nf-core/gatk4/intervallisttobed/main.nf | 4 +- .../gatk4/markduplicates/environment.yml | 4 +- modules/nf-core/gatk4/markduplicates/main.nf | 35 ++++++++--------- 6 files changed, 23 insertions(+), 91 deletions(-) delete mode 100644 modules/nf-core/dragmap/align/dragmap-align.diff delete mode 100644 modules/nf-core/dragmap/hashtable/dragmap-hashtable.diff diff --git a/modules.json b/modules.json index 19ef5b63ec..aa7a17eab0 100644 --- a/modules.json +++ b/modules.json @@ -270,7 +270,7 @@ }, "gatk4/markduplicates": { "branch": "master", - "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", + "git_sha": "1ec937ab3edc307bc0d79a2200d784e9f0868359", "installed_by": ["modules"] }, "gatk4/mergemutectstats": { diff --git a/modules/nf-core/dragmap/align/dragmap-align.diff b/modules/nf-core/dragmap/align/dragmap-align.diff deleted file mode 100644 index cca557b628..0000000000 --- a/modules/nf-core/dragmap/align/dragmap-align.diff +++ /dev/null @@ -1,38 +0,0 @@ -Changes in module 'nf-core/dragmap/align' -Changes in 'dragmap/align/main.nf': ---- modules/nf-core/dragmap/align/main.nf -+++ modules/nf-core/dragmap/align/main.nf -@@ -4,8 +4,8 @@ - - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? -- 'https://depot.galaxyproject.org/singularity/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:7eed251370ac7f3537c3d9472cdb2f9f5d8da1c5-0': -- 'biocontainers/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:7eed251370ac7f3537c3d9472cdb2f9f5d8da1c5-0' }" -+ 'https://depot.galaxyproject.org/singularity/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:df80ed8d23d0a2c43181a2b3dd1b39f2d00fab5c-0': -+ 'biocontainers/mulled-v2-580d344d9d4a496cd403932da8765f9e0187774d:df80ed8d23d0a2c43181a2b3dd1b39f2d00fab5c-0' }" - - input: - tuple val(meta) , path(reads) - -'modules/nf-core/dragmap/align/meta.yml' is unchanged -Changes in 'dragmap/align/environment.yml': ---- modules/nf-core/dragmap/align/environment.yml -+++ modules/nf-core/dragmap/align/environment.yml -@@ -1,8 +1,8 @@ - channels: - - conda-forge - - bioconda -- - dependencies: -- - dragmap=1.3.0 -- - pigz=2.8 -- - samtools=1.18 -+ - dragmap=1.2.1 -+ - pigz=2.3.4 -+ # renovate: datasource=conda depName=bioconda/samtools -+ - samtools=1.19.2 - -'modules/nf-core/dragmap/align/tests/main.nf.test.snap' is unchanged -'modules/nf-core/dragmap/align/tests/main.nf.test' is unchanged -'modules/nf-core/dragmap/align/tests/tags.yml' is unchanged -************************************************************ diff --git a/modules/nf-core/dragmap/hashtable/dragmap-hashtable.diff b/modules/nf-core/dragmap/hashtable/dragmap-hashtable.diff deleted file mode 100644 index 3e9ffb89c6..0000000000 --- a/modules/nf-core/dragmap/hashtable/dragmap-hashtable.diff +++ /dev/null @@ -1,31 +0,0 @@ -Changes in module 'nf-core/dragmap/hashtable' -Changes in 'dragmap/hashtable/main.nf': ---- modules/nf-core/dragmap/hashtable/main.nf -+++ modules/nf-core/dragmap/hashtable/main.nf -@@ -4,8 +4,8 @@ - - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? -- 'https://depot.galaxyproject.org/singularity/dragmap:1.3.0--h91baf5a_3': -- 'biocontainers/dragmap:1.3.0--h91baf5a_3' }" -+ 'https://depot.galaxyproject.org/singularity/dragmap:1.2.1--h72d16da_1': -+ 'biocontainers/dragmap:1.2.1--h72d16da_1' }" - - input: - tuple val(meta), path(fasta) - -'modules/nf-core/dragmap/hashtable/meta.yml' is unchanged -Changes in 'dragmap/hashtable/environment.yml': ---- modules/nf-core/dragmap/hashtable/environment.yml -+++ modules/nf-core/dragmap/hashtable/environment.yml -@@ -2,4 +2,4 @@ - - conda-forge - - bioconda - dependencies: -- - bioconda::dragmap=1.3.0 -+ - bioconda::dragmap=1.2.1 - -'modules/nf-core/dragmap/hashtable/tests/main.nf.test.snap' is unchanged -'modules/nf-core/dragmap/hashtable/tests/main.nf.test' is unchanged -'modules/nf-core/dragmap/hashtable/tests/tags.yml' is unchanged -************************************************************ diff --git a/modules/nf-core/gatk4/intervallisttobed/main.nf b/modules/nf-core/gatk4/intervallisttobed/main.nf index b10765b2ae..3d8a4689dc 100644 --- a/modules/nf-core/gatk4/intervallisttobed/main.nf +++ b/modules/nf-core/gatk4/intervallisttobed/main.nf @@ -19,7 +19,7 @@ process GATK4_INTERVALLISTTOBED { script: def args = task.ext.args ?: '' - prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}" def avail_mem = 3072 if (!task.memory) { @@ -42,7 +42,7 @@ process GATK4_INTERVALLISTTOBED { """ stub: - prefix = task.ext.prefix ?: "${meta.id}" + def prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.bed diff --git a/modules/nf-core/gatk4/markduplicates/environment.yml b/modules/nf-core/gatk4/markduplicates/environment.yml index 8afaba0656..352d20f839 100644 --- a/modules/nf-core/gatk4/markduplicates/environment.yml +++ b/modules/nf-core/gatk4/markduplicates/environment.yml @@ -8,5 +8,5 @@ dependencies: # renovate: datasource=conda depName=bioconda/gatk4 - bioconda::gatk4=4.6.1.0 - bioconda::gcnvkernel=0.9 - - bioconda::htslib=1.19.1 - - bioconda::samtools=1.19.2 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 \ No newline at end of file diff --git a/modules/nf-core/gatk4/markduplicates/main.nf b/modules/nf-core/gatk4/markduplicates/main.nf index cf770308d5..f4bd896bf3 100644 --- a/modules/nf-core/gatk4/markduplicates/main.nf +++ b/modules/nf-core/gatk4/markduplicates/main.nf @@ -1,24 +1,24 @@ process GATK4_MARKDUPLICATES { - tag "$meta.id" + tag "${meta.id}" label 'process_low' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-d9e7bad0f7fbc8f4458d5c3ab7ffaaf0235b59fb:7cc3d06cbf42e28c5e2ebfc7c858654c7340a9d5-0': - 'biocontainers/mulled-v2-d9e7bad0f7fbc8f4458d5c3ab7ffaaf0235b59fb:7cc3d06cbf42e28c5e2ebfc7c858654c7340a9d5-0' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/92/927ff9bb80d65b425cbe752db6648a84043feff6e8ca90e60f9ff6ddbe8938d5/data' + : 'community.wave.seqera.io/library/gatk4_gcnvkernel_htslib_samtools:c1e4292d6ee27439'}" input: tuple val(meta), path(bam) - path fasta - path fasta_fai + path fasta + path fasta_fai output: - tuple val(meta), path("*cram"), emit: cram, optional: true - tuple val(meta), path("*bam"), emit: bam, optional: true - tuple val(meta), path("*.crai"), emit: crai, optional: true - tuple val(meta), path("*.bai"), emit: bai, optional: true + tuple val(meta), path("*cram"), emit: cram, optional: true + tuple val(meta), path("*bam"), emit: bam, optional: true + tuple val(meta), path("*.crai"), emit: crai, optional: true + tuple val(meta), path("*.bai"), emit: bai, optional: true tuple val(meta), path("*.metrics"), emit: metrics - path "versions.yml", emit: versions + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when @@ -30,14 +30,15 @@ process GATK4_MARKDUPLICATES { // If the extension is CRAM, then change it to BAM prefix_bam = prefix.tokenize('.')[-1] == 'cram' ? "${prefix.substring(0, prefix.lastIndexOf('.'))}.bam" : prefix - def input_list = bam.collect{"--INPUT $it"}.join(' ') + def input_list = bam.collect { "--INPUT ${it}" }.join(' ') def reference = fasta ? "--REFERENCE_SEQUENCE ${fasta}" : "" def avail_mem = 3072 if (!task.memory) { - log.info '[GATK MarkDuplicates] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' - } else { - avail_mem = (task.memory.mega*0.8).intValue() + log.info('[GATK MarkDuplicates] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.') + } + else { + avail_mem = (task.memory.mega * 0.8).intValue() } // Using samtools and not Markduplicates to compress to CRAM speeds up computation: @@ -45,12 +46,12 @@ process GATK4_MARKDUPLICATES { """ gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ MarkDuplicates \\ - $input_list \\ + ${input_list} \\ --OUTPUT ${prefix_bam} \\ --METRICS_FILE ${prefix}.metrics \\ --TMP_DIR . \\ ${reference} \\ - $args + ${args} # If cram files are wished as output, the run samtools for conversion if [[ ${prefix} == *.cram ]]; then From 7aa852280ef36efbd91fce34573b3cf238f6c5d8 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Wed, 7 May 2025 10:56:35 +0200 Subject: [PATCH 13/38] update gatk4/intervallisttobed --- modules.json | 5 +-- .../gatk4-intervallisttobed.diff | 29 ------------- .../nf-core/gatk4/intervallisttobed/main.nf | 41 +++++++------------ .../nf-core/gatk4/intervallisttobed/meta.yml | 10 +++-- 4 files changed, 22 insertions(+), 63 deletions(-) delete mode 100644 modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff diff --git a/modules.json b/modules.json index aa7a17eab0..899c76661a 100644 --- a/modules.json +++ b/modules.json @@ -259,9 +259,8 @@ }, "gatk4/intervallisttobed": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", - "installed_by": ["modules"], - "patch": "modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff" + "git_sha": "20fe8646005253d57a7a8db42abf69ea0966dc75", + "installed_by": ["modules"] }, "gatk4/learnreadorientationmodel": { "branch": "master", diff --git a/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff b/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff deleted file mode 100644 index c5b321b292..0000000000 --- a/modules/nf-core/gatk4/intervallisttobed/gatk4-intervallisttobed.diff +++ /dev/null @@ -1,29 +0,0 @@ -Changes in component 'nf-core/gatk4/intervallisttobed' -Changes in 'gatk4/intervallisttobed/main.nf': ---- modules/nf-core/gatk4/intervallisttobed/main.nf -+++ modules/nf-core/gatk4/intervallisttobed/main.nf -@@ -52,4 +52,18 @@ - gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') - END_VERSIONS - """ -+ -+ stub: -+ def prefix = task.ext.prefix ?: "${meta.id}.cram" -+ def metrics = task.ext.metrics ?: "${prefix}.metrics" -+ def prefix_basename = prefix.substring(0, prefix.lastIndexOf(".")) -+ -+ """ -+ touch ${prefix}.bed -+ -+ cat <<-END_VERSIONS > versions.yml -+ "${task.process}": -+ gawk: \$(awk -Wversion | sed '1!d; s/.*Awk //; s/,.*//') -+ END_VERSIONS -+ """ - } - -'modules/nf-core/gatk4/intervallisttobed/meta.yml' is unchanged -'modules/nf-core/gatk4/intervallisttobed/environment.yml' is unchanged -'modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test.snap' is unchanged -'modules/nf-core/gatk4/intervallisttobed/tests/main.nf.test' is unchanged -************************************************************ diff --git a/modules/nf-core/gatk4/intervallisttobed/main.nf b/modules/nf-core/gatk4/intervallisttobed/main.nf index 3d8a4689dc..a7b05edbfc 100644 --- a/modules/nf-core/gatk4/intervallisttobed/main.nf +++ b/modules/nf-core/gatk4/intervallisttobed/main.nf @@ -1,39 +1,40 @@ process GATK4_INTERVALLISTTOBED { - tag "$meta.id" + tag "${meta.id}" label 'process_low' conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data': - 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd' }" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b2/b28daf5d9bb2f0d129dcad1b7410e0dd8a9b087aaf3ec7ced929b1f57624ad98/data' + : 'community.wave.seqera.io/library/gatk4_gcnvkernel:e48d414933d188cd'}" input: tuple val(meta), path(intervals) output: - tuple val(meta), path("*.bed"), emit: bed - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}.bed"), emit: bed + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when script: def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" + prefix = task.ext.prefix ?: "${meta.id}" def avail_mem = 3072 if (!task.memory) { - log.info '[GATK IntervalListToBed] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' - } else { - avail_mem = (task.memory.mega*0.8).intValue() + log.info('[GATK IntervalListToBed] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.') + } + else { + avail_mem = (task.memory.mega * 0.8).intValue() } """ gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ IntervalListToBed \\ - --INPUT $intervals \\ + --INPUT ${intervals} \\ --OUTPUT ${prefix}.bed \\ --TMP_DIR . \\ - $args + ${args} cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -42,7 +43,7 @@ process GATK4_INTERVALLISTTOBED { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" + prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.bed @@ -52,18 +53,4 @@ process GATK4_INTERVALLISTTOBED { gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') END_VERSIONS """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}.cram" - def metrics = task.ext.metrics ?: "${prefix}.metrics" - def prefix_basename = prefix.substring(0, prefix.lastIndexOf(".")) - - """ - touch ${prefix}.bed - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - gawk: \$(awk -Wversion | sed '1!d; s/.*Awk //; s/,.*//') - END_VERSIONS - """ } diff --git a/modules/nf-core/gatk4/intervallisttobed/meta.yml b/modules/nf-core/gatk4/intervallisttobed/meta.yml index 0779fa1822..f151daafdb 100644 --- a/modules/nf-core/gatk4/intervallisttobed/meta.yml +++ b/modules/nf-core/gatk4/intervallisttobed/meta.yml @@ -30,10 +30,12 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - - "*.bed": - type: file - description: BED file - pattern: "*.bed" + - ${prefix}.bed: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "${prefix}.bed" - versions: - versions.yml: type: file From d611ccc91437f62e1ffa4d729eb6a05644819e4d Mon Sep 17 00:00:00 2001 From: maxulysse Date: Wed, 7 May 2025 11:18:39 +0200 Subject: [PATCH 14/38] update samtools in Markduplicates --- tests/alignment_from_everything.nf.test.snap | 3 ++- tests/alignment_to_fastq.nf.test.snap | 3 ++- tests/default.nf.test.snap | 3 ++- tests/fastp.nf.test.snap | 6 ++++-- tests/preprocessing_umi.nf.test.snap | 3 ++- tests/sentieon.nf.test.snap | 3 ++- tests/start_from_markduplicates.nf.test.snap | 6 ++++-- tests/tumor-normal-pair.nf.test.snap | 3 ++- tests/variant_calling_freebayes.nf.test.snap | 12 ++++++++---- 9 files changed, 28 insertions(+), 14 deletions(-) diff --git a/tests/alignment_from_everything.nf.test.snap b/tests/alignment_from_everything.nf.test.snap index dfe6ff01eb..29c83f7cbd 100644 --- a/tests/alignment_from_everything.nf.test.snap +++ b/tests/alignment_from_everything.nf.test.snap @@ -33,7 +33,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/alignment_to_fastq.nf.test.snap b/tests/alignment_to_fastq.nf.test.snap index ad3733ddf0..876ef9efc3 100644 --- a/tests/alignment_to_fastq.nf.test.snap +++ b/tests/alignment_to_fastq.nf.test.snap @@ -33,7 +33,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap index e3f910aa37..3bf95f6028 100644 --- a/tests/default.nf.test.snap +++ b/tests/default.nf.test.snap @@ -21,7 +21,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/fastp.nf.test.snap b/tests/fastp.nf.test.snap index 71c2bd109d..2b05691d37 100644 --- a/tests/fastp.nf.test.snap +++ b/tests/fastp.nf.test.snap @@ -21,7 +21,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 @@ -363,7 +364,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/preprocessing_umi.nf.test.snap b/tests/preprocessing_umi.nf.test.snap index 512aaa3462..bfd216d794 100644 --- a/tests/preprocessing_umi.nf.test.snap +++ b/tests/preprocessing_umi.nf.test.snap @@ -36,7 +36,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "GROUPREADSBYUMI": { "fgbio": "2.4.0" diff --git a/tests/sentieon.nf.test.snap b/tests/sentieon.nf.test.snap index 6a127a4273..f0405e0443 100644 --- a/tests/sentieon.nf.test.snap +++ b/tests/sentieon.nf.test.snap @@ -14,7 +14,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/start_from_markduplicates.nf.test.snap b/tests/start_from_markduplicates.nf.test.snap index 3ea4d1f93a..fabbc5ffae 100644 --- a/tests/start_from_markduplicates.nf.test.snap +++ b/tests/start_from_markduplicates.nf.test.snap @@ -11,7 +11,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 @@ -182,7 +183,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/tumor-normal-pair.nf.test.snap b/tests/tumor-normal-pair.nf.test.snap index a703b790b0..0993e9a66f 100644 --- a/tests/tumor-normal-pair.nf.test.snap +++ b/tests/tumor-normal-pair.nf.test.snap @@ -21,7 +21,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 diff --git a/tests/variant_calling_freebayes.nf.test.snap b/tests/variant_calling_freebayes.nf.test.snap index 775f07ff9c..bc5683d6a6 100644 --- a/tests/variant_calling_freebayes.nf.test.snap +++ b/tests/variant_calling_freebayes.nf.test.snap @@ -181,7 +181,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 @@ -576,7 +577,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 @@ -921,7 +923,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 @@ -1412,7 +1415,8 @@ }, "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", - "samtools": "1.19.2" + "samtools": 1.21 + }, "INDEX_CRAM": { "samtools": 1.21 From 538173758ce4d1b8e6c15c25cb73cfcd844fd227 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Wed, 7 May 2025 11:19:11 +0200 Subject: [PATCH 15/38] update CHANGELOG --- CHANGELOG.md | 21 +++++++++++---------- 1 file changed, 11 insertions(+), 10 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 123c0ab9c4..a5f1bed0ea 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -34,16 +34,17 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### Dependencies -| Dependency | Old version | New version | -| ----------------------------- | ----------- | ----------- | -| `bcftools` | 1.2 | 1.21 | -| `fgbio` | 2.2.1 | 2.4.0 | -| `gatk4` | 4.5 | 4.6 | -| `mosdepth` | 0.3.8 | 0.3.10 | -| `MuSE` | | 2.1.2 | -| `MultiQC` | 1.25.1 | 1.28 | -| `samtools` (in `BWAMEM1_MEM`) | 1.2 | 1.21 | -| `samtools` (in `BWAMEM2_MEM`) | 1.19.2 | 1.21 | +| Dependency | Old version | New version | +| -------------------------------------- | ----------- | ----------- | +| `bcftools` | 1.2 | 1.21 | +| `fgbio` | 2.2.1 | 2.4.0 | +| `gatk4` | 4.5 | 4.6 | +| `mosdepth` | 0.3.8 | 0.3.10 | +| `MuSE` | | 2.1.2 | +| `MultiQC` | 1.25.1 | 1.28 | +| `samtools` (in `BWAMEM1_MEM`) | 1.2 | 1.21 | +| `samtools` (in `BWAMEM2_MEM`) | 1.19.2 | 1.21 | +| `samtools` (in `GATK4_MARKDUPLICATES`) | 1.19.2 | 1.21 | ### Parameters From cae04eb8bf4136b8ec65282ee7a770c287f84d2f Mon Sep 17 00:00:00 2001 From: maxulysse Date: Wed, 7 May 2025 12:29:19 +0200 Subject: [PATCH 16/38] update snapshots --- tests/default.nf.test.snap | 47 ++++++++++++++-------------- tests/preprocessing_umi.nf.test.snap | 13 +++++--- 2 files changed, 31 insertions(+), 29 deletions(-) diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap index 3bf95f6028..ca7cf7a665 100644 --- a/tests/default.nf.test.snap +++ b/tests/default.nf.test.snap @@ -22,7 +22,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -263,31 +262,31 @@ "fastqc_sequence_counts_plot.txt:md5,7f0f19a58e8e54e792a751fd04a9ae13", "fastqc_sequence_duplication_levels_plot.txt:md5,92b02e250ff78725deb9a10d510fcecc", "fastqc_sequence_length_distribution_plot.txt:md5,fb04dce68ec566314125bc9438211b28", - "mosdepth-coverage-per-contig-single.txt:md5,264db67a99d2c90ea7b075e33c201b77", - "mosdepth-cumcoverage-dist-id.txt:md5,5235e965da7ebe3bfebb24ffa88defff", - "mosdepth_cov_dist.txt:md5,8d0d7cb485a7bffb07da17b28f827120", - "mosdepth_cumcov_dist.txt:md5,8d0d7cb485a7bffb07da17b28f827120", - "mosdepth_perchrom.txt:md5,264db67a99d2c90ea7b075e33c201b77", + "mosdepth-coverage-per-contig-single.txt:md5,759c540e5c35e84f2066d7a92fecf8e6", + "mosdepth-cumcoverage-dist-id.txt:md5,f747672151fc2d3700a09133181ed208", + "mosdepth_cov_dist.txt:md5,6769d443cfc128a729092e368ea4abed", + "mosdepth_cumcov_dist.txt:md5,6769d443cfc128a729092e368ea4abed", + "mosdepth_perchrom.txt:md5,759c540e5c35e84f2066d7a92fecf8e6", "multiqc_citations.txt:md5,ace4ca89138a5f1e2be289c157c00bd9", "multiqc_fastqc.txt:md5,bde0d0bffa62228b33fb68b7e25b6ff8", - "multiqc_samtools_stats.txt:md5,de27f9aaca881d11534cf0c6d5f9eadc", + "multiqc_samtools_stats.txt:md5,dedb8d6b6d5a7ddc597975afdf5610dc", "picard_MarkIlluminaAdapters_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_MeanQualityByCycle_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "samtools-stats-dp.txt:md5,c94f4d3ffa3f510552f90e173fdd9f9d", + "samtools-stats-dp.txt:md5,545466eeeb8c9bfde6c119cb17392f81", "samtools_alignment_plot.txt:md5,717f499a3543e7ee4c7a8454bf80aeca", - "test.strelka.variants.bcftools_stats.txt:md5,eeac00236f294b3801ed5e5b4f31c30f", - "test.md.mosdepth.global.dist.txt:md5,b61e1acee11a6ddf7ce3232a5948a6a0", - "test.md.mosdepth.region.dist.txt:md5,1a382f98d488d2ae3df83a0d87caafc1", - "test.md.mosdepth.summary.txt:md5,839108358878ada89e1eaddf6e0541ba", - "test.md.regions.bed.gz:md5,6fdaec99e739dc0f47fe55dd64dfe93e", - "test.md.regions.bed.gz.csi:md5,544e02fcca548749a0af758d0a2df352", - "test.recal.mosdepth.global.dist.txt:md5,b61e1acee11a6ddf7ce3232a5948a6a0", - "test.recal.mosdepth.region.dist.txt:md5,1a382f98d488d2ae3df83a0d87caafc1", - "test.recal.mosdepth.summary.txt:md5,839108358878ada89e1eaddf6e0541ba", - "test.recal.regions.bed.gz:md5,6fdaec99e739dc0f47fe55dd64dfe93e", - "test.recal.regions.bed.gz.csi:md5,544e02fcca548749a0af758d0a2df352", - "test.strelka.variants.FILTER.summary:md5,4346265632669ea47be20b7cd52e3d20", + "test.strelka.variants.bcftools_stats.txt:md5,3e171488118dbc521668c1cb79414410", + "test.md.mosdepth.global.dist.txt:md5,ef7c375ae07aec5540f9892b9b556b73", + "test.md.mosdepth.region.dist.txt:md5,212efff2213f6fc1c3204daf68bbb8c8", + "test.md.mosdepth.summary.txt:md5,72114393647ff64503522760218b30f0", + "test.md.regions.bed.gz:md5,985db429051ddcd5eae177da6fb55ad6", + "test.md.regions.bed.gz.csi:md5,3fa0f8272fefafe3cd840376d34a94a2", + "test.recal.mosdepth.global.dist.txt:md5,ef7c375ae07aec5540f9892b9b556b73", + "test.recal.mosdepth.region.dist.txt:md5,212efff2213f6fc1c3204daf68bbb8c8", + "test.recal.mosdepth.summary.txt:md5,72114393647ff64503522760218b30f0", + "test.recal.regions.bed.gz:md5,985db429051ddcd5eae177da6fb55ad6", + "test.recal.regions.bed.gz.csi:md5,3fa0f8272fefafe3cd840376d34a94a2", + "test.strelka.variants.FILTER.summary:md5,dd87f507da7de20d5318841af312493b", "test.strelka.variants.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], "No BAM files", @@ -296,14 +295,14 @@ "test.recal.cram:md5,dbd6f40b1e6d72501dc034e62e9d54eb" ], [ - "test.strelka.genome.vcf.gz:md5,3f9e494f9810624791c31a88b74083f3", - "test.strelka.variants.vcf.gz:md5,f269818d55a583fcec77b213b238d935" + "test.strelka.genome.vcf.gz:md5,1e55bf36b678e91f8ac7ee73f37815c0", + "test.strelka.variants.vcf.gz:md5,e81855d97d9077edb8d99052ed595fd5" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-05T18:24:51.02114859" + "timestamp": "2025-05-07T11:29:15.142234777" } -} +} \ No newline at end of file diff --git a/tests/preprocessing_umi.nf.test.snap b/tests/preprocessing_umi.nf.test.snap index bfd216d794..6ea96be80e 100644 --- a/tests/preprocessing_umi.nf.test.snap +++ b/tests/preprocessing_umi.nf.test.snap @@ -37,7 +37,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "GROUPREADSBYUMI": { "fgbio": "2.4.0" @@ -92,6 +91,7 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", + "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -130,6 +130,7 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", + "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -155,6 +156,7 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", + "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -180,6 +182,7 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", + "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -269,12 +272,12 @@ "test.md.mosdepth.region.dist.txt:md5,61676a4a3668c0e84eb0f56dc6bda1ae", "test.md.mosdepth.summary.txt:md5,9bbea5e4d213a51f501c2aadff8d4526", "test.md.regions.bed.gz:md5,e24c18ad56e54376c41fdaacec372f9e", - "test.md.regions.bed.gz.csi:md5,080731cdedcd389e72135f048d6e2e00", + "test.md.regions.bed.gz.csi:md5,d0713716f63ac573f4a3385733e9a537", "test.recal.mosdepth.global.dist.txt:md5,09d22913aa50a0207f97a3f85b182c6e", "test.recal.mosdepth.region.dist.txt:md5,61676a4a3668c0e84eb0f56dc6bda1ae", "test.recal.mosdepth.summary.txt:md5,9bbea5e4d213a51f501c2aadff8d4526", "test.recal.regions.bed.gz:md5,e24c18ad56e54376c41fdaacec372f9e", - "test.recal.regions.bed.gz.csi:md5,080731cdedcd389e72135f048d6e2e00", + "test.recal.regions.bed.gz.csi:md5,d0713716f63ac573f4a3385733e9a537", "test-test_L1_umi-grouped_histogram.txt:md5,85292e9acb83edf17110dce17be27f44" ], [ @@ -290,6 +293,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:01:27.619093159" + "timestamp": "2025-05-07T12:27:08.85654258" } -} +} \ No newline at end of file From f5584b3d43ee492c259a9dd20ea687f915c4ea10 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 11:29:29 +0200 Subject: [PATCH 17/38] update CHANGELOG --- CHANGELOG.md | 2 ++ 1 file changed, 2 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index a5f1bed0ea..5564081b55 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -37,6 +37,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | Dependency | Old version | New version | | -------------------------------------- | ----------- | ----------- | | `bcftools` | 1.2 | 1.21 | +| `fastp` | 0.23.4 | 0.24.0 | | `fgbio` | 2.2.1 | 2.4.0 | | `gatk4` | 4.5 | 4.6 | | `mosdepth` | 0.3.8 | 0.3.10 | @@ -45,6 +46,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | `samtools` (in `BWAMEM1_MEM`) | 1.2 | 1.21 | | `samtools` (in `BWAMEM2_MEM`) | 1.19.2 | 1.21 | | `samtools` (in `GATK4_MARKDUPLICATES`) | 1.19.2 | 1.21 | +| `tabix` | 1.2 | 1.21 | ### Parameters From 6ff0632be73806d0dfd565bbce0dc4238882b54d Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 11:29:45 +0200 Subject: [PATCH 18/38] update modules --- .../bcftools/annotate/bcftools-annotate.diff | 31 +++++++++---------- modules/nf-core/bcftools/annotate/main.nf | 4 ++- subworkflows/local/prepare_intervals/main.nf | 12 +++---- .../local/vcf_annotate_bcftools/main.nf | 15 +++++---- 4 files changed, 30 insertions(+), 32 deletions(-) diff --git a/modules/nf-core/bcftools/annotate/bcftools-annotate.diff b/modules/nf-core/bcftools/annotate/bcftools-annotate.diff index a9a8f03558..ce9a8eb5d7 100644 --- a/modules/nf-core/bcftools/annotate/bcftools-annotate.diff +++ b/modules/nf-core/bcftools/annotate/bcftools-annotate.diff @@ -1,29 +1,26 @@ -Changes in module 'nf-core/bcftools/annotate' +Changes in component 'nf-core/bcftools/annotate' Changes in 'bcftools/annotate/main.nf': --- modules/nf-core/bcftools/annotate/main.nf +++ modules/nf-core/bcftools/annotate/main.nf -@@ -8,8 +8,10 @@ - 'biocontainers/bcftools:1.20--h8b25389_0' }" +@@ -8,7 +8,9 @@ + 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: - tuple val(meta), path(input), path(index), path(annotations), path(annotations_index) -- path(header_lines) + tuple val(meta), path(input), path(index) -+ path annotations -+ path annotations_index -+ path header_lines ++ path(annotations) ++ path(annotations_index) + path(header_lines) + path(rename_chrs) - output: - tuple val(meta), path("*.{vcf,vcf.gz,bcf,bcf.gz}"), emit: vcf 'modules/nf-core/bcftools/annotate/meta.yml' is unchanged 'modules/nf-core/bcftools/annotate/environment.yml' is unchanged -'modules/nf-core/bcftools/annotate/tests/main.nf.test.snap' is unchanged -'modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config' is unchanged -'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config' is unchanged -'modules/nf-core/bcftools/annotate/tests/bcf.config' is unchanged -'modules/nf-core/bcftools/annotate/tests/vcf.config' is unchanged -'modules/nf-core/bcftools/annotate/tests/main.nf.test' is unchanged -'modules/nf-core/bcftools/annotate/tests/tags.yml' is unchanged -'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config' is unchanged +'modules/nf-core/bcftools/annotate/tests/main.nf.test.snap' was removed +'modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config' was removed +'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config' was removed +'modules/nf-core/bcftools/annotate/tests/bcf.config' was removed +'modules/nf-core/bcftools/annotate/tests/vcf.config' was removed +'modules/nf-core/bcftools/annotate/tests/main.nf.test' was removed +'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config' was removed ************************************************************ diff --git a/modules/nf-core/bcftools/annotate/main.nf b/modules/nf-core/bcftools/annotate/main.nf index 8ab067d80b..39471ca0c1 100644 --- a/modules/nf-core/bcftools/annotate/main.nf +++ b/modules/nf-core/bcftools/annotate/main.nf @@ -8,7 +8,9 @@ process BCFTOOLS_ANNOTATE { 'community.wave.seqera.io/library/bcftools:1.21--4335bec1d7b44d11' }" input: - tuple val(meta), path(input), path(index), path(annotations), path(annotations_index) + tuple val(meta), path(input), path(index) + path(annotations) + path(annotations_index) path(header_lines) path(rename_chrs) diff --git a/subworkflows/local/prepare_intervals/main.nf b/subworkflows/local/prepare_intervals/main.nf index 27c4e9c145..ebb4205eee 100644 --- a/subworkflows/local/prepare_intervals/main.nf +++ b/subworkflows/local/prepare_intervals/main.nf @@ -6,11 +6,11 @@ // For all modules here: // A when clause condition is defined in the conf/modules.config to determine if the module should be run -include { CREATE_INTERVALS_BED } from '../../../modules/local/create_intervals_bed/main' -include { GATK4_INTERVALLISTTOBED } from '../../../modules/nf-core/gatk4/intervallisttobed/main' -include { GAWK as BUILD_INTERVALS } from '../../../modules/nf-core/gawk/main' -include { TABIX_BGZIPTABIX as TABIX_BGZIPTABIX_INTERVAL_SPLIT } from '../../../modules/nf-core/tabix/bgziptabix/main' -include { TABIX_BGZIPTABIX as TABIX_BGZIPTABIX_INTERVAL_COMBINED } from '../../../modules/nf-core/tabix/bgziptabix/main' +include { CREATE_INTERVALS_BED } from '../../../modules/local/create_intervals_bed' +include { GATK4_INTERVALLISTTOBED } from '../../../modules/nf-core/gatk4/intervallisttobed' +include { GAWK as BUILD_INTERVALS } from '../../../modules/nf-core/gawk' +include { TABIX_BGZIPTABIX as TABIX_BGZIPTABIX_INTERVAL_SPLIT } from '../../../modules/nf-core/tabix/bgziptabix' +include { TABIX_BGZIPTABIX as TABIX_BGZIPTABIX_INTERVAL_COMBINED } from '../../../modules/nf-core/tabix/bgziptabix' workflow PREPARE_INTERVALS { take: @@ -39,7 +39,7 @@ workflow PREPARE_INTERVALS { } else if (step != 'annotate' && step != 'controlfreec') { // If no interval/target file is provided, then generated intervals from FASTA file if (!intervals) { - BUILD_INTERVALS(fasta_fai, []) + BUILD_INTERVALS(fasta_fai, [], []) intervals_combined = BUILD_INTERVALS.out.output diff --git a/subworkflows/local/vcf_annotate_bcftools/main.nf b/subworkflows/local/vcf_annotate_bcftools/main.nf index 9f23a426ca..a15e942f23 100644 --- a/subworkflows/local/vcf_annotate_bcftools/main.nf +++ b/subworkflows/local/vcf_annotate_bcftools/main.nf @@ -3,7 +3,7 @@ // Run BCFtools to annotate VCF files // -include { BCFTOOLS_ANNOTATE } from '../../../modules/nf-core/bcftools/annotate/main' +include { BCFTOOLS_ANNOTATE } from '../../../modules/nf-core/bcftools/annotate' workflow VCF_ANNOTATE_BCFTOOLS { take: @@ -12,18 +12,17 @@ workflow VCF_ANNOTATE_BCFTOOLS { annotations_index // header_lines // - main: - ch_versions = Channel.empty() + versions = Channel.empty() - BCFTOOLS_ANNOTATE(vcf.map{ meta, vcf -> [ meta, vcf, [] ] }, annotations, annotations_index, header_lines) + BCFTOOLS_ANNOTATE(vcf.map{ meta, vcf -> [ meta, vcf, [] ] }, annotations, annotations_index, header_lines, []) - ch_vcf_tbi = BCFTOOLS_ANNOTATE.out.vcf.join(BCFTOOLS_ANNOTATE.out.tbi, failOnDuplicate: true, failOnMismatch: true) + vcf_tbi = BCFTOOLS_ANNOTATE.out.vcf.join(BCFTOOLS_ANNOTATE.out.tbi, failOnDuplicate: true, failOnMismatch: true) // Gather versions of all tools used - ch_versions = ch_versions.mix(BCFTOOLS_ANNOTATE.out.versions) + versions = versions.mix(BCFTOOLS_ANNOTATE.out.versions) emit: - vcf_tbi = ch_vcf_tbi // channel: [ val(meta), vcf.gz, vcf.gz.tbi ] - versions = ch_versions // path: versions.yml + vcf_tbi // channel: [ val(meta), vcf.gz, vcf.gz.tbi ] + versions // path: versions.yml } From 112bf8b40c9893b3b67f86a2107d9fe60e6724b9 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 11:31:31 +0200 Subject: [PATCH 19/38] update snapshots --- tests/alignment_from_everything.nf.test.snap | 25 +-- tests/alignment_to_fastq.nf.test.snap | 13 +- tests/annotation_bcfann.nf.test.snap | 4 +- tests/annotation_merge.nf.test.snap | 12 +- tests/annotation_snpeff.nf.test.snap | 4 +- tests/annotation_vep.nf.test.snap | 4 +- tests/fastp.nf.test | 4 +- tests/fastp.nf.test.snap | 142 +++++++++--------- tests/intervals.nf.test.snap | 23 ++- ...joint_calling_haplotypecaller.nf.test.snap | 34 ++--- tests/joint_calling_mutect2.nf.test.snap | 30 ++-- 11 files changed, 147 insertions(+), 148 deletions(-) diff --git a/tests/alignment_from_everything.nf.test.snap b/tests/alignment_from_everything.nf.test.snap index 29c83f7cbd..63da535606 100644 --- a/tests/alignment_from_everything.nf.test.snap +++ b/tests/alignment_from_everything.nf.test.snap @@ -34,7 +34,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -86,6 +85,7 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", + "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -124,6 +124,7 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", + "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -149,6 +150,7 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", + "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -174,6 +176,7 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", + "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -358,42 +361,42 @@ "test.md.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test.md.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test.md.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test.md.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test.md.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test.recal.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test.recal.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test.recal.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test.recal.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test.recal.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test.recal.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test2.md.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test2.md.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test2.md.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test2.md.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test2.md.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test2.md.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test2.recal.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test2.recal.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test2.recal.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test2.recal.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test2.recal.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test2.recal.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test3.md.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test3.md.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test3.md.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test3.md.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test3.md.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test3.md.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test3.recal.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test3.recal.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test3.recal.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test3.recal.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test3.recal.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test3.recal.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test_bam.md.mosdepth.global.dist.txt:md5,9cb9b181119256ed17a77dcf44d58285", "test_bam.md.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test_bam.md.mosdepth.summary.txt:md5,dbe376360e437c89190139ef0ae6769a", "test_bam.md.regions.bed.gz:md5,0e5ed846b9b11717e42e93eec60f4ffc", - "test_bam.md.regions.bed.gz.csi:md5,633cc0252eb2246a0943aec7e7512e3e", + "test_bam.md.regions.bed.gz.csi:md5,d0713716f63ac573f4a3385733e9a537", "test_bam.recal.mosdepth.global.dist.txt:md5,9cb9b181119256ed17a77dcf44d58285", "test_bam.recal.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test_bam.recal.mosdepth.summary.txt:md5,dbe376360e437c89190139ef0ae6769a", "test_bam.recal.regions.bed.gz:md5,0e5ed846b9b11717e42e93eec60f4ffc", - "test_bam.recal.regions.bed.gz.csi:md5,633cc0252eb2246a0943aec7e7512e3e" + "test_bam.recal.regions.bed.gz.csi:md5,d0713716f63ac573f4a3385733e9a537" ], [ "test.sorted.bam:md5,59ecc5c82c7af1283eea7507c590c831", @@ -416,6 +419,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:12:19.059760493" + "timestamp": "2025-05-07T13:04:53.534982995" } -} +} \ No newline at end of file diff --git a/tests/alignment_to_fastq.nf.test.snap b/tests/alignment_to_fastq.nf.test.snap index 876ef9efc3..10d933b450 100644 --- a/tests/alignment_to_fastq.nf.test.snap +++ b/tests/alignment_to_fastq.nf.test.snap @@ -34,7 +34,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -85,6 +84,7 @@ "multiqc/multiqc_data/fastqc_sequence_counts_plot.txt", "multiqc/multiqc_data/fastqc_sequence_duplication_levels_plot.txt", "multiqc/multiqc_data/fastqc_sequence_length_distribution_plot.txt", + "multiqc/multiqc_data/fastqc_top_overrepresented_sequences_table.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.txt", "multiqc/multiqc_data/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.txt", "multiqc/multiqc_data/gatk-base-recalibrator-reported-empirical-plot.txt", @@ -122,6 +122,7 @@ "multiqc/multiqc_plots/pdf/fastqc_sequence_counts_plot-pct.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_duplication_levels_plot.pdf", "multiqc/multiqc_plots/pdf/fastqc_sequence_length_distribution_plot.pdf", + "multiqc/multiqc_plots/pdf/fastqc_top_overrepresented_sequences_table.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.pdf", "multiqc/multiqc_plots/pdf/gatk-base-recalibrator-reported-empirical-plot.pdf", @@ -146,6 +147,7 @@ "multiqc/multiqc_plots/png/fastqc_sequence_counts_plot-pct.png", "multiqc/multiqc_plots/png/fastqc_sequence_duplication_levels_plot.png", "multiqc/multiqc_plots/png/fastqc_sequence_length_distribution_plot.png", + "multiqc/multiqc_plots/png/fastqc_top_overrepresented_sequences_table.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.png", "multiqc/multiqc_plots/png/gatk-base-recalibrator-reported-empirical-plot.png", @@ -170,6 +172,7 @@ "multiqc/multiqc_plots/svg/fastqc_sequence_counts_plot-pct.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_duplication_levels_plot.svg", "multiqc/multiqc_plots/svg/fastqc_sequence_length_distribution_plot.svg", + "multiqc/multiqc_plots/svg/fastqc_top_overrepresented_sequences_table.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Count.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-quality-scores-plot_Pre-recalibration_Percent.svg", "multiqc/multiqc_plots/svg/gatk-base-recalibrator-reported-empirical-plot.svg", @@ -257,12 +260,12 @@ "test.md.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test.md.mosdepth.summary.txt:md5,dbe376360e437c89190139ef0ae6769a", "test.md.regions.bed.gz:md5,0e5ed846b9b11717e42e93eec60f4ffc", - "test.md.regions.bed.gz.csi:md5,633cc0252eb2246a0943aec7e7512e3e", + "test.md.regions.bed.gz.csi:md5,d0713716f63ac573f4a3385733e9a537", "test.recal.mosdepth.global.dist.txt:md5,9cb9b181119256ed17a77dcf44d58285", "test.recal.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test.recal.mosdepth.summary.txt:md5,dbe376360e437c89190139ef0ae6769a", "test.recal.regions.bed.gz:md5,0e5ed846b9b11717e42e93eec60f4ffc", - "test.recal.regions.bed.gz.csi:md5,633cc0252eb2246a0943aec7e7512e3e" + "test.recal.regions.bed.gz.csi:md5,d0713716f63ac573f4a3385733e9a537" ], [ "test.sorted.bam:md5,6934a96fff1eaa2f70b31ab7e11d3598", @@ -276,6 +279,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:14:02.827954597" + "timestamp": "2025-05-07T13:07:39.972199258" } -} +} \ No newline at end of file diff --git a/tests/annotation_bcfann.nf.test.snap b/tests/annotation_bcfann.nf.test.snap index 2af2103291..ede6670f43 100644 --- a/tests/annotation_bcfann.nf.test.snap +++ b/tests/annotation_bcfann.nf.test.snap @@ -4,7 +4,7 @@ 2, { "BCFTOOLS_ANNOTATE": { - "bcftools": 1.2 + "bcftools": 1.21 }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -40,6 +40,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:19:01.812858155" + "timestamp": "2025-05-07T13:32:55.132929605" } } \ No newline at end of file diff --git a/tests/annotation_merge.nf.test.snap b/tests/annotation_merge.nf.test.snap index f67b920248..e5636a5a02 100644 --- a/tests/annotation_merge.nf.test.snap +++ b/tests/annotation_merge.nf.test.snap @@ -11,10 +11,10 @@ "snpeff": "5.1d" }, "TABIX_BGZIPTABIX": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_TABIX": { - "tabix": 1.2 + "tabix": 1.21 }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -111,7 +111,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:24:21.475139525" + "timestamp": "2025-05-07T13:27:19.144912925" }, "-profile test --tools merge": { "content": [ @@ -125,10 +125,10 @@ "snpeff": "5.1d" }, "TABIX_BGZIPTABIX": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_TABIX": { - "tabix": 1.2 + "tabix": 1.21 }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -214,6 +214,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:22:45.028265151" + "timestamp": "2025-05-07T13:24:52.306809862" } } \ No newline at end of file diff --git a/tests/annotation_snpeff.nf.test.snap b/tests/annotation_snpeff.nf.test.snap index e03485f767..8f4cfbef26 100644 --- a/tests/annotation_snpeff.nf.test.snap +++ b/tests/annotation_snpeff.nf.test.snap @@ -7,7 +7,7 @@ "snpeff": "5.1d" }, "TABIX_BGZIPTABIX": { - "tabix": 1.2 + "tabix": 1.21 }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -108,6 +108,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:25:56.027772736" + "timestamp": "2025-05-07T13:29:12.975605409" } } \ No newline at end of file diff --git a/tests/annotation_vep.nf.test.snap b/tests/annotation_vep.nf.test.snap index 17c96d96ee..a8a8408aa6 100644 --- a/tests/annotation_vep.nf.test.snap +++ b/tests/annotation_vep.nf.test.snap @@ -8,7 +8,7 @@ "tabix": 1.21 }, "TABIX_TABIX": { - "tabix": 1.2 + "tabix": 1.21 }, "Workflow": { "nf-core/sarek": "v3.6.0dev" @@ -284,6 +284,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:27:59.681632554" + "timestamp": "2025-05-07T13:40:09.687878321" } } \ No newline at end of file diff --git a/tests/fastp.nf.test b/tests/fastp.nf.test index c74d39bf99..c66ba3c93c 100644 --- a/tests/fastp.nf.test +++ b/tests/fastp.nf.test @@ -6,7 +6,7 @@ nextflow_pipeline { tag "pipeline_sarek" tag "cpu" - test("trimming | -profile test,trimming --save_trimmed") { + test("-profile test,trimming --save_trimmed") { when { params { @@ -63,7 +63,7 @@ nextflow_pipeline { } } - test("split fastq | -profile test,split_fastq") { + test("-profile test,split_fastq") { when { params { diff --git a/tests/fastp.nf.test.snap b/tests/fastp.nf.test.snap index 2b05691d37..9e3cd1183f 100644 --- a/tests/fastp.nf.test.snap +++ b/tests/fastp.nf.test.snap @@ -1,5 +1,5 @@ { - "trimming | -profile test,trimming --save_trimmed": { + "-profile test,trimming --save_trimmed": { "content": [ 20, { @@ -8,7 +8,7 @@ "samtools": 1.21 }, "FASTP": { - "fastp": "0.23.4" + "fastp": "0.24.0" }, "FASTQC": { "fastqc": "0.12.1" @@ -22,7 +22,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -274,7 +273,7 @@ "reports/samtools/test/test.recal.cram.stats" ], [ - "fastp-insert-size-plot.txt:md5,6ad7c055673a215f4cec333b5eca239d", + "fastp-insert-size-plot.txt:md5,7e4ef00f8f5204cbd6c11a9d51357d76", "fastp-seq-content-gc-plot_Read_1_After_filtering.txt:md5,0f998ee8c520a016317c34207bc13f59", "fastp-seq-content-gc-plot_Read_1_Before_filtering.txt:md5,6bb5a2d67ad8458c4fd09e7426b33265", "fastp-seq-content-gc-plot_Read_2_After_filtering.txt:md5,81070ec3e258d78d2fa8dab09b90a7c5", @@ -287,7 +286,7 @@ "fastp-seq-quality-plot_Read_1_Before_filtering.txt:md5,6d3f0f8dfcf9d06b5170f25560f41381", "fastp-seq-quality-plot_Read_2_After_filtering.txt:md5,922e2838b8db8cb7237202a91a116b0d", "fastp-seq-quality-plot_Read_2_Before_filtering.txt:md5,6df6151fdceb012dbbd3d8ed241e052d", - "fastp_filtered_reads_plot.txt:md5,af65be8a3a3f3fd0364f97e7b880b36b", + "fastp_filtered_reads_plot.txt:md5,2bc65f301301334619990273c6126c5d", "fastqc-status-check-heatmap.txt:md5,a020b9689ddeb4abec16b4854fe452f1", "fastqc_adapter_content_plot.txt:md5,2e1b72be741319e7fadbbb39d7e5b37d", "fastqc_per_base_n_content_plot.txt:md5,ad3b971a6bb4e8ba6c844c8a03584eb8", @@ -298,36 +297,36 @@ "fastqc_sequence_counts_plot.txt:md5,7f0f19a58e8e54e792a751fd04a9ae13", "fastqc_sequence_duplication_levels_plot.txt:md5,92b02e250ff78725deb9a10d510fcecc", "fastqc_sequence_length_distribution_plot.txt:md5,fb04dce68ec566314125bc9438211b28", - "mosdepth-coverage-per-contig-single.txt:md5,e438f352d5126880644db87a9c918c13", - "mosdepth-cumcoverage-dist-id.txt:md5,0454a8e0bda2af678a50f4a19443fbd1", - "mosdepth_cov_dist.txt:md5,2166e606b018756868050ff82de53957", - "mosdepth_cumcov_dist.txt:md5,2166e606b018756868050ff82de53957", - "mosdepth_perchrom.txt:md5,e438f352d5126880644db87a9c918c13", + "mosdepth-coverage-per-contig-single.txt:md5,10199970ab4a7a2823c46b30dcb8d7e4", + "mosdepth-cumcoverage-dist-id.txt:md5,df5199b9924ae40c014b36487aab0102", + "mosdepth_cov_dist.txt:md5,5e9aa2ae206ce2b45b4409302343475e", + "mosdepth_cumcov_dist.txt:md5,5e9aa2ae206ce2b45b4409302343475e", + "mosdepth_perchrom.txt:md5,10199970ab4a7a2823c46b30dcb8d7e4", "multiqc_citations.txt:md5,0e2971e7a873c92592112775fa99fb02", - "multiqc_fastp.txt:md5,ad68ff660e3c39604e8dcd07e38ca98f", + "multiqc_fastp.txt:md5,2f22f6c961e432974f27a4e56d877cec", "multiqc_fastqc.txt:md5,bde0d0bffa62228b33fb68b7e25b6ff8", - "multiqc_samtools_stats.txt:md5,5c0414c4f4b5b8fe0853f668a6076534", + "multiqc_samtools_stats.txt:md5,0cfa14915806a0fc7695ba59b8ab07f5", "picard_MarkIlluminaAdapters_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_MeanQualityByCycle_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "samtools-stats-dp.txt:md5,2c6130084accd16f188e68e595307362", + "samtools-stats-dp.txt:md5,0c7d551fa5c75cdb0b1b04372c521737", "samtools_alignment_plot.txt:md5,5aefdd8aaa9bfdeb0792b8d89c6ad878", "test-test_L1_1.fastp.fastq.gz:md5,f1a5c524cae7be9b5ca9a4138f847cfa", "test-test_L1_2.fastp.fastq.gz:md5,e366994a1db55b5ed3cd12482f33cee7", "test-test_L2_1.fastp.fastq.gz:md5,f1a5c524cae7be9b5ca9a4138f847cfa", "test-test_L2_2.fastp.fastq.gz:md5,e366994a1db55b5ed3cd12482f33cee7", - "test-test_L1.fastp.json:md5,5db85a1cc8441aaf8e92185da899ab51", - "test-test_L2.fastp.json:md5,5ede98d4f6bbad75b32a6861748ee8c9", - "test.md.mosdepth.global.dist.txt:md5,3b27db27d3af8a49213b0f0ca5a3a691", - "test.md.mosdepth.region.dist.txt:md5,3e33ce923c2e9348c001cc34960d4d90", - "test.md.mosdepth.summary.txt:md5,2de9c6803d74a7157c626320cf916587", - "test.md.regions.bed.gz:md5,bb0ca9679342566559b7c5ed0b4e25b3", - "test.md.regions.bed.gz.csi:md5,eba5aca0b8f72759192bbdd29330278e", - "test.recal.mosdepth.global.dist.txt:md5,3b27db27d3af8a49213b0f0ca5a3a691", - "test.recal.mosdepth.region.dist.txt:md5,3e33ce923c2e9348c001cc34960d4d90", - "test.recal.mosdepth.summary.txt:md5,2de9c6803d74a7157c626320cf916587", - "test.recal.regions.bed.gz:md5,bb0ca9679342566559b7c5ed0b4e25b3", - "test.recal.regions.bed.gz.csi:md5,eba5aca0b8f72759192bbdd29330278e" + "test-test_L1.fastp.json:md5,fb88c7b5807f6c7478b01baddf8ca4e8", + "test-test_L2.fastp.json:md5,708187bd90c12b1c8c3fa7046b69dc35", + "test.md.mosdepth.global.dist.txt:md5,b1c26e3381f220e65d683048ab6b6e2a", + "test.md.mosdepth.region.dist.txt:md5,02d51752367e753a6984c12f059499ba", + "test.md.mosdepth.summary.txt:md5,f18e776c3ee8e6947c3a69c136f54860", + "test.md.regions.bed.gz:md5,a3e8ccd3f04d3aee009a109d52b69920", + "test.md.regions.bed.gz.csi:md5,74d39fd1e463ce7b77610c96f5f57daf", + "test.recal.mosdepth.global.dist.txt:md5,b1c26e3381f220e65d683048ab6b6e2a", + "test.recal.mosdepth.region.dist.txt:md5,02d51752367e753a6984c12f059499ba", + "test.recal.mosdepth.summary.txt:md5,f18e776c3ee8e6947c3a69c136f54860", + "test.recal.regions.bed.gz:md5,a3e8ccd3f04d3aee009a109d52b69920", + "test.recal.regions.bed.gz.csi:md5,74d39fd1e463ce7b77610c96f5f57daf" ], "No BAM files", [ @@ -340,9 +339,9 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:05:45.907001399" + "timestamp": "2025-05-07T14:03:24.345691343" }, - "split fastq | -profile test,split_fastq": { + "-profile test,split_fastq": { "content": [ 26, { @@ -351,7 +350,7 @@ "samtools": 1.21 }, "FASTP": { - "fastp": "0.23.4" + "fastp": "0.24.0" }, "FASTQC": { "fastqc": "0.12.1" @@ -365,7 +364,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -629,7 +627,7 @@ "reports/samtools/test/test.recal.cram.stats" ], [ - "fastp-insert-size-plot.txt:md5,fd83e63158281a895aff12e58f701361", + "fastp-insert-size-plot.txt:md5,36c1e87a700481bb9c17bfe3a3744f22", "fastp-seq-content-gc-plot_Read_1_After_filtering.txt:md5,6bb5a2d67ad8458c4fd09e7426b33265", "fastp-seq-content-gc-plot_Read_1_Before_filtering.txt:md5,6bb5a2d67ad8458c4fd09e7426b33265", "fastp-seq-content-gc-plot_Read_2_After_filtering.txt:md5,0ebbd32b93bc6163573df7e09553f1de", @@ -642,7 +640,7 @@ "fastp-seq-quality-plot_Read_1_Before_filtering.txt:md5,6d3f0f8dfcf9d06b5170f25560f41381", "fastp-seq-quality-plot_Read_2_After_filtering.txt:md5,6df6151fdceb012dbbd3d8ed241e052d", "fastp-seq-quality-plot_Read_2_Before_filtering.txt:md5,6df6151fdceb012dbbd3d8ed241e052d", - "fastp_filtered_reads_plot.txt:md5,0e3e0f4f626a6599d5674f640e4ed5e2", + "fastp_filtered_reads_plot.txt:md5,4db6ef902b0483a3301ba0e8c09f8ec8", "fastqc-status-check-heatmap.txt:md5,a020b9689ddeb4abec16b4854fe452f1", "fastqc_adapter_content_plot.txt:md5,2e1b72be741319e7fadbbb39d7e5b37d", "fastqc_per_base_n_content_plot.txt:md5,ad3b971a6bb4e8ba6c844c8a03584eb8", @@ -653,53 +651,53 @@ "fastqc_sequence_counts_plot.txt:md5,7f0f19a58e8e54e792a751fd04a9ae13", "fastqc_sequence_duplication_levels_plot.txt:md5,92b02e250ff78725deb9a10d510fcecc", "fastqc_sequence_length_distribution_plot.txt:md5,fb04dce68ec566314125bc9438211b28", - "mosdepth-coverage-per-contig-single.txt:md5,709f5e6e408e4f5761bf5435fa891792", - "mosdepth-cumcoverage-dist-id.txt:md5,ab5c082eedccdcd3a6b0a0b16eab76fb", - "mosdepth_cov_dist.txt:md5,7e72113dc0c2a58fc194b5a3460e9482", - "mosdepth_cumcov_dist.txt:md5,7e72113dc0c2a58fc194b5a3460e9482", - "mosdepth_perchrom.txt:md5,709f5e6e408e4f5761bf5435fa891792", + "mosdepth-coverage-per-contig-single.txt:md5,06b2a40f641572799105d445dbfc46d0", + "mosdepth-cumcoverage-dist-id.txt:md5,0afdc2fff6a329cd4494f9044d9853a0", + "mosdepth_cov_dist.txt:md5,c5e471efac70e5ae1127a1db01c0328d", + "mosdepth_cumcov_dist.txt:md5,c5e471efac70e5ae1127a1db01c0328d", + "mosdepth_perchrom.txt:md5,06b2a40f641572799105d445dbfc46d0", "multiqc_citations.txt:md5,0e2971e7a873c92592112775fa99fb02", - "multiqc_fastp.txt:md5,8de3ae0031cdbc45d6d28116c4141ee5", + "multiqc_fastp.txt:md5,758582c0fafe6e69ad8488eb612008de", "multiqc_fastqc.txt:md5,bde0d0bffa62228b33fb68b7e25b6ff8", - "multiqc_samtools_stats.txt:md5,0109974e74f32942f607957f61e5fcb9", + "multiqc_samtools_stats.txt:md5,c65c858280083724b95b19a9dc99a769", "picard_MarkIlluminaAdapters_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_MeanQualityByCycle_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "samtools-stats-dp.txt:md5,99fbfb76afd6106fa9a18dc5bfdcad26", - "samtools_alignment_plot.txt:md5,6322d00c2442fdb6815dd90d58548af8", - "0001.test-test_L1_1.fastp.fastq.gz:md5,8c9691556887b9f283f072a44626334c", - "0001.test-test_L1_2.fastp.fastq.gz:md5,3d776c62c3b94e78f346d5d23e3f8171", - "0001.test-test_L2_1.fastp.fastq.gz:md5,8c9691556887b9f283f072a44626334c", - "0001.test-test_L2_2.fastp.fastq.gz:md5,3d776c62c3b94e78f346d5d23e3f8171", - "0002.test-test_L1_1.fastp.fastq.gz:md5,a2248402d3c1c0f94e895e27b621f574", - "0002.test-test_L1_2.fastp.fastq.gz:md5,24c5f80f60f5e656d67a3fb3e1543bb6", - "0002.test-test_L2_1.fastp.fastq.gz:md5,a2248402d3c1c0f94e895e27b621f574", - "0002.test-test_L2_2.fastp.fastq.gz:md5,24c5f80f60f5e656d67a3fb3e1543bb6", - "0003.test-test_L1_1.fastp.fastq.gz:md5,69a9e34b409b4b02288ca26957085f21", - "0003.test-test_L1_2.fastp.fastq.gz:md5,70580019225b3371366a084b1bcdbd1f", - "0003.test-test_L2_1.fastp.fastq.gz:md5,69a9e34b409b4b02288ca26957085f21", - "0003.test-test_L2_2.fastp.fastq.gz:md5,70580019225b3371366a084b1bcdbd1f", - "0004.test-test_L1_1.fastp.fastq.gz:md5,7ca0af52f3421aa547d3b8c494a9979a", - "0004.test-test_L1_2.fastp.fastq.gz:md5,9fed0306de48317ab68706bec5cb0b38", - "0004.test-test_L2_1.fastp.fastq.gz:md5,7ca0af52f3421aa547d3b8c494a9979a", - "0004.test-test_L2_2.fastp.fastq.gz:md5,9fed0306de48317ab68706bec5cb0b38", - "test-test_L1.fastp.json:md5,c7d31d315a2ca5fb9f7e11a2e429c769", - "test-test_L2.fastp.json:md5,185b418ebc6a34fed285a50adfe3f38c", - "test.md.mosdepth.global.dist.txt:md5,5b1d05c1e4bee145233d363f02edd18b", - "test.md.mosdepth.region.dist.txt:md5,1266123c1dd631e97aaf82a63162ed33", - "test.md.mosdepth.summary.txt:md5,8d6d2a2d898fbf2e5bb4954c3a5857d9", - "test.md.regions.bed.gz:md5,e8d15607e26a3d7c4f045fde542e129b", - "test.md.regions.bed.gz.csi:md5,a5ad8f917979f62eacfff1461529dbaa", - "test.recal.mosdepth.global.dist.txt:md5,5b1d05c1e4bee145233d363f02edd18b", - "test.recal.mosdepth.region.dist.txt:md5,1266123c1dd631e97aaf82a63162ed33", - "test.recal.mosdepth.summary.txt:md5,8d6d2a2d898fbf2e5bb4954c3a5857d9", - "test.recal.regions.bed.gz:md5,e8d15607e26a3d7c4f045fde542e129b", - "test.recal.regions.bed.gz.csi:md5,a5ad8f917979f62eacfff1461529dbaa" + "samtools-stats-dp.txt:md5,fab25a6713d21bd5e983bd50b6d6e178", + "samtools_alignment_plot.txt:md5,f6ac923f056f74150f3606f788080066", + "0001.test-test_L1_1.fastp.fastq.gz:md5,f379a60cc2a41f39fa0c0d23edf6eb61", + "0001.test-test_L1_2.fastp.fastq.gz:md5,e54d912158088d98f8083854079e1f5c", + "0001.test-test_L2_1.fastp.fastq.gz:md5,f379a60cc2a41f39fa0c0d23edf6eb61", + "0001.test-test_L2_2.fastp.fastq.gz:md5,e54d912158088d98f8083854079e1f5c", + "0002.test-test_L1_1.fastp.fastq.gz:md5,366180a220f6b78c55b1b23b35dc7f96", + "0002.test-test_L1_2.fastp.fastq.gz:md5,66ca650f883997310858acac94c8d236", + "0002.test-test_L2_1.fastp.fastq.gz:md5,366180a220f6b78c55b1b23b35dc7f96", + "0002.test-test_L2_2.fastp.fastq.gz:md5,66ca650f883997310858acac94c8d236", + "0003.test-test_L1_1.fastp.fastq.gz:md5,46bc09415a26d50230163e613cb1324b", + "0003.test-test_L1_2.fastp.fastq.gz:md5,500404ef12d7c6f02eb3b5367f84a978", + "0003.test-test_L2_1.fastp.fastq.gz:md5,46bc09415a26d50230163e613cb1324b", + "0003.test-test_L2_2.fastp.fastq.gz:md5,500404ef12d7c6f02eb3b5367f84a978", + "0004.test-test_L1_1.fastp.fastq.gz:md5,f3b1d77aa32f019f3088810cac2605e9", + "0004.test-test_L1_2.fastp.fastq.gz:md5,e38c0529e6ba0abce221ac39c84263b0", + "0004.test-test_L2_1.fastp.fastq.gz:md5,f3b1d77aa32f019f3088810cac2605e9", + "0004.test-test_L2_2.fastp.fastq.gz:md5,e38c0529e6ba0abce221ac39c84263b0", + "test-test_L1.fastp.json:md5,2f72ca9fa3c55cfd4ff67a747f7c2e46", + "test-test_L2.fastp.json:md5,f8b183e541878de7b24e555e23e078f1", + "test.md.mosdepth.global.dist.txt:md5,e5d0c6bf323c32f5414bd48b90bb32fa", + "test.md.mosdepth.region.dist.txt:md5,5062f8b7bb536c9b77a68f4ccd2315c2", + "test.md.mosdepth.summary.txt:md5,455358d5943fd1e5f09853acff3e50b6", + "test.md.regions.bed.gz:md5,729091bfb7c08486c8d247f4629996e6", + "test.md.regions.bed.gz.csi:md5,295eb71f59c0e37b5c3cf289a467f97e", + "test.recal.mosdepth.global.dist.txt:md5,e5d0c6bf323c32f5414bd48b90bb32fa", + "test.recal.mosdepth.region.dist.txt:md5,5062f8b7bb536c9b77a68f4ccd2315c2", + "test.recal.mosdepth.summary.txt:md5,455358d5943fd1e5f09853acff3e50b6", + "test.recal.regions.bed.gz:md5,729091bfb7c08486c8d247f4629996e6", + "test.recal.regions.bed.gz.csi:md5,295eb71f59c0e37b5c3cf289a467f97e" ], "No BAM files", [ - "test.md.cram:md5,f41be8bf8086fb481d5bdbabd88d31ad", - "test.recal.cram:md5,c17dac685fd968605e941c937887c646" + "test.md.cram:md5,109bcdc3a3c2720d46cb85268920f85c", + "test.recal.cram:md5,f89c35bd0e96b2254e36b4e3660b1269" ], "No VCF files" ], @@ -707,6 +705,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:07:49.668978131" + "timestamp": "2025-05-07T14:05:35.553849281" } -} +} \ No newline at end of file diff --git a/tests/intervals.nf.test.snap b/tests/intervals.nf.test.snap index b7b83afa06..8412d7ef32 100644 --- a/tests/intervals.nf.test.snap +++ b/tests/intervals.nf.test.snap @@ -31,13 +31,11 @@ "preprocessing", "preprocessing/mapped", "preprocessing/mapped/test", - "preprocessing/mapped/test/test.sorted.crai", "preprocessing/mapped/test/test.sorted.cram", + "preprocessing/mapped/test/test.sorted.cram.crai", "reference" ], - [ - "test.sorted.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ], + "No stable content", "No BAM files", [ "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" @@ -48,7 +46,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:43:09.875888523" + "timestamp": "2025-05-07T14:17:58.394906246" }, "-profile test --intervals false --save_reference --tools null --skip_tools baserecalibrator,fastqc,markduplicates,mosdepth,multiqc,samtools -with-stub": { "content": [ @@ -81,8 +79,8 @@ "preprocessing", "preprocessing/mapped", "preprocessing/mapped/test", - "preprocessing/mapped/test/test.sorted.crai", "preprocessing/mapped/test/test.sorted.cram", + "preprocessing/mapped/test/test.sorted.cram.crai", "reference", "reference/bwa", "reference/bwa/genome.amb", @@ -97,7 +95,6 @@ ], [ "fai.bed:md5,d41d8cd98f00b204e9800998ecf8427e", - "test.sorted.crai:md5,d41d8cd98f00b204e9800998ecf8427e", "genome.amb:md5,d41d8cd98f00b204e9800998ecf8427e", "genome.ann:md5,d41d8cd98f00b204e9800998ecf8427e", "genome.bwt:md5,d41d8cd98f00b204e9800998ecf8427e", @@ -117,7 +114,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:44:13.254814263" + "timestamp": "2025-05-08T10:32:16.526738968" }, "-profile test --intervals genome.multi_intervals.bed --tools null --skip_tools baserecalibrator,fastqc,markduplicates,mosdepth,multiqc,samtools -with-stub": { "content": [ @@ -148,13 +145,11 @@ "preprocessing", "preprocessing/mapped", "preprocessing/mapped/test", - "preprocessing/mapped/test/test.sorted.crai", "preprocessing/mapped/test/test.sorted.cram", + "preprocessing/mapped/test/test.sorted.cram.crai", "reference" ], - [ - "test.sorted.crai:md5,d41d8cd98f00b204e9800998ecf8427e" - ], + "No stable content", "No BAM files", [ "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" @@ -165,7 +160,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:41:52.783999657" + "timestamp": "2025-05-07T14:17:18.664227191" }, "-profile test --intervals false --save_reference --tools null --skip_tools baserecalibrator,fastqc,markduplicates,mosdepth,multiqc,samtools": { "content": [ @@ -330,4 +325,4 @@ }, "timestamp": "2025-04-28T17:43:12.251284585" } -} +} \ No newline at end of file diff --git a/tests/joint_calling_haplotypecaller.nf.test.snap b/tests/joint_calling_haplotypecaller.nf.test.snap index 7a78860e1c..2b363ea90a 100644 --- a/tests/joint_calling_haplotypecaller.nf.test.snap +++ b/tests/joint_calling_haplotypecaller.nf.test.snap @@ -4,7 +4,7 @@ 26, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "GATK4_GENOMICSDBIMPORT": { "gatk4": "4.6.1.0" @@ -134,28 +134,28 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "joint_germline.bcftools_stats.txt:md5,73debe8d398b3b2278401319a5c5695c", + "joint_germline.bcftools_stats.txt:md5,1e0bcb3e7dc0e812371e4609f477569c", "testN.recal.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e", "testN.recal.mosdepth.region.dist.txt:md5,3a2030e5e8af7bc12720c3a5592bf921", "testN.recal.mosdepth.summary.txt:md5,615c5c5019d88045a9ff5bbe6e63d270", "testN.recal.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa", - "testN.recal.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294", + "testN.recal.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4", "testN.recal.regions.bed.gz:md5,0c8215fbea7b0bf7aba9d1781575f905", - "testN.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "testN.recal.regions.bed.gz.csi:md5,5c00a1d457c387d6e71848a6d897e309", "testT.recal.mosdepth.global.dist.txt:md5,ba97ed85645f77da6f3adad138b3cdb4", "testT.recal.mosdepth.region.dist.txt:md5,a7eb835371dd0aaf347ccca7ebe1eb3b", "testT.recal.mosdepth.summary.txt:md5,a937108cbf24c1430b79c861234ce22b", "testT.recal.per-base.bed.gz:md5,fde70b7a0caef4460692540b97b3fd52", - "testT.recal.per-base.bed.gz.csi:md5,8335c384c47d610349efaf5b634ef1cf", + "testT.recal.per-base.bed.gz.csi:md5,7f62d96cdff1ce2acc0c7d2d0549cb1b", "testT.recal.regions.bed.gz:md5,8f0d545a0950c6a53225abec38553f6f", - "testT.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "testT.recal.regions.bed.gz.csi:md5,5c00a1d457c387d6e71848a6d897e309", "joint_germline.FILTER.summary:md5,2a4eb7abfb2e64e45d53fdda17530b7f", "joint_germline.TsTv.count:md5,949fa16c755189c23a37f0ea8ecd1b26" ], "No BAM files", "No CRAM files", [ - "joint_germline.vcf.gz:md5,ff85bb32174d961ebe75c0383d2dabe", + "joint_germline.vcf.gz:md5,3551d1de0abc899d2bbd0cbe1336f832", "testN.haplotypecaller.g.vcf.gz:md5,44590f25a9ed621929879cefc601f95a", "testT.haplotypecaller.g.vcf.gz:md5,e37d210dda0bfe2716502353328b1103" ] @@ -164,14 +164,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:48:43.452937651" + "timestamp": "2025-05-07T14:20:12.868615849" }, "-profile test --input tests/csv/3.0/mapped_joint_bam.csv --tools haplotypecaller --joint_germline --dbsnp_vqsr false --known_snps_vqsr false --known_indels_vqsr false --nucleotides_per_second 100": { "content": [ 18, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "GATK4_GENOMICSDBIMPORT": { "gatk4": "4.6.1.0" @@ -298,28 +298,28 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "joint_germline.bcftools_stats.txt:md5,73debe8d398b3b2278401319a5c5695c", + "joint_germline.bcftools_stats.txt:md5,1e0bcb3e7dc0e812371e4609f477569c", "testN.recal.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e", "testN.recal.mosdepth.region.dist.txt:md5,3a2030e5e8af7bc12720c3a5592bf921", "testN.recal.mosdepth.summary.txt:md5,615c5c5019d88045a9ff5bbe6e63d270", "testN.recal.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa", - "testN.recal.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294", + "testN.recal.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4", "testN.recal.regions.bed.gz:md5,0c8215fbea7b0bf7aba9d1781575f905", - "testN.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "testN.recal.regions.bed.gz.csi:md5,5c00a1d457c387d6e71848a6d897e309", "testT.recal.mosdepth.global.dist.txt:md5,ba97ed85645f77da6f3adad138b3cdb4", "testT.recal.mosdepth.region.dist.txt:md5,a7eb835371dd0aaf347ccca7ebe1eb3b", "testT.recal.mosdepth.summary.txt:md5,a937108cbf24c1430b79c861234ce22b", "testT.recal.per-base.bed.gz:md5,fde70b7a0caef4460692540b97b3fd52", - "testT.recal.per-base.bed.gz.csi:md5,8335c384c47d610349efaf5b634ef1cf", + "testT.recal.per-base.bed.gz.csi:md5,7f62d96cdff1ce2acc0c7d2d0549cb1b", "testT.recal.regions.bed.gz:md5,8f0d545a0950c6a53225abec38553f6f", - "testT.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "testT.recal.regions.bed.gz.csi:md5,5c00a1d457c387d6e71848a6d897e309", "joint_germline.FILTER.summary:md5,2a4eb7abfb2e64e45d53fdda17530b7f", "joint_germline.TsTv.count:md5,949fa16c755189c23a37f0ea8ecd1b26" ], "No BAM files", "No CRAM files", [ - "joint_germline.vcf.gz:md5,ff85bb32174d961ebe75c0383d2dabe", + "joint_germline.vcf.gz:md5,3551d1de0abc899d2bbd0cbe1336f832", "testN.haplotypecaller.g.vcf.gz:md5,44590f25a9ed621929879cefc601f95a", "testT.haplotypecaller.g.vcf.gz:md5,e37d210dda0bfe2716502353328b1103" ] @@ -328,6 +328,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T12:50:12.209282297" + "timestamp": "2025-05-07T14:21:35.790841796" } -} +} \ No newline at end of file diff --git a/tests/joint_calling_mutect2.nf.test.snap b/tests/joint_calling_mutect2.nf.test.snap index 22ebd60aef..e074873b07 100644 --- a/tests/joint_calling_mutect2.nf.test.snap +++ b/tests/joint_calling_mutect2.nf.test.snap @@ -74,36 +74,36 @@ "sample1.recal.mosdepth.region.dist.txt:md5,6ec49cd7d510c2eb3d9d90fdb79b783a", "sample1.recal.mosdepth.summary.txt:md5,103098d0bf76ed82d2b87d5f242b099a", "sample1.recal.per-base.bed.gz:md5,297f96648928d0ca5184223fb9941e7c", - "sample1.recal.per-base.bed.gz.csi:md5,519cc5bf84da0d71b87a88c76f83194e", + "sample1.recal.per-base.bed.gz.csi:md5,c67dcd711b096eb42f43784d5eadbc0d", "sample1.recal.regions.bed.gz:md5,314ce8d7273eff353072108aa77c327c", - "sample1.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample1.recal.regions.bed.gz.csi:md5,9cb0ad7039a3b703d16ca7d5b835c0ee", "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample2.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample2.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample2.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample3.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample3.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample3.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample3.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample3.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample3.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample3.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample3.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample3.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "test.mutect2.vcf.gz.stats:md5,6340205d9cc91fc3c2d243fc151c210b" ], "No BAM files", "No CRAM files", [ - "test.mutect2.vcf.gz:md5,24b427e374c06bb68b3441af886fd7a1" + "test.mutect2.vcf.gz:md5,593f6a3b49d8a4e44b1e2696883116c0" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T13:12:41.954291312" + "timestamp": "2025-05-07T14:43:03.941019054" }, "-profile test --input tests/csv/3.0/recalibrated_tumoronly_joint.csv --tools mutect2 --joint_mutect2": { "content": [ @@ -173,28 +173,28 @@ "sample2.recal.mosdepth.region.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.summary.txt:md5,b0b47739dcafeeb1a9e6218b8abca1e0", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.recal.regions.bed.gz:md5,fb0efeba20ea272b7b709cf65246689e", - "sample2.recal.regions.bed.gz.csi:md5,19b91a252986eb863c8be568809a40f8", + "sample2.recal.regions.bed.gz.csi:md5,e8452848671e9e5c147ff4cceee944af", "sample3.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample3.recal.mosdepth.region.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample3.recal.mosdepth.summary.txt:md5,b0b47739dcafeeb1a9e6218b8abca1e0", "sample3.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample3.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample3.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample3.recal.regions.bed.gz:md5,fb0efeba20ea272b7b709cf65246689e", - "sample3.recal.regions.bed.gz.csi:md5,19b91a252986eb863c8be568809a40f8", + "sample3.recal.regions.bed.gz.csi:md5,e8452848671e9e5c147ff4cceee944af", "test.mutect2.vcf.gz.stats:md5,bd9ff0f343dd60fdd2860fdeff617a51" ], "No BAM files", "No CRAM files", [ - "test.mutect2.vcf.gz:md5,f8c8f1e1964e60690dd09b0bec2cb3f" + "test.mutect2.vcf.gz:md5,e064ce0953bb07416f3bc8a60c761238" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T13:43:47.178040106" + "timestamp": "2025-05-08T11:26:07.607972672" } -} +} \ No newline at end of file From 4bfb1dba0f59a4eebdff92b7cccfff0acab516ae Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 12:57:57 +0200 Subject: [PATCH 20/38] update snapshots --- tests/qc_ngscheckmate.nf.test.snap | 20 +++++++++---------- tests/samplesheets.nf.test.snap | 2 +- tests/save_output_as_bam.nf.test.snap | 2 +- tests/saved_mapped.nf.test.snap | 2 +- tests/start_from_markduplicates.nf.test.snap | 16 +++++++-------- ...art_from_preparerecalibration.nf.test.snap | 18 ++++++++--------- tests/start_from_recalibration.nf.test.snap | 14 ++++++------- 7 files changed, 36 insertions(+), 38 deletions(-) diff --git a/tests/qc_ngscheckmate.nf.test.snap b/tests/qc_ngscheckmate.nf.test.snap index 0e14a972e5..a0e96d0e0a 100644 --- a/tests/qc_ngscheckmate.nf.test.snap +++ b/tests/qc_ngscheckmate.nf.test.snap @@ -231,39 +231,39 @@ "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "ngscheckmate_all.txt:md5,f858e3eb892b8245cbf74cc979e4f33a", "ngscheckmate_matched.txt:md5,ab2c5b46e9a4dfb3bb54292db931b58b", - "ngscheckmate_output_corr_matrix.txt:md5,ee56010330f63577faeb598205b55f16" + "ngscheckmate_output_corr_matrix.txt:md5,a86afff85677c875503d495cbbb4f495" ], "No BAM files", "No CRAM files", [ - "sample1.ngscheckmate.vcf.gz:md5,aacee7a423693f0a44478c6061a6c77f", - "sample2.ngscheckmate.vcf.gz:md5,f6a388bef079a86dba62ec5818ce2288", - "sample3.ngscheckmate.vcf.gz:md5,aacee7a423693f0a44478c6061a6c77f", - "sample4.ngscheckmate.vcf.gz:md5,f6a388bef079a86dba62ec5818ce2288" + "sample1.ngscheckmate.vcf.gz:md5,5cffc2b460469247b346b2399dc016fd", + "sample2.ngscheckmate.vcf.gz:md5,17c1253ed56084291e919586ecf9dca", + "sample3.ngscheckmate.vcf.gz:md5,5cffc2b460469247b346b2399dc016fd", + "sample4.ngscheckmate.vcf.gz:md5,17c1253ed56084291e919586ecf9dca" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-29T11:25:12.332895104" + "timestamp": "2025-05-08T12:14:15.942392268" } } \ No newline at end of file diff --git a/tests/samplesheets.nf.test.snap b/tests/samplesheets.nf.test.snap index 432a8642c6..b8e547d70a 100644 --- a/tests/samplesheets.nf.test.snap +++ b/tests/samplesheets.nf.test.snap @@ -1,7 +1,7 @@ { "-profile test --step variant_calling --input tests/csv/3.0/recalibrated_somatic_two_normal_one_sample.csv": { "content": [ - "[Patient [test] has more than one sample [2] with normal status [0] and one sample with tumor status [1].]" + "[Patient [test] has more than one sample [2] with normal status [0] and one sample with tumor status [1].]" ], "meta": { "nf-test": "0.9.2", diff --git a/tests/save_output_as_bam.nf.test.snap b/tests/save_output_as_bam.nf.test.snap index 8c27189f44..9a5b7636d4 100644 --- a/tests/save_output_as_bam.nf.test.snap +++ b/tests/save_output_as_bam.nf.test.snap @@ -45,4 +45,4 @@ }, "timestamp": "2025-04-28T14:19:26.894332207" } -} +} \ No newline at end of file diff --git a/tests/saved_mapped.nf.test.snap b/tests/saved_mapped.nf.test.snap index cc251c85ba..e36fa94879 100644 --- a/tests/saved_mapped.nf.test.snap +++ b/tests/saved_mapped.nf.test.snap @@ -45,4 +45,4 @@ }, "timestamp": "2025-04-28T14:22:21.021247713" } -} +} \ No newline at end of file diff --git a/tests/start_from_markduplicates.nf.test.snap b/tests/start_from_markduplicates.nf.test.snap index fabbc5ffae..c7d206cf35 100644 --- a/tests/start_from_markduplicates.nf.test.snap +++ b/tests/start_from_markduplicates.nf.test.snap @@ -12,7 +12,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -151,12 +150,12 @@ "test.md.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test.md.mosdepth.summary.txt:md5,b23cf96942b2ada3f41172a9349a1175", "test.md.regions.bed.gz:md5,74cd0c779c7b3228adcf3b177333886a", - "test.md.regions.bed.gz.csi:md5,080731cdedcd389e72135f048d6e2e00", + "test.md.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917", "test.recal.mosdepth.global.dist.txt:md5,8e875e20e3fb9cf288d68c1d223f6fd5", "test.recal.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test.recal.mosdepth.summary.txt:md5,b23cf96942b2ada3f41172a9349a1175", "test.recal.regions.bed.gz:md5,74cd0c779c7b3228adcf3b177333886a", - "test.recal.regions.bed.gz.csi:md5,080731cdedcd389e72135f048d6e2e00" + "test.recal.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917" ], "No BAM files", [ @@ -169,7 +168,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:43:27.588569232" + "timestamp": "2025-05-08T12:45:53.565710622" }, "-profile test --input tests/csv/3.0/mapped_single_cram.csv --step markduplicates --tools null": { "content": [ @@ -184,7 +183,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -323,12 +321,12 @@ "test.md.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test.md.mosdepth.summary.txt:md5,b23cf96942b2ada3f41172a9349a1175", "test.md.regions.bed.gz:md5,74cd0c779c7b3228adcf3b177333886a", - "test.md.regions.bed.gz.csi:md5,080731cdedcd389e72135f048d6e2e00", + "test.md.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917", "test.recal.mosdepth.global.dist.txt:md5,8e875e20e3fb9cf288d68c1d223f6fd5", "test.recal.mosdepth.region.dist.txt:md5,75e1ce7e55af51f4985fa91654a5ea2d", "test.recal.mosdepth.summary.txt:md5,b23cf96942b2ada3f41172a9349a1175", "test.recal.regions.bed.gz:md5,74cd0c779c7b3228adcf3b177333886a", - "test.recal.regions.bed.gz.csi:md5,080731cdedcd389e72135f048d6e2e00" + "test.recal.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917" ], "No BAM files", [ @@ -341,7 +339,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:45:37.530709715" + "timestamp": "2025-05-08T12:48:32.878056713" }, "-profile test --input tests/csv/3.0/mapped_single_cram.csv --step markduplicates --skip_tools markduplicates --tools null": { "content": [ @@ -608,4 +606,4 @@ }, "timestamp": "2025-05-02T09:42:16.040955499" } -} +} \ No newline at end of file diff --git a/tests/start_from_preparerecalibration.nf.test.snap b/tests/start_from_preparerecalibration.nf.test.snap index b5200ac63d..80f822efb5 100644 --- a/tests/start_from_preparerecalibration.nf.test.snap +++ b/tests/start_from_preparerecalibration.nf.test.snap @@ -67,7 +67,7 @@ 10, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -158,7 +158,7 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.strelka.variants.bcftools_stats.txt:md5,3b37a441393a9329104451f44e56c619", + "test.strelka.variants.bcftools_stats.txt:md5,bffd4c0cf553a42c5b183220d71a1466", "test.strelka.variants.FILTER.summary:md5,39ff2cc8eb7495a14a6b76e0ab627027", "test.strelka.variants.TsTv.count:md5,ee7dafc8d941b8502a04a63dc3126fff" ], @@ -171,16 +171,16 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "25.01.0" + "nextflow": "24.10.6" }, - "timestamp": "2025-03-07T15:43:41.536174428" + "timestamp": "2025-05-08T12:51:50.326992843" }, "-profile test --input tests/csv/3.0/mapped_single_bam.csv --step prepare_recalibration --skip_tools baserecalibrator --tools strelka": { "content": [ 10, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -271,7 +271,7 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.strelka.variants.bcftools_stats.txt:md5,3b37a441393a9329104451f44e56c619", + "test.strelka.variants.bcftools_stats.txt:md5,bffd4c0cf553a42c5b183220d71a1466", "test.strelka.variants.FILTER.summary:md5,39ff2cc8eb7495a14a6b76e0ab627027", "test.strelka.variants.TsTv.count:md5,ee7dafc8d941b8502a04a63dc3126fff" ], @@ -284,9 +284,9 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.5" + "nextflow": "24.10.6" }, - "timestamp": "2025-04-08T17:18:07.556423068" + "timestamp": "2025-05-08T12:50:55.216033207" }, "-profile test --input tests/csv/3.0/mapped_single_cram.csv --step prepare_recalibration --tools null": { "content": [ @@ -377,4 +377,4 @@ }, "timestamp": "2025-04-28T14:50:25.563557393" } -} +} \ No newline at end of file diff --git a/tests/start_from_recalibration.nf.test.snap b/tests/start_from_recalibration.nf.test.snap index efc519a5aa..69b4216db8 100644 --- a/tests/start_from_recalibration.nf.test.snap +++ b/tests/start_from_recalibration.nf.test.snap @@ -43,7 +43,7 @@ 10, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -134,7 +134,7 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.strelka.variants.bcftools_stats.txt:md5,3b37a441393a9329104451f44e56c619", + "test.strelka.variants.bcftools_stats.txt:md5,bffd4c0cf553a42c5b183220d71a1466", "test.strelka.variants.FILTER.summary:md5,39ff2cc8eb7495a14a6b76e0ab627027", "test.strelka.variants.TsTv.count:md5,ee7dafc8d941b8502a04a63dc3126fff" ], @@ -149,14 +149,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-25T14:46:10.828807912" + "timestamp": "2025-05-08T12:55:31.433270271" }, "-profile test --input tests/csv/3.0/mapped_single_bam.csv --step recalibrate --skip_tools baserecalibrator --tools strelka": { "content": [ 10, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -247,7 +247,7 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.strelka.variants.bcftools_stats.txt:md5,3b37a441393a9329104451f44e56c619", + "test.strelka.variants.bcftools_stats.txt:md5,bffd4c0cf553a42c5b183220d71a1466", "test.strelka.variants.FILTER.summary:md5,39ff2cc8eb7495a14a6b76e0ab627027", "test.strelka.variants.TsTv.count:md5,ee7dafc8d941b8502a04a63dc3126fff" ], @@ -262,7 +262,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-25T14:45:07.515187647" + "timestamp": "2025-05-08T12:54:37.674975509" }, "-profile test --input tests/csv/3.0/mapped_single_cram.csv --step recalibrate --tools null": { "content": [ @@ -329,4 +329,4 @@ }, "timestamp": "2025-04-28T14:51:52.5491393" } -} +} \ No newline at end of file From 691f363b3d27374207f92b2ac9a8106349f3e23c Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 13:13:54 +0200 Subject: [PATCH 21/38] update snapshot --- tests/tumor-normal-pair.nf.test.snap | 25 ++++++++++++------------- 1 file changed, 12 insertions(+), 13 deletions(-) diff --git a/tests/tumor-normal-pair.nf.test.snap b/tests/tumor-normal-pair.nf.test.snap index 0993e9a66f..cf483f2c31 100644 --- a/tests/tumor-normal-pair.nf.test.snap +++ b/tests/tumor-normal-pair.nf.test.snap @@ -4,7 +4,7 @@ 40, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", @@ -22,7 +22,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -318,29 +317,29 @@ "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "samtools-stats-dp.txt:md5,d81e84864ecb732951a137e88d87a263", "samtools_alignment_plot.txt:md5,e757696d1f7107df2bd4ad92f607272e", - "test.strelka.variants.bcftools_stats.txt:md5,550430d0b8336ac650b7e50bdfdc914c", - "test2_vs_test.strelka.somatic_indels.bcftools_stats.txt:md5,2ce8bffbfbb88c4da6a5239b11dc2f44", - "test2_vs_test.strelka.somatic_snvs.bcftools_stats.txt:md5,869e2d3a46760e2bea9b2e027002848d", + "test.strelka.variants.bcftools_stats.txt:md5,3e171488118dbc521668c1cb79414410", + "test2_vs_test.strelka.somatic_indels.bcftools_stats.txt:md5,5e8f9a8fdbc765ced736d0c8c7dd3a52", + "test2_vs_test.strelka.somatic_snvs.bcftools_stats.txt:md5,edb7763fad7b6f825e47e01ffa70adbc", "test.md.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test.md.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test.md.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test.md.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test.md.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test.md.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test.recal.mosdepth.global.dist.txt:md5,76fa71922a3f748e507c2364c531dfcb", "test.recal.mosdepth.region.dist.txt:md5,abc5df85e302b79985627888870882da", "test.recal.mosdepth.summary.txt:md5,d536456436eb275159b8c6af83213d80", "test.recal.regions.bed.gz:md5,b25a2798061021c0b2f4e1d18219bbbd", - "test.recal.regions.bed.gz.csi:md5,05d571f8d51ca6b1bde804d7a6d999af", + "test.recal.regions.bed.gz.csi:md5,b1c2a861f64e20a94108a6de3b76c582", "test2.md.mosdepth.global.dist.txt:md5,2020cf6dfc7ddca020c921dd9f0549b7", "test2.md.mosdepth.region.dist.txt:md5,38ff8b38c33b9231f047fea8ea830aae", "test2.md.mosdepth.summary.txt:md5,8b991358768cade225470a07cd34f573", "test2.md.regions.bed.gz:md5,08e767f91a0a8d82733f0040e804a85f", - "test2.md.regions.bed.gz.csi:md5,eba5aca0b8f72759192bbdd29330278e", + "test2.md.regions.bed.gz.csi:md5,d5f1c9389ecf52ba839e834780a94549", "test2.recal.mosdepth.global.dist.txt:md5,2020cf6dfc7ddca020c921dd9f0549b7", "test2.recal.mosdepth.region.dist.txt:md5,38ff8b38c33b9231f047fea8ea830aae", "test2.recal.mosdepth.summary.txt:md5,8b991358768cade225470a07cd34f573", "test2.recal.regions.bed.gz:md5,08e767f91a0a8d82733f0040e804a85f", - "test2.recal.regions.bed.gz.csi:md5,eba5aca0b8f72759192bbdd29330278e", + "test2.recal.regions.bed.gz.csi:md5,d5f1c9389ecf52ba839e834780a94549", "test.strelka.variants.FILTER.summary:md5,dd87f507da7de20d5318841af312493b", "test.strelka.variants.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "test2_vs_test.strelka.somatic_indels.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -356,8 +355,8 @@ "test2.recal.cram:md5,f4205ab086600ba2927e1468dc732976" ], [ - "test.strelka.genome.vcf.gz:md5,16437a040679d88b7d84a9276f793d6c", - "test.strelka.variants.vcf.gz:md5,666f835fdaf4952a179cdedd40c9d565", + "test.strelka.genome.vcf.gz:md5,1e55bf36b678e91f8ac7ee73f37815c0", + "test.strelka.variants.vcf.gz:md5,e81855d97d9077edb8d99052ed595fd5", "test2_vs_test.strelka.somatic_indels.vcf.gz:md5,d41d8cd98f00b204e9800998ecf8427e", "test2_vs_test.strelka.somatic_snvs.vcf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -366,6 +365,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:33:30.033068515" + "timestamp": "2025-05-08T13:01:50.459596949" } -} +} \ No newline at end of file From 309b2252be2e1c51fecd63d8dbc595df5f7a7f50 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 15:05:49 +0200 Subject: [PATCH 22/38] update snapshots --- .../variant_calling_controlfreec.nf.test.snap | 14 ++-- ...riant_calling_haplotypecaller.nf.test.snap | 42 +++++----- tests/variant_calling_manta.nf.test.snap | 80 +++++++++---------- .../variant_calling_msisensorpro.nf.test.snap | 10 +-- tests/variant_calling_strelka.nf.test.snap | 62 +++++++------- tests/variant_calling_strelka_bp.nf.test.snap | 40 +++++----- 6 files changed, 124 insertions(+), 124 deletions(-) diff --git a/tests/variant_calling_controlfreec.nf.test.snap b/tests/variant_calling_controlfreec.nf.test.snap index e9845d0045..eb3724b9c5 100644 --- a/tests/variant_calling_controlfreec.nf.test.snap +++ b/tests/variant_calling_controlfreec.nf.test.snap @@ -181,7 +181,7 @@ "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.summary.txt:md5,0a7300e56eda6fba7c7564f00aa000f0", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.bed:md5,5249f46e614b60867bdd6b9b83327979", "sample2.circos.txt:md5,2efab24d023931cec8b158c56d1f1765", "sample2.p.value.txt:md5,38c8c9ad33a4fca3804a34d5c436cd1e", @@ -203,7 +203,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T15:27:35.607451098" + "timestamp": "2025-05-08T13:50:10.007345887" }, "-profile test --tools controlfreec somatic": { "content": [ @@ -291,16 +291,16 @@ "sample3.recal.mosdepth.region.dist.txt:md5,6ec49cd7d510c2eb3d9d90fdb79b783a", "sample3.recal.mosdepth.summary.txt:md5,103098d0bf76ed82d2b87d5f242b099a", "sample3.recal.per-base.bed.gz:md5,297f96648928d0ca5184223fb9941e7c", - "sample3.recal.per-base.bed.gz.csi:md5,519cc5bf84da0d71b87a88c76f83194e", + "sample3.recal.per-base.bed.gz.csi:md5,c67dcd711b096eb42f43784d5eadbc0d", "sample3.recal.regions.bed.gz:md5,314ce8d7273eff353072108aa77c327c", - "sample3.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample3.recal.regions.bed.gz.csi:md5,9cb0ad7039a3b703d16ca7d5b835c0ee", "sample4.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample4.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample4.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample4.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample4.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample4.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample4.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample4.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample4.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample4_vs_sample3.bed:md5,47f60179409e9389e59b2e2525e42210", "sample4_vs_sample3.circos.txt:md5,68addb1d8bda08355842bef0ab15cd6e", "sample4_vs_sample3.normal.mpileup.gz_control.cpn:md5,d50bf2c9a4d35f022364901c284e80ed", @@ -323,7 +323,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T15:25:16.602158101" + "timestamp": "2025-05-08T13:48:46.786760162" }, "-profile test --tools controlfreec --no_intervals somatic stub": { "content": [ diff --git a/tests/variant_calling_haplotypecaller.nf.test.snap b/tests/variant_calling_haplotypecaller.nf.test.snap index c0af8b19e5..3de65aea50 100644 --- a/tests/variant_calling_haplotypecaller.nf.test.snap +++ b/tests/variant_calling_haplotypecaller.nf.test.snap @@ -4,7 +4,7 @@ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "GATK4_HAPLOTYPECALLER": { "gatk4": "4.6.1.0" @@ -109,11 +109,11 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.haplotypecaller.bcftools_stats.txt:md5,a20ca016416f2b455fa7b0c548687aac", + "test.haplotypecaller.bcftools_stats.txt:md5,1497941f37b14c39a24490a50a97e365", "test.recal.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e", "test.recal.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59", "test.recal.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa", - "test.recal.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294", + "test.recal.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4", "test.haplotypecaller.FILTER.summary:md5,87a84b5f8ac3d3cbeeef7d60afcdbfe7", "test.haplotypecaller.TsTv.count:md5,b77c120ee5cc0423267200c67d60c663" ], @@ -127,14 +127,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:12:04.628297495" + "timestamp": "2025-05-08T14:27:03.361772335" }, "-profile test --input mapped_single_bam.csv --tools haplotypecaller --step variant_calling --wes --nucleotides_per_second 20 --skip_tools haplotypecaller_filter": { "content": [ 14, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "GATK4_HAPLOTYPECALLER": { "gatk4": "4.6.1.0" @@ -242,14 +242,14 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.haplotypecaller.bcftools_stats.txt:md5,a20ca016416f2b455fa7b0c548687aac", + "test.haplotypecaller.bcftools_stats.txt:md5,1497941f37b14c39a24490a50a97e365", "test.recal.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e", "test.recal.mosdepth.region.dist.txt:md5,3a2030e5e8af7bc12720c3a5592bf921", "test.recal.mosdepth.summary.txt:md5,615c5c5019d88045a9ff5bbe6e63d270", "test.recal.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa", - "test.recal.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294", + "test.recal.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4", "test.recal.regions.bed.gz:md5,0c8215fbea7b0bf7aba9d1781575f905", - "test.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "test.recal.regions.bed.gz.csi:md5,5c00a1d457c387d6e71848a6d897e309", "test.haplotypecaller.FILTER.summary:md5,87a84b5f8ac3d3cbeeef7d60afcdbfe7", "test.haplotypecaller.TsTv.count:md5,b77c120ee5cc0423267200c67d60c663" ], @@ -263,17 +263,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:10:34.337617614" + "timestamp": "2025-05-08T14:26:09.861669442" }, "-profile test --input mapped_single_bam.csv --tools haplotypecaller --step variant_calling --wes --nucleotides_per_second 20 --no_intervals": { "content": [ 11, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CNNSCOREVARIANTS": { - "gatk4": "4.6.1.0" + "gatk4": "4.5.0.0" }, "FILTERVARIANTTRANCHES": { "gatk4": "4.6.1.0" @@ -383,11 +383,11 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.haplotypecaller.filtered.bcftools_stats.txt:md5,83e1b9b77606129d621f3c571dd67adb", + "test.haplotypecaller.filtered.bcftools_stats.txt:md5,bfdbcc0c0513be1e223434eefee3b90b", "test.recal.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e", "test.recal.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59", "test.recal.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa", - "test.recal.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294", + "test.recal.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4", "test.haplotypecaller.filtered.FILTER.summary:md5,4e2ceea7f3ff998004691fd71192d9ee", "test.haplotypecaller.filtered.TsTv.count:md5,b77c120ee5cc0423267200c67d60c663" ], @@ -402,17 +402,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:08:52.542503702" + "timestamp": "2025-05-08T14:25:05.652674847" }, "-profile test --input mapped_single_bam.csv --tools haplotypecaller --step variant_calling --wes --nucleotides_per_second 20": { "content": [ 16, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CNNSCOREVARIANTS": { - "gatk4": "4.6.1.0" + "gatk4": "4.5.0.0" }, "FILTERVARIANTTRANCHES": { "gatk4": "4.6.1.0" @@ -525,14 +525,14 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.haplotypecaller.filtered.bcftools_stats.txt:md5,83e1b9b77606129d621f3c571dd67adb", + "test.haplotypecaller.filtered.bcftools_stats.txt:md5,bfdbcc0c0513be1e223434eefee3b90b", "test.recal.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e", "test.recal.mosdepth.region.dist.txt:md5,3a2030e5e8af7bc12720c3a5592bf921", "test.recal.mosdepth.summary.txt:md5,615c5c5019d88045a9ff5bbe6e63d270", "test.recal.per-base.bed.gz:md5,da6db0fb375a3053a89db8c935eebbaa", - "test.recal.per-base.bed.gz.csi:md5,6f322dc9250522a701bd68bd18fa8294", + "test.recal.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4", "test.recal.regions.bed.gz:md5,0c8215fbea7b0bf7aba9d1781575f905", - "test.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "test.recal.regions.bed.gz.csi:md5,5c00a1d457c387d6e71848a6d897e309", "test.haplotypecaller.filtered.FILTER.summary:md5,4e2ceea7f3ff998004691fd71192d9ee", "test.haplotypecaller.filtered.TsTv.count:md5,b77c120ee5cc0423267200c67d60c663" ], @@ -547,6 +547,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:07:03.169192156" + "timestamp": "2025-05-08T14:23:55.870403231" } -} +} \ No newline at end of file diff --git a/tests/variant_calling_manta.nf.test.snap b/tests/variant_calling_manta.nf.test.snap index f84513541e..13468d1dc0 100644 --- a/tests/variant_calling_manta.nf.test.snap +++ b/tests/variant_calling_manta.nf.test.snap @@ -4,7 +4,7 @@ 11, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -80,12 +80,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.manta.diploid_sv.bcftools_stats.txt:md5,216eda1200c48453b7b0ed04748acf8a", + "sample1.manta.diploid_sv.bcftools_stats.txt:md5,636109db283cbee4539786928c811893", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample1.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], @@ -99,14 +99,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:20:57.270937462" + "timestamp": "2025-05-08T14:41:23.824593113" }, "-profile test --tools manta --no_intervals tumoronly": { "content": [ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_TUMORONLY": { "manta": "1.6.0" @@ -185,12 +185,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.manta.tumor_sv.bcftools_stats.txt:md5,e57a0a2251b8acff3c804a59f01bb744", + "sample2.manta.tumor_sv.bcftools_stats.txt:md5,9fbe26c75869000b526b59b454f76f6a", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample2.manta.tumor_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample2.manta.tumor_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], @@ -204,14 +204,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:29:42.195437933" + "timestamp": "2025-05-08T14:46:39.812689739" }, "-profile test --tools manta --no_intervals somatic": { "content": [ 20, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -316,19 +316,19 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.manta.diploid_sv.bcftools_stats.txt:md5,8adad91e1c8dc8db63cf9b3607bee3a0", - "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,17dc847445b98885bc18622f862f44d9", - "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,a8660b352950f0b32768fcbbd6b48896", + "sample3.manta.diploid_sv.bcftools_stats.txt:md5,36a838390faba81e3eabf5ac8a093a4a", + "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,f00cf810d34ef7e5c7980f7039bb4446", + "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,7af2ea2e84154ddf2a483b1bd1f0646c", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample3.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "sample4_vs_sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -348,14 +348,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:26:31.398077875" + "timestamp": "2025-05-08T14:44:38.09078725" }, "-profile test --tools manta tumoronly": { "content": [ 11, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_TUMORONLY": { "manta": "1.6.0" @@ -431,12 +431,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.manta.tumor_sv.bcftools_stats.txt:md5,e57a0a2251b8acff3c804a59f01bb744", + "sample2.manta.tumor_sv.bcftools_stats.txt:md5,9fbe26c75869000b526b59b454f76f6a", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample2.manta.tumor_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample2.manta.tumor_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], @@ -450,14 +450,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:27:58.506339727" + "timestamp": "2025-05-08T14:45:35.363106238" }, "-profile test --tools manta --only_paired_variant_calling": { "content": [ 31, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -587,30 +587,30 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.manta.diploid_sv.bcftools_stats.txt:md5,216eda1200c48453b7b0ed04748acf8a", - "sample2.manta.tumor_sv.bcftools_stats.txt:md5,e57a0a2251b8acff3c804a59f01bb744", - "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,17dc847445b98885bc18622f862f44d9", - "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,a8660b352950f0b32768fcbbd6b48896", + "sample1.manta.diploid_sv.bcftools_stats.txt:md5,636109db283cbee4539786928c811893", + "sample2.manta.tumor_sv.bcftools_stats.txt:md5,9fbe26c75869000b526b59b454f76f6a", + "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,f00cf810d34ef7e5c7980f7039bb4446", + "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,7af2ea2e84154ddf2a483b1bd1f0646c", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample1.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample1.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "sample2.manta.tumor_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -633,14 +633,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:19:25.988979988" + "timestamp": "2025-05-08T14:40:26.327204878" }, "-profile test --tools manta somatic": { "content": [ 22, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -742,19 +742,19 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.manta.diploid_sv.bcftools_stats.txt:md5,8adad91e1c8dc8db63cf9b3607bee3a0", - "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,17dc847445b98885bc18622f862f44d9", - "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,a8660b352950f0b32768fcbbd6b48896", + "sample3.manta.diploid_sv.bcftools_stats.txt:md5,36a838390faba81e3eabf5ac8a093a4a", + "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,f00cf810d34ef7e5c7980f7039bb4446", + "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,7af2ea2e84154ddf2a483b1bd1f0646c", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample3.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "sample4_vs_sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -774,14 +774,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:24:36.505592567" + "timestamp": "2025-05-08T14:43:27.984136675" }, "-profile test --tools manta --no_intervals germline": { "content": [ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -860,12 +860,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.manta.diploid_sv.bcftools_stats.txt:md5,216eda1200c48453b7b0ed04748acf8a", + "sample1.manta.diploid_sv.bcftools_stats.txt:md5,636109db283cbee4539786928c811893", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample1.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], @@ -879,6 +879,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:22:35.946897081" + "timestamp": "2025-05-08T14:42:20.132883277" } } \ No newline at end of file diff --git a/tests/variant_calling_msisensorpro.nf.test.snap b/tests/variant_calling_msisensorpro.nf.test.snap index 052643f4eb..9db3386cd4 100644 --- a/tests/variant_calling_msisensorpro.nf.test.snap +++ b/tests/variant_calling_msisensorpro.nf.test.snap @@ -104,16 +104,16 @@ "sample3.recal.mosdepth.region.dist.txt:md5,6ec49cd7d510c2eb3d9d90fdb79b783a", "sample3.recal.mosdepth.summary.txt:md5,103098d0bf76ed82d2b87d5f242b099a", "sample3.recal.per-base.bed.gz:md5,297f96648928d0ca5184223fb9941e7c", - "sample3.recal.per-base.bed.gz.csi:md5,519cc5bf84da0d71b87a88c76f83194e", + "sample3.recal.per-base.bed.gz.csi:md5,c67dcd711b096eb42f43784d5eadbc0d", "sample3.recal.regions.bed.gz:md5,314ce8d7273eff353072108aa77c327c", - "sample3.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample3.recal.regions.bed.gz.csi:md5,9cb0ad7039a3b703d16ca7d5b835c0ee", "sample4.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample4.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample4.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample4.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample4.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample4.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample4.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample4.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample4.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample4_vs_sample3:md5,db7f2cc99ea79f79b0ba011c4bcbb43d", "sample4_vs_sample3_dis:md5,e2fd47a3359bb562f604a6f0a126e107", "sample4_vs_sample3_germline:md5,ba585b355c08877b8bca4901f49d9311", @@ -127,7 +127,7 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-29T14:17:23.746727114" + "timestamp": "2025-05-08T14:34:18.537743086" }, "-profile test --tools msisensorpro somatic --build_only_index --input false": { "content": [ diff --git a/tests/variant_calling_strelka.nf.test.snap b/tests/variant_calling_strelka.nf.test.snap index 5872e24c54..e84b19f2d3 100644 --- a/tests/variant_calling_strelka.nf.test.snap +++ b/tests/variant_calling_strelka.nf.test.snap @@ -4,7 +4,7 @@ 22, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -135,19 +135,19 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.strelka.variants.bcftools_stats.txt:md5,d505d381e8c3906788e4135bb975ff84", - "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,1c57e5cd6424157536276002ef1a58d6", - "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,8cf6d0b3f41436cd2f2aa09c9831764d", + "sample3.strelka.variants.bcftools_stats.txt:md5,6d4d032ba146941cb226765aaed9d67f", + "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,62c6123f6494c3cdbd42dc7230e757b3", + "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,8404ea88658fbc41d447ba20bf46dd0a", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.strelka.variants.FILTER.summary:md5,fef8aeadd3b0f3b8c040c0da03bf1cbd", "sample3.strelka.variants.TsTv.count:md5,c5b7a8eda2526d899098439ae4c06a49", "sample4_vs_sample3.strelka.somatic_indels.FILTER.summary:md5,30a45e2bc87f40c89388032cbf75ec65", @@ -168,14 +168,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:15:06.745770667" + "timestamp": "2025-05-08T14:53:30.174715323" }, "-profile test --tools strelka germline": { "content": [ 11, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -276,12 +276,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.strelka.variants.bcftools_stats.txt:md5,2936f10f99295fb772d8c35f246e223d", + "sample1.strelka.variants.bcftools_stats.txt:md5,7d091579d450a6f6d6e6ed9795dce0cb", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.strelka.variants.FILTER.summary:md5,fef8aeadd3b0f3b8c040c0da03bf1cbd", "sample1.strelka.variants.TsTv.count:md5,c5b7a8eda2526d899098439ae4c06a49" ], @@ -296,14 +296,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:11:35.623933346" + "timestamp": "2025-05-08T14:50:13.253546511" }, "-profile test --tools strelka --only_paired_variant_calling": { "content": [ 26, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -450,29 +450,29 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.strelka.variants.bcftools_stats.txt:md5,2936f10f99295fb772d8c35f246e223d", - "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,1c57e5cd6424157536276002ef1a58d6", - "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,8cf6d0b3f41436cd2f2aa09c9831764d", + "sample1.strelka.variants.bcftools_stats.txt:md5,7d091579d450a6f6d6e6ed9795dce0cb", + "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,62c6123f6494c3cdbd42dc7230e757b3", + "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,8404ea88658fbc41d447ba20bf46dd0a", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample1.strelka.variants.FILTER.summary:md5,fef8aeadd3b0f3b8c040c0da03bf1cbd", "sample1.strelka.variants.TsTv.count:md5,c5b7a8eda2526d899098439ae4c06a49", "sample4_vs_sample3.strelka.somatic_indels.FILTER.summary:md5,30a45e2bc87f40c89388032cbf75ec65", @@ -493,14 +493,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:09:46.255572597" + "timestamp": "2025-05-08T14:48:42.776313855" }, "-profile test --tools strelka --no_intervals germline": { "content": [ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -604,12 +604,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.strelka.variants.bcftools_stats.txt:md5,0e829f5d31d768a8e99786786282c9ef", + "sample1.strelka.variants.bcftools_stats.txt:md5,a125b261633ee5e73c4c0bfead86c77c", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.strelka.variants.FILTER.summary:md5,8697a0a983314e98b99b5f6038af65f6", "sample1.strelka.variants.TsTv.count:md5,1481854d2a765f5641856ecf95ca4097" ], @@ -624,14 +624,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:13:11.18647863" + "timestamp": "2025-05-08T14:51:41.478100582" }, "-profile test --tools strelka --no_intervals somatic": { "content": [ 20, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "STRELKA_SINGLE": { "strelka": "2.9.10" @@ -765,19 +765,19 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.strelka.variants.bcftools_stats.txt:md5,c75a458b1aa0e1bae3b667d48684e13c", - "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,1c57e5cd6424157536276002ef1a58d6", - "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,110810e5702ef11bc002bd0948dbdfff", + "sample3.strelka.variants.bcftools_stats.txt:md5,322c544c624565a9ab0e128bca556d81", + "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,62c6123f6494c3cdbd42dc7230e757b3", + "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,eec9d410eb24068b9a67be417c41d54e", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.strelka.variants.FILTER.summary:md5,8697a0a983314e98b99b5f6038af65f6", "sample3.strelka.variants.TsTv.count:md5,1481854d2a765f5641856ecf95ca4097", "sample4_vs_sample3.strelka.somatic_indels.FILTER.summary:md5,30a45e2bc87f40c89388032cbf75ec65", @@ -798,6 +798,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:17:27.522397279" + "timestamp": "2025-05-08T14:55:20.601666431" } } \ No newline at end of file diff --git a/tests/variant_calling_strelka_bp.nf.test.snap b/tests/variant_calling_strelka_bp.nf.test.snap index 6156be20e1..9d1d047e46 100644 --- a/tests/variant_calling_strelka_bp.nf.test.snap +++ b/tests/variant_calling_strelka_bp.nf.test.snap @@ -4,7 +4,7 @@ 34, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -171,22 +171,22 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.manta.diploid_sv.bcftools_stats.txt:md5,8adad91e1c8dc8db63cf9b3607bee3a0", - "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,17dc847445b98885bc18622f862f44d9", - "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,a8660b352950f0b32768fcbbd6b48896", - "sample3.strelka.variants.bcftools_stats.txt:md5,c75a458b1aa0e1bae3b667d48684e13c", - "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,1c57e5cd6424157536276002ef1a58d6", - "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,110810e5702ef11bc002bd0948dbdfff", + "sample3.manta.diploid_sv.bcftools_stats.txt:md5,36a838390faba81e3eabf5ac8a093a4a", + "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,f00cf810d34ef7e5c7980f7039bb4446", + "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,7af2ea2e84154ddf2a483b1bd1f0646c", + "sample3.strelka.variants.bcftools_stats.txt:md5,322c544c624565a9ab0e128bca556d81", + "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,62c6123f6494c3cdbd42dc7230e757b3", + "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,eec9d410eb24068b9a67be417c41d54e", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample3.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "sample4_vs_sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -216,14 +216,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:21:44.356378218" + "timestamp": "2025-05-08T14:59:46.677743775" }, "-profile test --tools manta,strelka somatic": { "content": [ 36, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "MANTA_GERMLINE": { "manta": "1.6.0" @@ -387,22 +387,22 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.manta.diploid_sv.bcftools_stats.txt:md5,8adad91e1c8dc8db63cf9b3607bee3a0", - "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,17dc847445b98885bc18622f862f44d9", - "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,a8660b352950f0b32768fcbbd6b48896", - "sample3.strelka.variants.bcftools_stats.txt:md5,d505d381e8c3906788e4135bb975ff84", - "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,1c57e5cd6424157536276002ef1a58d6", - "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,8cf6d0b3f41436cd2f2aa09c9831764d", + "sample3.manta.diploid_sv.bcftools_stats.txt:md5,36a838390faba81e3eabf5ac8a093a4a", + "sample4_vs_sample3.manta.diploid_sv.bcftools_stats.txt:md5,f00cf810d34ef7e5c7980f7039bb4446", + "sample4_vs_sample3.manta.somatic_sv.bcftools_stats.txt:md5,7af2ea2e84154ddf2a483b1bd1f0646c", + "sample3.strelka.variants.bcftools_stats.txt:md5,6d4d032ba146941cb226765aaed9d67f", + "sample4_vs_sample3.strelka.somatic_indels.bcftools_stats.txt:md5,62c6123f6494c3cdbd42dc7230e757b3", + "sample4_vs_sample3.strelka.somatic_snvs.bcftools_stats.txt:md5,8404ea88658fbc41d447ba20bf46dd0a", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample3.manta.diploid_sv.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "sample4_vs_sample3.manta.diploid_sv.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -432,6 +432,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:19:41.248210165" + "timestamp": "2025-05-08T14:57:37.902465064" } } \ No newline at end of file From 8a45b18d5bdacae17c7a4f4b1b8ea26cc09c9da1 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 15:37:16 +0200 Subject: [PATCH 23/38] update snapshots --- tests/variant_calling_lofreq.nf.test.snap | 18 ++++++------ tests/variant_calling_tiddit.nf.test.snap | 34 +++++++++++------------ 2 files changed, 26 insertions(+), 26 deletions(-) diff --git a/tests/variant_calling_lofreq.nf.test.snap b/tests/variant_calling_lofreq.nf.test.snap index 79aad3ab38..a0c917a7a2 100644 --- a/tests/variant_calling_lofreq.nf.test.snap +++ b/tests/variant_calling_lofreq.nf.test.snap @@ -4,7 +4,7 @@ 11, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "LOFREQ": { "lofreq": "2.1.5" @@ -102,14 +102,14 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.lofreq.bcftools_stats.txt:md5,9c9de2e4ed2f324adf1912a45d73601f", + "sample2.lofreq.bcftools_stats.txt:md5,a8a850fdd11644fa4b770971dfe37194", "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample2.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample2.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample2.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample2.lofreq.FILTER.summary:md5,8dd8a0c91d5c4a260b462e04f615e502" ], "No BAM files", @@ -122,14 +122,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:14:58.339195663" + "timestamp": "2025-05-08T15:24:24.279180064" }, "-profile test --tools lofreq --no_intervals tumoronly": { "content": [ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "LOFREQ": { "lofreq": "2.1.5" @@ -227,11 +227,11 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.lofreq.bcftools_stats.txt:md5,e838ce412fc091918059e79727b35785", + "sample2.lofreq.bcftools_stats.txt:md5,dd602205b6d368eb0e21d2a94c36e0de", "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.summary.txt:md5,0a7300e56eda6fba7c7564f00aa000f0", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.lofreq.FILTER.summary:md5,72beda1b57da053eb352204828605a40" ], "No BAM files", @@ -244,6 +244,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:17:10.896507141" + "timestamp": "2025-05-08T15:26:34.298298945" } } \ No newline at end of file diff --git a/tests/variant_calling_tiddit.nf.test.snap b/tests/variant_calling_tiddit.nf.test.snap index cc4f4414f1..4e2e17cf5c 100644 --- a/tests/variant_calling_tiddit.nf.test.snap +++ b/tests/variant_calling_tiddit.nf.test.snap @@ -4,10 +4,10 @@ 12, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "TABIX_BGZIP_TIDDIT_SV": { - "tabix": 1.2 + "tabix": 1.21 }, "TIDDIT_SV": { "tiddit": "3.6.1" @@ -84,12 +84,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.tiddit.bcftools_stats.txt:md5,dd0c50c4f3d5b05accfb0985def2c459", + "sample1.tiddit.bcftools_stats.txt:md5,ee25406b8d3ed73eaa8a66972c805c1f", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.tiddit.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample1.tiddit.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], @@ -103,17 +103,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:23:16.417462067" + "timestamp": "2025-05-08T15:28:33.593515141" }, "-profile test --tools tiddit tumoronly": { "content": [ 12, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "TABIX_BGZIP_TIDDIT_SV": { - "tabix": 1.2 + "tabix": 1.21 }, "TIDDIT_SV": { "tiddit": "3.6.1" @@ -190,12 +190,12 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.tiddit.bcftools_stats.txt:md5,a08085171756bfa2692781a469eb595d", + "sample2.tiddit.bcftools_stats.txt:md5,82343c0b28dace889f164bbb256a8461", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample2.tiddit.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample2.tiddit.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a" ], @@ -209,21 +209,21 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:26:44.820878609" + "timestamp": "2025-05-08T15:32:24.912145963" }, "-profile test --tools tiddit somatic": { "content": [ 23, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "SVDB_MERGE": { "svdb": "2.8.2", "bcftools": 1.21 }, "TABIX_BGZIP_TIDDIT_SV": { - "tabix": 1.2 + "tabix": 1.21 }, "TIDDIT_SV": { "tiddit": "3.6.1" @@ -321,18 +321,18 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample3.tiddit.bcftools_stats.txt:md5,a1e2cc3cee75edf3cdb8ae312b7e5d23", - "sample4_vs_sample3.tiddit_sv_merge.bcftools_stats.txt:md5,1a1281463c1dfacf96cec6b67c3ab410", + "sample3.tiddit.bcftools_stats.txt:md5,b8a60370884c8f2c94baa7d3e859492f", + "sample4_vs_sample3.tiddit_sv_merge.bcftools_stats.txt:md5,82f123b157211ac9b8d3b145bbea2147", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.tiddit.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample3.tiddit.TsTv.count:md5,fa27f678965b7cba6a92efcd039f802a", "sample4_vs_sample3.tiddit_sv_merge.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", @@ -351,6 +351,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:25:36.493663121" + "timestamp": "2025-05-08T15:30:53.423070589" } } \ No newline at end of file From 403dd9d6015499894076d61870a9a90469b5fd0a Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 16:27:55 +0200 Subject: [PATCH 24/38] update snapshots --- .../variant_calling_deepvariant.nf.test.snap | 38 +++++++++---------- tests/variant_calling_muse.nf.test.snap | 26 ++++++------- 2 files changed, 32 insertions(+), 32 deletions(-) diff --git a/tests/variant_calling_deepvariant.nf.test.snap b/tests/variant_calling_deepvariant.nf.test.snap index 2371cb36fa..a772851ca7 100644 --- a/tests/variant_calling_deepvariant.nf.test.snap +++ b/tests/variant_calling_deepvariant.nf.test.snap @@ -4,10 +4,10 @@ 12, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "DEEPVARIANT_RUNDEEPVARIANT": { - "deepvariant": "1.6.1" + "deepvariant": "1.8.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -105,7 +105,7 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.deepvariant.bcftools_stats.txt:md5,4602909f8d2553ba7e74042f26494798", + "test.deepvariant.bcftools_stats.txt:md5,942c7931ed08d691a32859dff091c22f", "test.recal.mosdepth.global.dist.txt:md5,bdb8f185c35dd1eec7ce2f69bce57972", "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", @@ -117,25 +117,25 @@ "No BAM files", "No CRAM files", [ - "test.deepvariant.g.vcf.gz:md5,35b7f653833947fdcfae2b93961ee374", - "test.deepvariant.vcf.gz:md5,b6ba3ee8485299571ff23e0328367790" + "test.deepvariant.g.vcf.gz:md5,a51327a75372557eece796de33dc3318", + "test.deepvariant.vcf.gz:md5,e4a7b726e2f3db8ac15d08dd7e564519" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T15:38:32.802309766" + "timestamp": "2025-05-08T16:15:10.16958337" }, "-profile test --tools deepvariant --input tests/csv/3.0/mapped_single_cram.csv -with-stub": { "content": [ 12, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "DEEPVARIANT_RUNDEEPVARIANT": { - "deepvariant": "1.6.1" + "deepvariant": "1.8.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -337,17 +337,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T19:17:55.411970058" + "timestamp": "2025-05-08T16:18:15.847523817" }, "-profile test --tools deepvariant --input tests/csv/3.0/mapped_single_cram.csv --no_intervals -with-stub": { "content": [ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "DEEPVARIANT_RUNDEEPVARIANT": { - "deepvariant": "1.6.1" + "deepvariant": "1.8.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -552,17 +552,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T19:18:35.510258408" + "timestamp": "2025-05-08T16:19:21.666525055" }, "-profile test --tools deepvariant --input tests/csv/3.0/mapped_single_cram.csv --no_intervals": { "content": [ 9, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "DEEPVARIANT_RUNDEEPVARIANT": { - "deepvariant": "1.6.1" + "deepvariant": "1.8.0" }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -663,7 +663,7 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "test.deepvariant.bcftools_stats.txt:md5,4602909f8d2553ba7e74042f26494798", + "test.deepvariant.bcftools_stats.txt:md5,942c7931ed08d691a32859dff091c22f", "test.recal.mosdepth.global.dist.txt:md5,bdb8f185c35dd1eec7ce2f69bce57972", "test.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "test.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", @@ -675,14 +675,14 @@ "No BAM files", "No CRAM files", [ - "test.deepvariant.g.vcf.gz:md5,35b7f653833947fdcfae2b93961ee374", - "test.deepvariant.vcf.gz:md5,b6ba3ee8485299571ff23e0328367790" + "test.deepvariant.g.vcf.gz:md5,a51327a75372557eece796de33dc3318", + "test.deepvariant.vcf.gz:md5,e4a7b726e2f3db8ac15d08dd7e564519" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T15:40:01.04644895" + "timestamp": "2025-05-08T16:17:06.851031948" } -} +} \ No newline at end of file diff --git a/tests/variant_calling_muse.nf.test.snap b/tests/variant_calling_muse.nf.test.snap index 447ad28f95..ceeac4f61c 100644 --- a/tests/variant_calling_muse.nf.test.snap +++ b/tests/variant_calling_muse.nf.test.snap @@ -4,7 +4,7 @@ 17, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CRAM_TO_BAM_NORMAL": { "samtools": 1.21 @@ -28,10 +28,10 @@ }, [ "cram", - "cram/sample3.bai", "cram/sample3.bam", - "cram/sample4.bai", + "cram/sample3.bam.bai", "cram/sample4.bam", + "cram/sample4.bam.bai", "csv", "csv/variantcalled.csv", "multiqc", @@ -152,10 +152,10 @@ "variant_calling/muse/sample4_vs_sample3/sample4_vs_sample3.muse.vcf.gz.tbi" ], [ - "sample3.bai:md5,d41d8cd98f00b204e9800998ecf8427e", "sample3.bam:md5,d41d8cd98f00b204e9800998ecf8427e", - "sample4.bai:md5,d41d8cd98f00b204e9800998ecf8427e", + "sample3.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e", "sample4.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "sample4.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e", "sample4_vs_sample3.muse.bcftools_stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "sample3.recal.global.dist.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "sample3.recal.per-base.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", @@ -260,14 +260,14 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-29T09:56:08.034706398" + "timestamp": "2025-05-08T16:22:57.908427076" }, "-profile test --tools muse --input recalibrated_somatic.csv": { "content": [ 18, { "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CRAM_TO_BAM_NORMAL": { "samtools": 1.21 @@ -376,21 +376,21 @@ "sample4.bam:md5,fe8ceee2ede1f9b0b4f2aaa3f1a97241", "sample4.bam.bai:md5,c6d0e6be2e5d8a6bd312517d9ba0f4af", "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample4_vs_sample3.muse.bcftools_stats.txt:md5,0a4c6d5841a55b492a50917b0610a0b3", + "sample4_vs_sample3.muse.bcftools_stats.txt:md5,09a0d72425a3638cbe8f1cbd254e66f3", "sample3.recal.mosdepth.global.dist.txt:md5,69e29702ef01fd8f6c7a5468fc35a16a", "sample3.recal.mosdepth.region.dist.txt:md5,6ec49cd7d510c2eb3d9d90fdb79b783a", "sample3.recal.mosdepth.summary.txt:md5,103098d0bf76ed82d2b87d5f242b099a", "sample3.recal.per-base.bed.gz:md5,297f96648928d0ca5184223fb9941e7c", - "sample3.recal.per-base.bed.gz.csi:md5,519cc5bf84da0d71b87a88c76f83194e", + "sample3.recal.per-base.bed.gz.csi:md5,c67dcd711b096eb42f43784d5eadbc0d", "sample3.recal.regions.bed.gz:md5,314ce8d7273eff353072108aa77c327c", - "sample3.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample3.recal.regions.bed.gz.csi:md5,9cb0ad7039a3b703d16ca7d5b835c0ee", "sample4.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample4.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample4.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample4.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample4.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample4.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample4.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample4.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample4.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample4_vs_sample3.muse.FILTER.summary:md5,1ce42d34e4ae919afb519efc99146423", "sample4_vs_sample3.muse.TsTv.count:md5,8dcfdbcaac118df1d5ad407dd2af699f" ], @@ -410,6 +410,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-29T10:01:09.744970444" + "timestamp": "2025-05-08T16:21:39.484419416" } } \ No newline at end of file From 8c3e597d9614f6c25d16cfbbc009c87648ac59fe Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 16:58:51 +0200 Subject: [PATCH 25/38] update snapshots --- tests/variant_calling_mutect2.nf.test.snap | 36 +++++++++++----------- 1 file changed, 18 insertions(+), 18 deletions(-) diff --git a/tests/variant_calling_mutect2.nf.test.snap b/tests/variant_calling_mutect2.nf.test.snap index 9c834e87a9..ddebf2ccb6 100644 --- a/tests/variant_calling_mutect2.nf.test.snap +++ b/tests/variant_calling_mutect2.nf.test.snap @@ -53,20 +53,20 @@ "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.summary.txt:md5,0a7300e56eda6fba7c7564f00aa000f0", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.mutect2.vcf.gz.stats:md5,76f749c53212d72e98801f6030fbf8a6" ], "No BAM files", "No CRAM files", [ - "sample2.mutect2.vcf.gz:md5,7ccd1d6d414e65a0ce25a8f0ddd2cc8f" + "sample2.mutect2.vcf.gz:md5,4a803cf2687fc368a8c4eef5e2fc8c9c" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T18:56:37.013336498" + "timestamp": "2025-05-08T16:57:21.622764626" }, "-profile test --tools mutect2 somatic": { "content": [ @@ -133,29 +133,29 @@ "sample3.recal.mosdepth.region.dist.txt:md5,6ec49cd7d510c2eb3d9d90fdb79b783a", "sample3.recal.mosdepth.summary.txt:md5,103098d0bf76ed82d2b87d5f242b099a", "sample3.recal.per-base.bed.gz:md5,297f96648928d0ca5184223fb9941e7c", - "sample3.recal.per-base.bed.gz.csi:md5,519cc5bf84da0d71b87a88c76f83194e", + "sample3.recal.per-base.bed.gz.csi:md5,c67dcd711b096eb42f43784d5eadbc0d", "sample3.recal.regions.bed.gz:md5,314ce8d7273eff353072108aa77c327c", - "sample3.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample3.recal.regions.bed.gz.csi:md5,9cb0ad7039a3b703d16ca7d5b835c0ee", "sample4.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample4.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample4.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample4.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample4.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample4.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample4.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample4.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample4.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample4_vs_sample3.mutect2.vcf.gz.stats:md5,bd657dd9abf6e2354224bb0d20ba181e" ], "No BAM files", "No CRAM files", [ - "sample4_vs_sample3.mutect2.vcf.gz:md5,5a75d8a1c59a59ba6e7ffd04b02b204c" + "sample4_vs_sample3.mutect2.vcf.gz:md5,f2c46d0dae1b1a59180c0b9e595993d2" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T18:45:31.780604858" + "timestamp": "2025-05-08T16:41:48.62217437" }, "-profile test --tools mutect2 somatic --no_intervals": { "content": [ @@ -218,24 +218,24 @@ "sample3.recal.mosdepth.global.dist.txt:md5,69e29702ef01fd8f6c7a5468fc35a16a", "sample3.recal.mosdepth.summary.txt:md5,d2775eb102acc5950f7f53883dcb503d", "sample3.recal.per-base.bed.gz:md5,297f96648928d0ca5184223fb9941e7c", - "sample3.recal.per-base.bed.gz.csi:md5,519cc5bf84da0d71b87a88c76f83194e", + "sample3.recal.per-base.bed.gz.csi:md5,c67dcd711b096eb42f43784d5eadbc0d", "sample4.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample4.recal.mosdepth.summary.txt:md5,0a7300e56eda6fba7c7564f00aa000f0", "sample4.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample4.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample4.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample4_vs_sample3.mutect2.vcf.gz.stats:md5,4300e84631ee258660f95e846511d021" ], "No BAM files", "No CRAM files", [ - "sample4_vs_sample3.mutect2.vcf.gz:md5,5a75d8a1c59a59ba6e7ffd04b02b204c" + "sample4_vs_sample3.mutect2.vcf.gz:md5,f2c46d0dae1b1a59180c0b9e595993d2" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T18:49:42.950290454" + "timestamp": "2025-05-08T16:48:13.055749903" }, "-profile test --tools mutect2 tumoronly": { "content": [ @@ -295,21 +295,21 @@ "sample2.recal.mosdepth.region.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.summary.txt:md5,b0b47739dcafeeb1a9e6218b8abca1e0", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.recal.regions.bed.gz:md5,fb0efeba20ea272b7b709cf65246689e", - "sample2.recal.regions.bed.gz.csi:md5,19b91a252986eb863c8be568809a40f8", + "sample2.recal.regions.bed.gz.csi:md5,e8452848671e9e5c147ff4cceee944af", "sample2.mutect2.vcf.gz.stats:md5,76f749c53212d72e98801f6030fbf8a6" ], "No BAM files", "No CRAM files", [ - "sample2.mutect2.vcf.gz:md5,7ccd1d6d414e65a0ce25a8f0ddd2cc8f" + "sample2.mutect2.vcf.gz:md5,4a803cf2687fc368a8c4eef5e2fc8c9c" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T18:53:10.711560282" + "timestamp": "2025-05-08T16:53:38.789996792" } -} +} \ No newline at end of file From aa7093d8b92a07b8485d96e9cda9f70745c56bbe Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 19:02:42 +0200 Subject: [PATCH 26/38] update freebayes snapshot --- tests/variant_calling_freebayes.nf.test.snap | 190 +++++++++---------- 1 file changed, 93 insertions(+), 97 deletions(-) diff --git a/tests/variant_calling_freebayes.nf.test.snap b/tests/variant_calling_freebayes.nf.test.snap index bc5683d6a6..49e07f1f96 100644 --- a/tests/variant_calling_freebayes.nf.test.snap +++ b/tests/variant_calling_freebayes.nf.test.snap @@ -4,10 +4,10 @@ 17, { "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "FREEBAYES": { "freebayes": "1.3.6" @@ -116,14 +116,14 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.freebayes.bcftools_stats.txt:md5,47adcedfdc355d4a35d2a9695962be13", + "sample2.freebayes.bcftools_stats.txt:md5,716b2277c7498ce8d59f8357d500bf6c", "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.region.dist.txt:md5,39005ffaac22871ffaaf19656fe69c5b", "sample2.recal.mosdepth.summary.txt:md5,68d4b98f17361fddf73052ead34fa370", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.recal.regions.bed.gz:md5,b7561bc56a955f7db0f11e67e2ec0386", - "sample2.recal.regions.bed.gz.csi:md5,538cb5d244411a670a4b041691f8825b", + "sample2.recal.regions.bed.gz.csi:md5,393c2749068304d8545b501b9d4658e4", "sample2.freebayes.FILTER.summary:md5,0df3ddeec5779344b5d463347c9c6ea8", "sample2.freebayes.TsTv.count:md5,b1d308ed5087361a584cb61e7b835e1e" ], @@ -151,17 +151,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T15:56:52.82766352" + "timestamp": "2025-05-08T18:56:09.099010463" }, "-profile test --tools freebayes --no_intervals --wes --input fastq_pair.csv": { "content": [ 37, { "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", @@ -182,7 +182,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -194,7 +193,7 @@ "samtools": 1.21 }, "TABIX_VC_FREEBAYES": { - "tabix": 1.2 + "tabix": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -477,28 +476,28 @@ "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "samtools-stats-dp.txt:md5,d81e84864ecb732951a137e88d87a263", "samtools_alignment_plot.txt:md5,e757696d1f7107df2bd4ad92f607272e", - "test.freebayes.bcftools_stats.txt:md5,110684ce9105d6e9f4f1b2eb04b88bdc", - "test2_vs_test.freebayes.bcftools_stats.txt:md5,1e4b9bb2973f705991068d9ee4951267", + "test.freebayes.bcftools_stats.txt:md5,cff6037c4982d00a133b9a32b2aeb435", + "test2_vs_test.freebayes.bcftools_stats.txt:md5,b16283c84db55e5fef4353b8234710d4", "test.md.mosdepth.global.dist.txt:md5,5a0679057c530e5945c9c5a3a17312dc", "test.md.mosdepth.summary.txt:md5,0010c2396a3173c7cf4983abe2eb6a4c", "test.md.per-base.bed.gz:md5,34dfe443c0a0767562dd65272e3310ef", - "test.md.per-base.bed.gz.csi:md5,828c6dcb1df46953672b782093832dc3", + "test.md.per-base.bed.gz.csi:md5,b0ab630c3241fbd7581b7a38d944ff8b", "test.recal.mosdepth.global.dist.txt:md5,5a0679057c530e5945c9c5a3a17312dc", "test.recal.mosdepth.summary.txt:md5,0010c2396a3173c7cf4983abe2eb6a4c", "test.recal.per-base.bed.gz:md5,34dfe443c0a0767562dd65272e3310ef", - "test.recal.per-base.bed.gz.csi:md5,828c6dcb1df46953672b782093832dc3", + "test.recal.per-base.bed.gz.csi:md5,b0ab630c3241fbd7581b7a38d944ff8b", "test2.md.mosdepth.global.dist.txt:md5,f25166c3a0051bb4d8c11a210278de6c", "test2.md.mosdepth.summary.txt:md5,d5e4084de2ea2a0a7b60b2d71c804d4b", "test2.md.per-base.bed.gz:md5,e1c6d60621d8f64aaf28fa1c1ddda921", - "test2.md.per-base.bed.gz.csi:md5,69f4da029c05e9bcccae8895b6247a1e", + "test2.md.per-base.bed.gz.csi:md5,4205a09ede17cdbdaad45e3553f73105", "test2.recal.mosdepth.global.dist.txt:md5,f25166c3a0051bb4d8c11a210278de6c", "test2.recal.mosdepth.summary.txt:md5,d5e4084de2ea2a0a7b60b2d71c804d4b", "test2.recal.per-base.bed.gz:md5,e1c6d60621d8f64aaf28fa1c1ddda921", - "test2.recal.per-base.bed.gz.csi:md5,69f4da029c05e9bcccae8895b6247a1e", + "test2.recal.per-base.bed.gz.csi:md5,4205a09ede17cdbdaad45e3553f73105", "test.freebayes.FILTER.summary:md5,76c5919541536c12b5c8a6094d6d78d5", - "test.freebayes.TsTv.count:md5,0a0464beef110bc0f3c5a35d022b528e", + "test.freebayes.TsTv.count:md5,91c93bad844367dc6a1adedea802b9d9", "test2_vs_test.freebayes.FILTER.summary:md5,d2d717fef7c18ef9b40bbbc5c5bbf101", - "test2_vs_test.freebayes.TsTv.count:md5,e09dacc71bf72254e3aace1cc7c1e16d" + "test2_vs_test.freebayes.TsTv.count:md5,fe2ee32e2f0b0a7923064e71ebae4502" ], "No BAM files", [ @@ -544,17 +543,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:25:01.191800567" + "timestamp": "2025-05-08T18:53:33.220951234" }, "-profile test --tools freebayes --wes --nucleotides_per_second 20": { "content": [ 31, { "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", @@ -578,7 +577,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -835,36 +833,36 @@ "fastqc_sequence_counts_plot.txt:md5,7f0f19a58e8e54e792a751fd04a9ae13", "fastqc_sequence_duplication_levels_plot.txt:md5,92b02e250ff78725deb9a10d510fcecc", "fastqc_sequence_length_distribution_plot.txt:md5,fb04dce68ec566314125bc9438211b28", - "mosdepth-coverage-per-contig-single.txt:md5,3914c1896454cc5b176a66737524690d", - "mosdepth-cumcoverage-dist-id.txt:md5,d20db85d15395e60fe7c667292fb8cd2", - "mosdepth_cov_dist.txt:md5,66f531e1c6f8efabddb86421022e8753", - "mosdepth_cumcov_dist.txt:md5,66f531e1c6f8efabddb86421022e8753", - "mosdepth_perchrom.txt:md5,3914c1896454cc5b176a66737524690d", + "mosdepth-coverage-per-contig-single.txt:md5,c9c35a540ea3b9915085e3a6a36d77a5", + "mosdepth-cumcoverage-dist-id.txt:md5,7d1bd7a21efd90ba3c6cf26a84d06911", + "mosdepth_cov_dist.txt:md5,d2b4b912053a46f772a9bbefd70c6e70", + "mosdepth_cumcov_dist.txt:md5,d2b4b912053a46f772a9bbefd70c6e70", + "mosdepth_perchrom.txt:md5,c9c35a540ea3b9915085e3a6a36d77a5", "multiqc_citations.txt:md5,ace4ca89138a5f1e2be289c157c00bd9", "multiqc_fastqc.txt:md5,bde0d0bffa62228b33fb68b7e25b6ff8", - "multiqc_samtools_stats.txt:md5,de27f9aaca881d11534cf0c6d5f9eadc", + "multiqc_samtools_stats.txt:md5,dedb8d6b6d5a7ddc597975afdf5610dc", "picard_MarkIlluminaAdapters_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_MeanQualityByCycle_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "samtools-stats-dp.txt:md5,c94f4d3ffa3f510552f90e173fdd9f9d", + "samtools-stats-dp.txt:md5,545466eeeb8c9bfde6c119cb17392f81", "samtools_alignment_plot.txt:md5,717f499a3543e7ee4c7a8454bf80aeca", - "test.freebayes.bcftools_stats.txt:md5,9cf08a94d093de3ff335f3ef42e82f6d", - "test.md.mosdepth.global.dist.txt:md5,e4ce28ba1c331dc08bc53a0189908f77", - "test.md.mosdepth.region.dist.txt:md5,04d9f20dc5306990eec982a3c5a7d107", - "test.md.mosdepth.summary.txt:md5,70b4bbe29bd5e7c4ea39b6caf3316096", - "test.md.per-base.bed.gz:md5,9ace6ac0d2e4cd5011ef45ae528da2c7", - "test.md.per-base.bed.gz.csi:md5,594e690685bfd305836161c88daace09", - "test.md.regions.bed.gz:md5,e39c27885a30c0321f3cb7c7fb6c5edc", - "test.md.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", - "test.recal.mosdepth.global.dist.txt:md5,9c1d90e0fed14b710098b7724b602aea", - "test.recal.mosdepth.region.dist.txt:md5,04d9f20dc5306990eec982a3c5a7d107", - "test.recal.mosdepth.summary.txt:md5,17dfb78b147488eb8fd450294de4a35e", - "test.recal.per-base.bed.gz:md5,e112e852ae92f43f1fd6e446f449031a", - "test.recal.per-base.bed.gz.csi:md5,bb424ead65ffe782f6eaa3663ea65721", - "test.recal.regions.bed.gz:md5,e39c27885a30c0321f3cb7c7fb6c5edc", - "test.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", - "test.freebayes.FILTER.summary:md5,75824ce08910acce7e9f6adb4d635850", - "test.freebayes.TsTv.count:md5,3c198f7ec7fe2f5d365218ba0ff64197" + "test.freebayes.bcftools_stats.txt:md5,6cc46818b9aed1d38a1f1032090ef528", + "test.md.mosdepth.global.dist.txt:md5,531a83245143e7975f18e1988c876138", + "test.md.mosdepth.region.dist.txt:md5,d25723bdd3fec6b17d2462abfa097b9e", + "test.md.mosdepth.summary.txt:md5,87be70cd1237d7af9aa40d8cd8b3a817", + "test.md.per-base.bed.gz:md5,c53d26b767b6e75b3e502438a77f89b2", + "test.md.per-base.bed.gz.csi:md5,c3066b00781e14a9db5fc0bf0d47d777", + "test.md.regions.bed.gz:md5,f96fa1cdae548eb7e54ce6a481d928b9", + "test.md.regions.bed.gz.csi:md5,c6d1ac97ef4dfe43731c8368d8391cab", + "test.recal.mosdepth.global.dist.txt:md5,a3e6c8f6d4b5e909d0527be83a93fbae", + "test.recal.mosdepth.region.dist.txt:md5,d25723bdd3fec6b17d2462abfa097b9e", + "test.recal.mosdepth.summary.txt:md5,ca5424a709268a61200a2dc2865f1a14", + "test.recal.per-base.bed.gz:md5,8aaf9cb3dd5c9643e77aba91293fc39d", + "test.recal.per-base.bed.gz.csi:md5,d8038c7d544abd5d6335f2541de4e769", + "test.recal.regions.bed.gz:md5,f96fa1cdae548eb7e54ce6a481d928b9", + "test.recal.regions.bed.gz.csi:md5,c6d1ac97ef4dfe43731c8368d8391cab", + "test.freebayes.FILTER.summary:md5,25c222bca4740f969a44ae9705e98068", + "test.freebayes.TsTv.count:md5,8f48b74a55f5726568f7d088ae578de9" ], "No BAM files", [ @@ -885,7 +883,7 @@ "##FORMAT=", "##FORMAT=" ], - "VcfFile [chromosomes=[chr22], sampleCount=1, variantCount=502, phased=false, phasedAutodetect=false]" + "VcfFile [chromosomes=[chr22], sampleCount=1, variantCount=475, phased=false, phasedAutodetect=false]" ] ] ], @@ -893,17 +891,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:16:55.424008803" + "timestamp": "2025-05-08T18:38:38.394184756" }, "-profile test --tools freebayes --no_intervals": { "content": [ 22, { "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", @@ -924,7 +922,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -936,7 +933,7 @@ "samtools": 1.21 }, "TABIX_VC_FREEBAYES": { - "tabix": 1.2 + "tabix": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -1177,32 +1174,32 @@ "fastqc_sequence_counts_plot.txt:md5,7f0f19a58e8e54e792a751fd04a9ae13", "fastqc_sequence_duplication_levels_plot.txt:md5,92b02e250ff78725deb9a10d510fcecc", "fastqc_sequence_length_distribution_plot.txt:md5,fb04dce68ec566314125bc9438211b28", - "mosdepth-coverage-per-contig-single.txt:md5,264db67a99d2c90ea7b075e33c201b77", - "mosdepth-cumcoverage-dist-id.txt:md5,5235e965da7ebe3bfebb24ffa88defff", - "mosdepth_cov_dist.txt:md5,8d0d7cb485a7bffb07da17b28f827120", - "mosdepth_cumcov_dist.txt:md5,8d0d7cb485a7bffb07da17b28f827120", - "mosdepth_perchrom.txt:md5,264db67a99d2c90ea7b075e33c201b77", + "mosdepth-coverage-per-contig-single.txt:md5,759c540e5c35e84f2066d7a92fecf8e6", + "mosdepth-cumcoverage-dist-id.txt:md5,f747672151fc2d3700a09133181ed208", + "mosdepth_cov_dist.txt:md5,6769d443cfc128a729092e368ea4abed", + "mosdepth_cumcov_dist.txt:md5,6769d443cfc128a729092e368ea4abed", + "mosdepth_perchrom.txt:md5,759c540e5c35e84f2066d7a92fecf8e6", "multiqc_citations.txt:md5,ace4ca89138a5f1e2be289c157c00bd9", "multiqc_fastqc.txt:md5,bde0d0bffa62228b33fb68b7e25b6ff8", - "multiqc_samtools_stats.txt:md5,de27f9aaca881d11534cf0c6d5f9eadc", + "multiqc_samtools_stats.txt:md5,dedb8d6b6d5a7ddc597975afdf5610dc", "picard_MarkIlluminaAdapters_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_MeanQualityByCycle_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", - "samtools-stats-dp.txt:md5,c94f4d3ffa3f510552f90e173fdd9f9d", + "samtools-stats-dp.txt:md5,545466eeeb8c9bfde6c119cb17392f81", "samtools_alignment_plot.txt:md5,717f499a3543e7ee4c7a8454bf80aeca", - "test.freebayes.bcftools_stats.txt:md5,4d453aa4634ba2211e3bc6cb0d7e1357", - "test.md.mosdepth.global.dist.txt:md5,b61e1acee11a6ddf7ce3232a5948a6a0", - "test.md.mosdepth.region.dist.txt:md5,1a382f98d488d2ae3df83a0d87caafc1", - "test.md.mosdepth.summary.txt:md5,839108358878ada89e1eaddf6e0541ba", - "test.md.regions.bed.gz:md5,6fdaec99e739dc0f47fe55dd64dfe93e", - "test.md.regions.bed.gz.csi:md5,5f9c60279af78e3aeafc96a8c11fb35f", - "test.recal.mosdepth.global.dist.txt:md5,b61e1acee11a6ddf7ce3232a5948a6a0", - "test.recal.mosdepth.region.dist.txt:md5,1a382f98d488d2ae3df83a0d87caafc1", - "test.recal.mosdepth.summary.txt:md5,839108358878ada89e1eaddf6e0541ba", - "test.recal.regions.bed.gz:md5,6fdaec99e739dc0f47fe55dd64dfe93e", - "test.recal.regions.bed.gz.csi:md5,5f9c60279af78e3aeafc96a8c11fb35f", - "test.freebayes.FILTER.summary:md5,562eaa4512cd4b57e6cfca7b44957d1c", - "test.freebayes.TsTv.count:md5,4e6935b1e1906e57be1b54c0dffe7169" + "test.freebayes.bcftools_stats.txt:md5,8f7a988dfa09a2484fcff83e96c5eda9", + "test.md.mosdepth.global.dist.txt:md5,ef7c375ae07aec5540f9892b9b556b73", + "test.md.mosdepth.region.dist.txt:md5,212efff2213f6fc1c3204daf68bbb8c8", + "test.md.mosdepth.summary.txt:md5,72114393647ff64503522760218b30f0", + "test.md.regions.bed.gz:md5,985db429051ddcd5eae177da6fb55ad6", + "test.md.regions.bed.gz.csi:md5,3fa0f8272fefafe3cd840376d34a94a2", + "test.recal.mosdepth.global.dist.txt:md5,ef7c375ae07aec5540f9892b9b556b73", + "test.recal.mosdepth.region.dist.txt:md5,212efff2213f6fc1c3204daf68bbb8c8", + "test.recal.mosdepth.summary.txt:md5,72114393647ff64503522760218b30f0", + "test.recal.regions.bed.gz:md5,985db429051ddcd5eae177da6fb55ad6", + "test.recal.regions.bed.gz.csi:md5,3fa0f8272fefafe3cd840376d34a94a2", + "test.freebayes.FILTER.summary:md5,d3606e0ad12a8b8947fd56ce22430ca1", + "test.freebayes.TsTv.count:md5,ba81c7be158efe78190bee509ee52255" ], "No BAM files", [ @@ -1223,7 +1220,7 @@ "##INFO=", "##INFO=" ], - "VcfFile [chromosomes=[chr22], sampleCount=1, variantCount=756, phased=false, phasedAutodetect=false]" + "VcfFile [chromosomes=[chr22], sampleCount=1, variantCount=738, phased=false, phasedAutodetect=false]" ] ] ], @@ -1231,23 +1228,23 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:19:17.165931947" + "timestamp": "2025-05-08T18:43:20.770109901" }, "-profile test --tools freebayes --no_intervals --input recalibrated_tumoronly.csv": { "content": [ 12, { "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "FREEBAYES": { "freebayes": "1.3.6" }, "TABIX_VC_FREEBAYES": { - "tabix": 1.2 + "tabix": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -1350,11 +1347,11 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.freebayes.bcftools_stats.txt:md5,8ff00f5f0b238ea63c9199b9742d0692", + "sample2.freebayes.bcftools_stats.txt:md5,dcf6642bb2bbe09910685ac17b7bc4c8", "sample2.recal.mosdepth.global.dist.txt:md5,f2dcd00a64947c49e8e4b93c2f4fbf27", "sample2.recal.mosdepth.summary.txt:md5,0a7300e56eda6fba7c7564f00aa000f0", "sample2.recal.per-base.bed.gz:md5,39a1bc436aa8546c26faedbe94cb676c", - "sample2.recal.per-base.bed.gz.csi:md5,aaa7bed9e7ef873b23bca249b8b58eb9", + "sample2.recal.per-base.bed.gz.csi:md5,cfb07b0ba46e8468b4342edb243536f3", "sample2.freebayes.FILTER.summary:md5,ee513ecf779b6e201b8ef98f95f25aab", "sample2.freebayes.TsTv.count:md5,2dc153ad5af26c9f8aa82442bf65b4bf" ], @@ -1382,17 +1379,17 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T15:59:00.273525948" + "timestamp": "2025-05-08T18:58:48.269196361" }, "-profile test --tools freebayes --wes --nucleotides_per_second 20 --input fastq_pair.csv": { "content": [ 52, { "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BWAMEM1_MEM": { "bwa": "0.7.18-r1243-dirty", @@ -1416,7 +1413,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -1723,38 +1719,38 @@ "picard_QualityScoreDistribution_histogram.txt:md5,d41d8cd98f00b204e9800998ecf8427e", "samtools-stats-dp.txt:md5,d81e84864ecb732951a137e88d87a263", "samtools_alignment_plot.txt:md5,e757696d1f7107df2bd4ad92f607272e", - "test.freebayes.bcftools_stats.txt:md5,b34d3aa4db414fc6776ce62c212c53d1", - "test2_vs_test.freebayes.bcftools_stats.txt:md5,300b53a10f1647e43719c9547a327e8a", + "test.freebayes.bcftools_stats.txt:md5,f362a7d25112f3e50b30f04c7791d900", + "test2_vs_test.freebayes.bcftools_stats.txt:md5,8984334341cf01f91835324e83148233", "test.md.mosdepth.global.dist.txt:md5,5a0679057c530e5945c9c5a3a17312dc", "test.md.mosdepth.region.dist.txt:md5,835fdc6fa52cc33e6fb76c0c20a8a6c3", "test.md.mosdepth.summary.txt:md5,dcc9ab2bf3248903e02d8da87e678977", "test.md.per-base.bed.gz:md5,34dfe443c0a0767562dd65272e3310ef", - "test.md.per-base.bed.gz.csi:md5,828c6dcb1df46953672b782093832dc3", + "test.md.per-base.bed.gz.csi:md5,b0ab630c3241fbd7581b7a38d944ff8b", "test.md.regions.bed.gz:md5,99cc80b920ba574e7d9ef8f59f54f7c6", - "test.md.regions.bed.gz.csi:md5,77c398bf19982ddf4272900832e3fe9b", + "test.md.regions.bed.gz.csi:md5,c6d1ac97ef4dfe43731c8368d8391cab", "test.recal.mosdepth.global.dist.txt:md5,0b3162def977123809598639f7698121", "test.recal.mosdepth.region.dist.txt:md5,835fdc6fa52cc33e6fb76c0c20a8a6c3", "test.recal.mosdepth.summary.txt:md5,a8455eb2947de529abfa62b303986e0f", "test.recal.per-base.bed.gz:md5,c075ccd2b847c7c04061a39717faeb30", - "test.recal.per-base.bed.gz.csi:md5,c44f956765d549fd55635a359f09ffd6", + "test.recal.per-base.bed.gz.csi:md5,4816eeb9af254ca40177b08cf11b98d2", "test.recal.regions.bed.gz:md5,99cc80b920ba574e7d9ef8f59f54f7c6", - "test.recal.regions.bed.gz.csi:md5,77c398bf19982ddf4272900832e3fe9b", + "test.recal.regions.bed.gz.csi:md5,c6d1ac97ef4dfe43731c8368d8391cab", "test2.md.mosdepth.global.dist.txt:md5,f25166c3a0051bb4d8c11a210278de6c", "test2.md.mosdepth.region.dist.txt:md5,3211135329e4077bd9bf0ba488e14371", "test2.md.mosdepth.summary.txt:md5,ce0eb6d33c6d0dc720fbc6d1811abef8", "test2.md.per-base.bed.gz:md5,e1c6d60621d8f64aaf28fa1c1ddda921", - "test2.md.per-base.bed.gz.csi:md5,69f4da029c05e9bcccae8895b6247a1e", + "test2.md.per-base.bed.gz.csi:md5,4205a09ede17cdbdaad45e3553f73105", "test2.md.regions.bed.gz:md5,0bb2549180165a99680ba3e453ea312f", - "test2.md.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", + "test2.md.regions.bed.gz.csi:md5,c6d1ac97ef4dfe43731c8368d8391cab", "test2.recal.mosdepth.global.dist.txt:md5,a1ef7e662ce993da4668e804952014ce", "test2.recal.mosdepth.region.dist.txt:md5,3211135329e4077bd9bf0ba488e14371", "test2.recal.mosdepth.summary.txt:md5,70ad653c0c98baeeaf5085f1209a7bdb", "test2.recal.per-base.bed.gz:md5,e992ef845ec91a3612297952a23ba579", - "test2.recal.per-base.bed.gz.csi:md5,49dec4905343693cb7812da9ee60037c", + "test2.recal.per-base.bed.gz.csi:md5,8072f447199c60f24b01eede8b557333", "test2.recal.regions.bed.gz:md5,0bb2549180165a99680ba3e453ea312f", - "test2.recal.regions.bed.gz.csi:md5,e1a52ced0e9ded1eecbca4eff2014c8e", - "test.freebayes.FILTER.summary:md5,43d53e36cbb1091f915b2499e545b41e", - "test.freebayes.TsTv.count:md5,650f3dc78c5aaaecfe8ffa3d499e812f", + "test2.recal.regions.bed.gz.csi:md5,c6d1ac97ef4dfe43731c8368d8391cab", + "test.freebayes.FILTER.summary:md5,ac6a709b3f1a7c5e9f1b3d1eb42bc940", + "test.freebayes.TsTv.count:md5,698b790749e5cb643243572e2e7c1055", "test2_vs_test.freebayes.FILTER.summary:md5,84039d55edf0981d6b9b81252aff6741", "test2_vs_test.freebayes.TsTv.count:md5,6c6038d43eb7fa766909b495979d120e" ], @@ -1802,6 +1798,6 @@ "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-05-02T09:22:24.20963219" + "timestamp": "2025-05-08T18:48:32.007891403" } -} +} \ No newline at end of file From b72d47e65dc60c692d724377fada9db649ca1c9e Mon Sep 17 00:00:00 2001 From: maxulysse Date: Thu, 8 May 2025 19:14:37 +0200 Subject: [PATCH 27/38] update mpileup snapshots --- tests/variant_calling_mpileup.nf.test.snap | 48 +++++++++++----------- 1 file changed, 24 insertions(+), 24 deletions(-) diff --git a/tests/variant_calling_mpileup.nf.test.snap b/tests/variant_calling_mpileup.nf.test.snap index 29690717cb..73359a40ef 100644 --- a/tests/variant_calling_mpileup.nf.test.snap +++ b/tests/variant_calling_mpileup.nf.test.snap @@ -4,10 +4,10 @@ 11, { "BCFTOOLS_MPILEUP": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -107,36 +107,36 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.bcftools.bcftools_stats.txt:md5,8d7c161ec565cb80c8387b7d1f4ce555", + "sample2.bcftools.bcftools_stats.txt:md5,3299f97352e32c873c95e43922c79147", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample2.bcftools.FILTER.summary:md5,8766995f3e4119ef30dfdaa9fb3752ce", "sample2.bcftools.TsTv.count:md5,01df95fcb4df593f7e1b214d90ebdb59" ], "No BAM files", "No CRAM files", [ - "sample2.bcftools.vcf.gz:md5,d6320fc5d154ebd33f1980a1de9a04d3" + "sample2.bcftools.vcf.gz:md5,439c858d3b61aa738252353e2fd04225" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:35:32.757074374" + "timestamp": "2025-05-08T19:07:08.564834071" }, "-profile test --tools mpileup --input recalibrated_germline.csv --no_intervals": { "content": [ 9, { "BCFTOOLS_MPILEUP": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -239,36 +239,36 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.bcftools.bcftools_stats.txt:md5,682221eea69554a76b73c6b00665ab1e", + "sample1.bcftools.bcftools_stats.txt:md5,0659e2f55ea631b8757dd04facc286a1", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.bcftools.FILTER.summary:md5,83a10512eb9d035f409a84db7e620c28", "sample1.bcftools.TsTv.count:md5,bfa998e75cbcb3da66f823cf39ef1e48" ], "No BAM files", "No CRAM files", [ - "sample1.bcftools.vcf.gz:md5,921356ebe67c2be9f574d9743f5b62" + "sample1.bcftools.vcf.gz:md5,83ab8ae7c467336e1ee7f672bbb037ad" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:33:23.486976646" + "timestamp": "2025-05-08T19:05:45.978637697" }, "-profile test --tools mpileup --input recalibrated_tumoronly.csv --no_intervals": { "content": [ 9, { "BCFTOOLS_MPILEUP": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -371,36 +371,36 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample2.bcftools.bcftools_stats.txt:md5,f5f9a15fb462ec104fe9c2a5874524cd", + "sample2.bcftools.bcftools_stats.txt:md5,cc6063baaf7443b12b3fa1c972e804c8", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample2.bcftools.FILTER.summary:md5,f295c70f174e7705fc2bac607aedbfda", "sample2.bcftools.TsTv.count:md5,e5d20f81fc97f7ee97fb6cb6bd851047" ], "No BAM files", "No CRAM files", [ - "sample2.bcftools.vcf.gz:md5,ea3ceb582bdbe09ebed4d35d2970bc23" + "sample2.bcftools.vcf.gz:md5,bb006620fd9b7eaf5104d64f34290901" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T17:01:20.110530342" + "timestamp": "2025-05-08T19:08:29.768341093" }, "-profile test --tools mpileup --input recalibrated_germline.csv": { "content": [ 11, { "BCFTOOLS_MPILEUP": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -500,25 +500,25 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "sample1.bcftools.bcftools_stats.txt:md5,dab0fe619ff035f4f05420be2dc23293", + "sample1.bcftools.bcftools_stats.txt:md5,a4865cc7e9dfbea42d098f4bbbc7459d", "sample1.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample1.bcftools.FILTER.summary:md5,9b62595b026decf12e9198d531e4307a", "sample1.bcftools.TsTv.count:md5,6c937125d7bac4c491bea50f18cba43a" ], "No BAM files", "No CRAM files", [ - "sample1.bcftools.vcf.gz:md5,84cbd4e6b04ed1be7cac7ca6d45b5b5f" + "sample1.bcftools.vcf.gz:md5,c55cf36bc05b6a7b4a98bb3ba925fc0a" ] ], "meta": { "nf-test": "0.9.2", "nextflow": "24.10.6" }, - "timestamp": "2025-04-28T16:31:30.532771983" + "timestamp": "2025-05-08T19:04:24.688675003" } } \ No newline at end of file From 9d509e224c939b66c8c85ac34a8e40286ee428e2 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Fri, 9 May 2025 10:45:00 +0200 Subject: [PATCH 28/38] update final snapshots --- tests/postprocess_concatenation.nf.test.snap | 36 ++++++------- ...s_concatenation_normalization.nf.test.snap | 54 +++++++++---------- tests/postprocess_normalization.nf.test.snap | 36 ++++++------- tests/spark.nf.test.snap | 10 ++-- tests/variant_calling_cnvkit.nf.test.snap | 32 +++++------ 5 files changed, 84 insertions(+), 84 deletions(-) diff --git a/tests/postprocess_concatenation.nf.test.snap b/tests/postprocess_concatenation.nf.test.snap index 2c2a831961..a67d23175d 100644 --- a/tests/postprocess_concatenation.nf.test.snap +++ b/tests/postprocess_concatenation.nf.test.snap @@ -7,13 +7,13 @@ "gawk": "5.1.0" }, "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CNNSCOREVARIANTS": { - "gatk4": "4.6.1.0" + "gatk4": "4.5.0.0" }, "FILTERVARIANTTRANCHES": { "gatk4": "4.6.1.0" @@ -25,19 +25,19 @@ "gatk4": "4.6.1.0" }, "GERMLINE_VCFS_CONCAT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "GERMLINE_VCFS_CONCAT_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "TABIX_EXT_VCF": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_GERMLINE_VCFS_CONCAT_SORT": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_VC_FREEBAYES": { - "tabix": 1.2 + "tabix": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -186,10 +186,10 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "testN.freebayes.bcftools_stats.txt:md5,a4314ea6434629bae54b288f54f0c3bc", - "testT.freebayes.bcftools_stats.txt:md5,62b05f3f02d3d3f92bd57f2f813feb7b", - "testN.haplotypecaller.filtered.bcftools_stats.txt:md5,c6ae8e784f8d1550e0b49bb1cfe3128c", - "testT.haplotypecaller.filtered.bcftools_stats.txt:md5,03057e323dfc1dda8dea8a72a43fff9c", + "testN.freebayes.bcftools_stats.txt:md5,8f1583a11cbf3c1a698e9783dd0ec932", + "testT.freebayes.bcftools_stats.txt:md5,ba32dfbe300f88db6e723763de9c818c", + "testN.haplotypecaller.filtered.bcftools_stats.txt:md5,a58aa8606797ac7545601e74c31b70ef", + "testT.haplotypecaller.filtered.bcftools_stats.txt:md5,3a958375eeee8fcab1b5af04bb1efdaa", "testN.recal.mosdepth.global.dist.txt:md5,bdb8f185c35dd1eec7ce2f69bce57972", "testN.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "testN.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", @@ -199,7 +199,7 @@ "testT.recal.mosdepth.region.dist.txt:md5,ccf646922b05cb4759c4f89072be2b69", "testT.recal.mosdepth.summary.txt:md5,024649a659caff330dfbef4ac3560542", "testT.recal.regions.bed.gz:md5,14b36a2cf428840aab471f95cfbe399f", - "testT.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", + "testT.recal.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917", "testN.freebayes.FILTER.summary:md5,2ec507a210cf7de0425b6c8028a6edf8", "testN.freebayes.TsTv.count:md5,4913577b275634ea33077dd023325dee", "testT.freebayes.FILTER.summary:md5,50f90bd0cdd1e95c10d7e5d88d0346f8", @@ -212,8 +212,8 @@ "No BAM files", "No CRAM files", [ - "testN.germline.vcf.gz:md5,141a2cc53b0a9d4a0ab4d779cb1e487", - "testT.germline.vcf.gz:md5,9119ee2c970c37729dcb35d4b88f9d10", + "testN.germline.vcf.gz:md5,184743db45c933febc5557d08b19f23c", + "testT.germline.vcf.gz:md5,7bac441a7c84790f43d26a73e10be9b5", "testN.freebayes.vcf.gz:md5,1d98e39fe458af9020283de18c764055", "testT.freebayes.vcf.gz:md5,387b7d48d04ad3b294f07173e6550fc7", "testN.haplotypecaller.filtered.vcf.gz:md5,df2040bf1bee0252581824d11d5d87d1", @@ -224,8 +224,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T13:50:46.898425819" + "timestamp": "2025-05-09T10:35:20.716677726" } -} +} \ No newline at end of file diff --git a/tests/postprocess_concatenation_normalization.nf.test.snap b/tests/postprocess_concatenation_normalization.nf.test.snap index 9d5fe68ac6..c51159f262 100644 --- a/tests/postprocess_concatenation_normalization.nf.test.snap +++ b/tests/postprocess_concatenation_normalization.nf.test.snap @@ -7,13 +7,13 @@ "gawk": "5.1.0" }, "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CNNSCOREVARIANTS": { - "gatk4": "4.6.1.0" + "gatk4": "4.5.0.0" }, "FILTERVARIANTTRANCHES": { "gatk4": "4.6.1.0" @@ -25,28 +25,28 @@ "gatk4": "4.6.1.0" }, "GERMLINE_VCFS_CONCAT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "GERMLINE_VCFS_CONCAT_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "TABIX_EXT_VCF": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_GERMLINE_VCFS_CONCAT_SORT": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_VCFS_NORM_SORT": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_VC_FREEBAYES": { - "tabix": 1.2 + "tabix": 1.21 }, "VCFS_NORM": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFS_NORM_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -226,14 +226,14 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "testN.freebayes.norm.bcftools_stats.txt:md5,1cadbd27bb650441dadfd6984e44190f", - "testN.germline.bcftools_stats.txt:md5,b8a3832c78fad6f4a182ea2a51fc82c3", - "testT.freebayes.norm.bcftools_stats.txt:md5,2ea5c1d5a877254d4807cc6a82c23f43", - "testT.germline.bcftools_stats.txt:md5,38218ede728ead2196270fdaf71e3d6b", - "testN.germline.bcftools_stats.txt:md5,4a8cdfb69f76ccd4f90603ff7e189cd2", - "testN.haplotypecaller.norm.bcftools_stats.txt:md5,2d71e5e97bac8219bb6284d50d6b1e96", - "testT.germline.bcftools_stats.txt:md5,5d8a645e1edf0d37d869578c8f3e3535", - "testT.haplotypecaller.norm.bcftools_stats.txt:md5,dc1c032230e6b9c67358475f50e0eb37", + "testN.freebayes.norm.bcftools_stats.txt:md5,8ee17648261a9f0d2965cad198b315ca", + "testN.germline.bcftools_stats.txt:md5,d5b648e305bc08e25b6d1309b74f9ba2", + "testT.freebayes.norm.bcftools_stats.txt:md5,86ab34c27ff2a8733e90a03437553edf", + "testT.germline.bcftools_stats.txt:md5,e4cf2c468bc50f44d55e8820c6e72a42", + "testN.germline.bcftools_stats.txt:md5,26e80f52f0070ada22b4c9333543d2cf", + "testN.haplotypecaller.norm.bcftools_stats.txt:md5,9913791329ce2582910657d0453d62fa", + "testT.germline.bcftools_stats.txt:md5,23451376749eae192f2127a2a97bb49d", + "testT.haplotypecaller.norm.bcftools_stats.txt:md5,400d5ea02dde9351af0b7864fa5eb10b", "testN.recal.mosdepth.global.dist.txt:md5,bdb8f185c35dd1eec7ce2f69bce57972", "testN.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "testN.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", @@ -243,7 +243,7 @@ "testT.recal.mosdepth.region.dist.txt:md5,ccf646922b05cb4759c4f89072be2b69", "testT.recal.mosdepth.summary.txt:md5,024649a659caff330dfbef4ac3560542", "testT.recal.regions.bed.gz:md5,14b36a2cf428840aab471f95cfbe399f", - "testT.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", + "testT.recal.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917", "testN.freebayes.norm.FILTER.summary:md5,d621a188425df0da8babce002e2f34dc", "testN.freebayes.norm.TsTv.count:md5,232bb44db986854d3992bda0df08f54b", "testN.germline.FILTER.summary:md5,2ec507a210cf7de0425b6c8028a6edf8", @@ -260,14 +260,14 @@ "testT.germline.TsTv.count:md5,803d74e40f7716202bae2a3a81c1ddfc", "testT.haplotypecaller.norm.FILTER.summary:md5,bedf7a690b985e8ff74eef9f4c1a8c34", "testT.haplotypecaller.norm.TsTv.count:md5,803d74e40f7716202bae2a3a81c1ddfc", - "versions.yml:md5,7b0164f473a98fe0f8f097ae49c0e597", - "versions.yml:md5,7b0164f473a98fe0f8f097ae49c0e597" + "versions.yml:md5,98a0b3d9237221abf06d1cf567bdd741", + "versions.yml:md5,98a0b3d9237221abf06d1cf567bdd741" ], "No BAM files", "No CRAM files", [ - "testN.germline.vcf.gz:md5,141a2cc53b0a9d4a0ab4d779cb1e487", - "testT.germline.vcf.gz:md5,9119ee2c970c37729dcb35d4b88f9d10", + "testN.germline.vcf.gz:md5,184743db45c933febc5557d08b19f23c", + "testT.germline.vcf.gz:md5,7bac441a7c84790f43d26a73e10be9b5", "testN.freebayes.vcf.gz:md5,1d98e39fe458af9020283de18c764055", "testT.freebayes.vcf.gz:md5,387b7d48d04ad3b294f07173e6550fc7", "testN.haplotypecaller.filtered.vcf.gz:md5,df2040bf1bee0252581824d11d5d87d1", @@ -284,8 +284,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-05-02T09:52:39.069554463" + "timestamp": "2025-05-09T10:37:11.370312794" } -} +} \ No newline at end of file diff --git a/tests/postprocess_normalization.nf.test.snap b/tests/postprocess_normalization.nf.test.snap index 193c42e33b..981b34fa12 100644 --- a/tests/postprocess_normalization.nf.test.snap +++ b/tests/postprocess_normalization.nf.test.snap @@ -7,13 +7,13 @@ "gawk": "5.1.0" }, "BCFTOOLS_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "BCFTOOLS_STATS": { - "bcftools": 1.2 + "bcftools": 1.21 }, "CNNSCOREVARIANTS": { - "gatk4": "4.6.1.0" + "gatk4": "4.5.0.0" }, "FILTERVARIANTTRANCHES": { "gatk4": "4.6.1.0" @@ -25,19 +25,19 @@ "gatk4": "4.6.1.0" }, "TABIX_EXT_VCF": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_VCFS_NORM_SORT": { - "tabix": 1.2 + "tabix": 1.21 }, "TABIX_VC_FREEBAYES": { - "tabix": 1.2 + "tabix": 1.21 }, "VCFS_NORM": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFS_NORM_SORT": { - "bcftools": 1.2 + "bcftools": 1.21 }, "VCFTOOLS_TSTV_COUNT": { "vcftools": "0.1.16" @@ -194,10 +194,10 @@ ], [ "multiqc_citations.txt:md5,ac2b3cf2dfb12c40837b9bbad8112d86", - "testN.freebayes.norm.bcftools_stats.txt:md5,1cadbd27bb650441dadfd6984e44190f", - "testT.freebayes.norm.bcftools_stats.txt:md5,2ea5c1d5a877254d4807cc6a82c23f43", - "testN.haplotypecaller.norm.bcftools_stats.txt:md5,2d71e5e97bac8219bb6284d50d6b1e96", - "testT.haplotypecaller.norm.bcftools_stats.txt:md5,dc1c032230e6b9c67358475f50e0eb37", + "testN.freebayes.norm.bcftools_stats.txt:md5,8ee17648261a9f0d2965cad198b315ca", + "testT.freebayes.norm.bcftools_stats.txt:md5,86ab34c27ff2a8733e90a03437553edf", + "testN.haplotypecaller.norm.bcftools_stats.txt:md5,9913791329ce2582910657d0453d62fa", + "testT.haplotypecaller.norm.bcftools_stats.txt:md5,400d5ea02dde9351af0b7864fa5eb10b", "testN.recal.mosdepth.global.dist.txt:md5,bdb8f185c35dd1eec7ce2f69bce57972", "testN.recal.mosdepth.region.dist.txt:md5,f1f1ad86fc280bced1888a5d7d25a3f2", "testN.recal.mosdepth.summary.txt:md5,32ea70ef1b99def3dc900b4afd513a40", @@ -207,7 +207,7 @@ "testT.recal.mosdepth.region.dist.txt:md5,ccf646922b05cb4759c4f89072be2b69", "testT.recal.mosdepth.summary.txt:md5,024649a659caff330dfbef4ac3560542", "testT.recal.regions.bed.gz:md5,14b36a2cf428840aab471f95cfbe399f", - "testT.recal.regions.bed.gz.csi:md5,b3716e5cd1744610e69c29bd4ffad259", + "testT.recal.regions.bed.gz.csi:md5,0dc011f3344841dc14aa488da905e917", "testN.freebayes.norm.FILTER.summary:md5,d621a188425df0da8babce002e2f34dc", "testN.freebayes.norm.TsTv.count:md5,232bb44db986854d3992bda0df08f54b", "testT.freebayes.norm.FILTER.summary:md5,50f90bd0cdd1e95c10d7e5d88d0346f8", @@ -216,8 +216,8 @@ "testN.haplotypecaller.norm.TsTv.count:md5,b77c120ee5cc0423267200c67d60c663", "testT.haplotypecaller.norm.FILTER.summary:md5,bedf7a690b985e8ff74eef9f4c1a8c34", "testT.haplotypecaller.norm.TsTv.count:md5,803d74e40f7716202bae2a3a81c1ddfc", - "versions.yml:md5,7b0164f473a98fe0f8f097ae49c0e597", - "versions.yml:md5,7b0164f473a98fe0f8f097ae49c0e597" + "versions.yml:md5,98a0b3d9237221abf06d1cf567bdd741", + "versions.yml:md5,98a0b3d9237221abf06d1cf567bdd741" ], "No BAM files", "No CRAM files", @@ -238,8 +238,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T13:54:43.851615695" + "timestamp": "2025-05-09T10:38:52.788266868" } -} +} \ No newline at end of file diff --git a/tests/spark.nf.test.snap b/tests/spark.nf.test.snap index 5acb6e4fa4..fc824a7b38 100644 --- a/tests/spark.nf.test.snap +++ b/tests/spark.nf.test.snap @@ -209,12 +209,12 @@ "test2.md.mosdepth.region.dist.txt:md5,286d57b7d9b3a95ef18ab2eb7f913d81", "test2.md.mosdepth.summary.txt:md5,04b69ef7f00199dcea7822a79d2c7bd7", "test2.md.regions.bed.gz:md5,292e177aa997597f83dc4e84bcc36b4c", - "test2.md.regions.bed.gz.csi:md5,550e016d80fe29358b61ecce346b28d5", + "test2.md.regions.bed.gz.csi:md5,5bf5fc178e4faf2462427502c3666004", "test2.recal.mosdepth.global.dist.txt:md5,85d38a74ce189b9110c57cd94bc26757", "test2.recal.mosdepth.region.dist.txt:md5,286d57b7d9b3a95ef18ab2eb7f913d81", "test2.recal.mosdepth.summary.txt:md5,04b69ef7f00199dcea7822a79d2c7bd7", "test2.recal.regions.bed.gz:md5,292e177aa997597f83dc4e84bcc36b4c", - "test2.recal.regions.bed.gz.csi:md5,550e016d80fe29358b61ecce346b28d5" + "test2.recal.regions.bed.gz.csi:md5,5bf5fc178e4faf2462427502c3666004" ], "No BAM files", [ @@ -225,9 +225,9 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-05-02T09:37:53.685618757" + "timestamp": "2025-05-09T10:25:14.54470682" }, "-profile test,spark --input tests/csv/3.0/fastq_tumor_only.csv --use_gatk_spark baserecalibrator,markduplicates --skip_tools fastqc,markduplicates_report,mosdepth,multiqc,samtools": { "content": [ @@ -291,4 +291,4 @@ }, "timestamp": "2025-04-28T14:37:02.314184198" } -} +} \ No newline at end of file diff --git a/tests/variant_calling_cnvkit.nf.test.snap b/tests/variant_calling_cnvkit.nf.test.snap index bebbe75a1f..699db13bad 100644 --- a/tests/variant_calling_cnvkit.nf.test.snap +++ b/tests/variant_calling_cnvkit.nf.test.snap @@ -123,22 +123,22 @@ "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample2.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "sample3.recal.mosdepth.global.dist.txt:md5,d9a4dd6429560b2b647da346050766c5", "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "multi_intervals.antitarget.bed:md5,d41d8cd98f00b204e9800998ecf8427e", "multi_intervals.target.bed:md5,f7474a0afbf5565c5675916606f2d9bd", "reference.cnn:md5,891454915f82d0eeda0be13d71e0d5d7", @@ -187,9 +187,9 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T15:18:39.754718799" + "timestamp": "2025-05-09T10:21:00.329946441" }, "-profile test --tools cnvkit --input recalibrated_germline.csv": { "content": [ @@ -260,7 +260,7 @@ "sample1.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample1.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample1.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample1.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample1.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "multi_intervals.antitarget.bed:md5,d41d8cd98f00b204e9800998ecf8427e", "multi_intervals.target.bed:md5,f7474a0afbf5565c5675916606f2d9bd", "reference.cnn:md5,891454915f82d0eeda0be13d71e0d5d7", @@ -282,9 +282,9 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T15:11:54.350089616" + "timestamp": "2025-05-09T10:16:23.974542985" }, "-profile test --tools cnvkit somatic --input recalibrated_somatic.csv": { "content": [ @@ -380,12 +380,12 @@ "sample3.recal.mosdepth.region.dist.txt:md5,1f3dab381958e08eb00f7c5e1135f677", "sample3.recal.mosdepth.summary.txt:md5,d7676e7c1de851b0ee5185d21096123b", "sample3.recal.regions.bed.gz:md5,6edeb8f7041a4403cb73651744b5bc82", - "sample3.recal.regions.bed.gz.csi:md5,f17cc9d960aa4a1e96548d570585cc8a", + "sample3.recal.regions.bed.gz.csi:md5,5fc6f880df27ca754ab229f0ccad2aea", "sample4.recal.mosdepth.global.dist.txt:md5,53f9ae9ab5002ffba340fa8cef7d70e4", "sample4.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample4.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample4.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample4.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample4.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "multi_intervals.antitarget.bed:md5,d41d8cd98f00b204e9800998ecf8427e", "multi_intervals.target.bed:md5,f7474a0afbf5565c5675916606f2d9bd", "reference.cnn:md5,891454915f82d0eeda0be13d71e0d5d7", @@ -422,9 +422,9 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T15:14:13.684623703" + "timestamp": "2025-05-09T10:18:05.749177223" }, "-profile test --tools cnvkit --input recalibrated_tumoronly.csv": { "content": [ @@ -494,7 +494,7 @@ "sample2.recal.mosdepth.region.dist.txt:md5,17600d21ac453506c52249cf435ad8ea", "sample2.recal.mosdepth.summary.txt:md5,7141030385af1f653718c9e0c9a5be80", "sample2.recal.regions.bed.gz:md5,c680c5d75f0cea068e3f917f4cf9bf52", - "sample2.recal.regions.bed.gz.csi:md5,4003c8833ed5e9b9f45282a6915c935e", + "sample2.recal.regions.bed.gz.csi:md5,68b7a9a98053b1122bdca68a1e1c87dd", "cnvkit.reference.antitarget-tmp.bed:md5,3d4d20f9f23b39970865d29ef239d20b", "cnvkit.reference.target-tmp.bed:md5,657b25dbda8516624efa8cb2cf3716ca", "test2.paired_end.recalibrated.sorted-scatter.png:md5,d9a4a27a7a93eca23108b43dea09c140", @@ -515,8 +515,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T15:16:07.519986848" + "timestamp": "2025-05-09T10:19:19.283846298" } } \ No newline at end of file From 414e55d4c6e0dd1af2e18b4ce9bfc2f2659fb080 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Fri, 9 May 2025 14:36:32 +0200 Subject: [PATCH 29/38] modules update all --- modules.json | 16 ++++---- .../sentieon/applyvarcal/environment.yml | 2 +- modules/nf-core/sentieon/applyvarcal/main.nf | 4 +- .../nf-core/sentieon/bwamem/environment.yml | 2 +- modules/nf-core/sentieon/bwamem/main.nf | 4 +- .../nf-core/sentieon/dedup/environment.yml | 2 +- modules/nf-core/sentieon/dedup/main.nf | 4 +- .../sentieon/dnamodelapply/environment.yml | 2 +- .../nf-core/sentieon/dnamodelapply/main.nf | 4 +- .../nf-core/sentieon/dnascope/environment.yml | 2 +- modules/nf-core/sentieon/dnascope/main.nf | 4 +- .../sentieon/gvcftyper/environment.yml | 2 +- modules/nf-core/sentieon/gvcftyper/main.nf | 4 +- .../sentieon/haplotyper/environment.yml | 2 +- modules/nf-core/sentieon/haplotyper/main.nf | 14 +++---- modules/nf-core/sentieon/haplotyper/meta.yml | 8 ++-- .../nf-core/sentieon/varcal/environment.yml | 2 +- modules/nf-core/sentieon/varcal/main.nf | 38 ++++++++++++------- 18 files changed, 64 insertions(+), 52 deletions(-) diff --git a/modules.json b/modules.json index 899c76661a..7a8083a8ae 100644 --- a/modules.json +++ b/modules.json @@ -429,42 +429,42 @@ }, "sentieon/applyvarcal": { "branch": "master", - "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/bwamem": { "branch": "master", - "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/dedup": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/dnamodelapply": { "branch": "master", - "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/dnascope": { "branch": "master", - "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/gvcftyper": { "branch": "master", - "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/haplotyper": { "branch": "master", - "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "sentieon/varcal": { "branch": "master", - "git_sha": "a5c6f000174170ee96f426efe268e5e5aa9ee364", + "git_sha": "6b36f8e5427ec38911565398de57656ca3a2606a", "installed_by": ["modules"] }, "snpeff/download": { diff --git a/modules/nf-core/sentieon/applyvarcal/environment.yml b/modules/nf-core/sentieon/applyvarcal/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/applyvarcal/environment.yml +++ b/modules/nf-core/sentieon/applyvarcal/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/applyvarcal/main.nf b/modules/nf-core/sentieon/applyvarcal/main.nf index 6427b13392..5307c4c952 100644 --- a/modules/nf-core/sentieon/applyvarcal/main.nf +++ b/modules/nf-core/sentieon/applyvarcal/main.nf @@ -5,8 +5,8 @@ process SENTIEON_APPLYVARCAL { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(vcf), path(vcf_tbi), path(recal), path(recal_index), path(tranches) diff --git a/modules/nf-core/sentieon/bwamem/environment.yml b/modules/nf-core/sentieon/bwamem/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/bwamem/environment.yml +++ b/modules/nf-core/sentieon/bwamem/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/bwamem/main.nf b/modules/nf-core/sentieon/bwamem/main.nf index c038a857bf..2f014d064b 100644 --- a/modules/nf-core/sentieon/bwamem/main.nf +++ b/modules/nf-core/sentieon/bwamem/main.nf @@ -5,8 +5,8 @@ process SENTIEON_BWAMEM { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/sentieon/dedup/environment.yml b/modules/nf-core/sentieon/dedup/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/dedup/environment.yml +++ b/modules/nf-core/sentieon/dedup/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/dedup/main.nf b/modules/nf-core/sentieon/dedup/main.nf index 5735df7340..976d0baa14 100644 --- a/modules/nf-core/sentieon/dedup/main.nf +++ b/modules/nf-core/sentieon/dedup/main.nf @@ -5,8 +5,8 @@ process SENTIEON_DEDUP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(bam), path(bai) diff --git a/modules/nf-core/sentieon/dnamodelapply/environment.yml b/modules/nf-core/sentieon/dnamodelapply/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/dnamodelapply/environment.yml +++ b/modules/nf-core/sentieon/dnamodelapply/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/dnamodelapply/main.nf b/modules/nf-core/sentieon/dnamodelapply/main.nf index b74e65a09f..acc7edd473 100644 --- a/modules/nf-core/sentieon/dnamodelapply/main.nf +++ b/modules/nf-core/sentieon/dnamodelapply/main.nf @@ -5,8 +5,8 @@ process SENTIEON_DNAMODELAPPLY { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(vcf), path(idx) diff --git a/modules/nf-core/sentieon/dnascope/environment.yml b/modules/nf-core/sentieon/dnascope/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/dnascope/environment.yml +++ b/modules/nf-core/sentieon/dnascope/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/dnascope/main.nf b/modules/nf-core/sentieon/dnascope/main.nf index c15b4c3dd8..f027783c24 100644 --- a/modules/nf-core/sentieon/dnascope/main.nf +++ b/modules/nf-core/sentieon/dnascope/main.nf @@ -5,8 +5,8 @@ process SENTIEON_DNASCOPE { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(bam), path(bai), path(intervals) diff --git a/modules/nf-core/sentieon/gvcftyper/environment.yml b/modules/nf-core/sentieon/gvcftyper/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/gvcftyper/environment.yml +++ b/modules/nf-core/sentieon/gvcftyper/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/gvcftyper/main.nf b/modules/nf-core/sentieon/gvcftyper/main.nf index 6817c6dbe2..bcfbddb007 100644 --- a/modules/nf-core/sentieon/gvcftyper/main.nf +++ b/modules/nf-core/sentieon/gvcftyper/main.nf @@ -5,8 +5,8 @@ process SENTIEON_GVCFTYPER { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(gvcfs), path(tbis), path(intervals) diff --git a/modules/nf-core/sentieon/haplotyper/environment.yml b/modules/nf-core/sentieon/haplotyper/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/haplotyper/environment.yml +++ b/modules/nf-core/sentieon/haplotyper/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/haplotyper/main.nf b/modules/nf-core/sentieon/haplotyper/main.nf index a04b342caf..18d65f5aa3 100644 --- a/modules/nf-core/sentieon/haplotyper/main.nf +++ b/modules/nf-core/sentieon/haplotyper/main.nf @@ -5,15 +5,15 @@ process SENTIEON_HAPLOTYPER { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(input), path(input_index), path(intervals), path(recal_table) - tuple val(meta1), path(fasta) - tuple val(meta2), path(fai) - tuple val(meta3), path(dbsnp) - tuple val(meta4), path(dbsnp_tbi) + tuple val(meta2), path(fasta) + tuple val(meta3), path(fai) + tuple val(meta4), path(dbsnp) + tuple val(meta5), path(dbsnp_tbi) val(emit_vcf) val(emit_gvcf) @@ -50,7 +50,7 @@ process SENTIEON_HAPLOTYPER { // Create a gVCF command to export a gVCF def gvcf_cmd = emit_gvcf ? - gvcf_cmd = base_cmd + args3 + ' --emit_mode gvcf ' + prefix + '.g.vcf.gz' : + base_cmd + args3 + ' --emit_mode gvcf ' + prefix + '.g.vcf.gz' : "" def sentieonLicense = secrets.SENTIEON_LICENSE_BASE64 ? diff --git a/modules/nf-core/sentieon/haplotyper/meta.yml b/modules/nf-core/sentieon/haplotyper/meta.yml index ee0e6152f0..779d674db2 100644 --- a/modules/nf-core/sentieon/haplotyper/meta.yml +++ b/modules/nf-core/sentieon/haplotyper/meta.yml @@ -32,7 +32,7 @@ input: - recal_table: type: file description: Recalibration table from sentieon/qualcal (optional) - - - meta1: + - - meta2: type: map description: | Groovy Map containing sample information @@ -41,7 +41,7 @@ input: type: file description: Genome fasta file pattern: "*.{fa,fasta}" - - - meta2: + - - meta3: type: map description: | Groovy Map containing sample information @@ -50,7 +50,7 @@ input: type: file description: The index of the FASTA reference. pattern: "*.fai" - - - meta3: + - - meta4: type: map description: | Groovy Map containing sample information @@ -58,7 +58,7 @@ input: - dbsnp: type: file description: VCF file containing known sites (optional) - - - meta4: + - - meta5: type: map description: | Groovy Map containing sample information diff --git a/modules/nf-core/sentieon/varcal/environment.yml b/modules/nf-core/sentieon/varcal/environment.yml index 6449d0dbb9..ec48106f35 100644 --- a/modules/nf-core/sentieon/varcal/environment.yml +++ b/modules/nf-core/sentieon/varcal/environment.yml @@ -4,4 +4,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::sentieon=202308.03 + - bioconda::sentieon=202503 diff --git a/modules/nf-core/sentieon/varcal/main.nf b/modules/nf-core/sentieon/varcal/main.nf index fb841c9117..5589af4975 100644 --- a/modules/nf-core/sentieon/varcal/main.nf +++ b/modules/nf-core/sentieon/varcal/main.nf @@ -5,8 +5,8 @@ process SENTIEON_VARCAL { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/a6/a64461f38d76bebea8e21441079e76e663e1168b0c59dafee6ee58440ad8c8ac/data' : - 'community.wave.seqera.io/library/sentieon:202308.03--59589f002351c221' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/80/80ccb05eb4f1a193a3bd99c4da90f55f74ea6556c25f154e53e1ff5a6caa372d/data' : + 'community.wave.seqera.io/library/sentieon:202503--5e378058d837c58c' }" input: tuple val(meta), path(vcf), path(tbi) // input vcf and tbi of variants to recalibrate @@ -29,21 +29,33 @@ process SENTIEON_VARCAL { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def labels_command = '' - // labels is a list. Here is an example of what labels might look like: // ['--resource:dbsnp,known=false,training=true,truth=false,prior=2.0 dbsnp_146.hg38.vcf.gz', '--resource:gatk,known=false,training=true,truth=true,prior=10.0 Homo_sapiens_assembly38.known_indels.vcf.gz --resource:mills,known=false,training=true,truth=true,prior=10.0 Mills_and_1000G_gold_standard.indels.hg38.vcf.gz'] - for(label in labels){ - for(gatk_resource_string in label.split('--resource:').findAll()){ // The findAll cmd is there to remove any empty string elements in the list - def items = gatk_resource_string.split(' ') - // Here is an example of what the list items might look like: - // ['dbsnp,known=false,training=true,truth=false,prior=2.0', 'dbsnp_146.hg38.vcf.gz'] - if (items.size() != 2) { - error("Expected the list '${items}' to contain two elements.") - } - labels_command += "--resource ${items[1]} --resource_param ${items[0]} " + def processResourceString = { resource_string -> + def items = resource_string.split(' ', 2) + if (items.size() != 2) { + error("Expected the resource string '${resource_string}' to contain two elements separated by a space.") + } + "--resource ${items[1]} --resource_param ${items[0].replaceFirst('^--resource:', '')}" + } + + def processLabels = { input -> + if (input instanceof String) { + return input.split('--resource:') + .findAll() + .collect { processResourceString(it) } + .join(' ') + } else if (input instanceof List) { + return input.collect { label -> + processResourceString(label.replaceFirst('^--resource:', '')) + }.join(' ') + } else { + error("Expected 'labels' to be either a String or a List, but got ${input.getClass()}") } } + + def labels_command = labels instanceof String && labels.trim().isEmpty() ? '' : processLabels(labels) + def sentieonLicense = secrets.SENTIEON_LICENSE_BASE64 ? "export SENTIEON_LICENSE=\$(mktemp);echo -e \"${secrets.SENTIEON_LICENSE_BASE64}\" | base64 -d > \$SENTIEON_LICENSE; " : "" From c3de166c93fab476c2a989b0fde693b13fdaa715 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Fri, 9 May 2025 14:38:05 +0200 Subject: [PATCH 30/38] update snapshot --- tests/sentieon.nf.test.snap | 9 ++++----- 1 file changed, 4 insertions(+), 5 deletions(-) diff --git a/tests/sentieon.nf.test.snap b/tests/sentieon.nf.test.snap index f0405e0443..e6d7bdf5ac 100644 --- a/tests/sentieon.nf.test.snap +++ b/tests/sentieon.nf.test.snap @@ -15,7 +15,6 @@ "GATK4_MARKDUPLICATES": { "gatk4": "4.6.1.0", "samtools": 1.21 - }, "INDEX_CRAM": { "samtools": 1.21 @@ -27,7 +26,7 @@ "samtools": 1.21 }, "SENTIEON_BWAMEM": { - "sentieon": 202308.03, + "sentieon": 202503, "bwa": "0.7.17-r1188" }, "Workflow": { @@ -139,8 +138,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.6" + "nextflow": "25.04.0" }, - "timestamp": "2025-04-28T14:28:28.391037334" + "timestamp": "2025-05-09T14:37:44.933144632" } -} +} \ No newline at end of file From b7c69dab9a6b6b5be95b668ec8bb6847d57a2622 Mon Sep 17 00:00:00 2001 From: Simon Pearce <24893913+SPPearce@users.noreply.github.com> Date: Fri, 9 May 2025 14:01:27 +0100 Subject: [PATCH 31/38] Apply suggestions from code review --- CHANGELOG.md | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 5564081b55..dd3a302333 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -39,13 +39,14 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | `bcftools` | 1.2 | 1.21 | | `fastp` | 0.23.4 | 0.24.0 | | `fgbio` | 2.2.1 | 2.4.0 | -| `gatk4` | 4.5 | 4.6 | +| `gatk4` | 4.5.0.0 | 4.6.1.0 | | `mosdepth` | 0.3.8 | 0.3.10 | | `MuSE` | | 2.1.2 | | `MultiQC` | 1.25.1 | 1.28 | | `samtools` (in `BWAMEM1_MEM`) | 1.2 | 1.21 | | `samtools` (in `BWAMEM2_MEM`) | 1.19.2 | 1.21 | | `samtools` (in `GATK4_MARKDUPLICATES`) | 1.19.2 | 1.21 | +| `sentieon` | 202308.03 | 202503 | | `tabix` | 1.2 | 1.21 | ### Parameters From 9e7f0959afe5319647e5ce1370c7cb6cea2a47c7 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Tue, 13 May 2025 20:36:17 -0400 Subject: [PATCH 32/38] update bcftools --- modules.json | 6 +-- .../bcftools/annotate/bcftools-annotate.diff | 14 +++--- modules/nf-core/bcftools/concat/main.nf | 3 +- modules/nf-core/bcftools/norm/main.nf | 14 +++--- modules/nf-core/samtools/mpileup/main.nf | 17 ++++---- modules/nf-core/samtools/mpileup/meta.yml | 9 +++- .../local/bam_variant_calling_mpileup/main.nf | 43 +++++++++---------- ...s_concatenation_normalization.nf.test.snap | 8 ++-- 8 files changed, 60 insertions(+), 54 deletions(-) diff --git a/modules.json b/modules.json index 7a8083a8ae..231e1d38f4 100644 --- a/modules.json +++ b/modules.json @@ -18,7 +18,7 @@ }, "bcftools/concat": { "branch": "master", - "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", + "git_sha": "1503efe8f6450e71218097f93cf43e4b625018d4", "installed_by": ["modules"] }, "bcftools/mpileup": { @@ -28,7 +28,7 @@ }, "bcftools/norm": { "branch": "master", - "git_sha": "c9c3ef86c1892413b3c86fb38c4e39fd7288512f", + "git_sha": "39fed2e840a805454a64dda9c2ef64c00e2c6781", "installed_by": ["modules"] }, "bcftools/sort": { @@ -414,7 +414,7 @@ }, "samtools/mpileup": { "branch": "master", - "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d", + "git_sha": "7e20d971c70d78dbd9f610698267f37b7fb3d38a", "installed_by": ["modules"] }, "samtools/stats": { diff --git a/modules/nf-core/bcftools/annotate/bcftools-annotate.diff b/modules/nf-core/bcftools/annotate/bcftools-annotate.diff index ce9a8eb5d7..e13b9c104c 100644 --- a/modules/nf-core/bcftools/annotate/bcftools-annotate.diff +++ b/modules/nf-core/bcftools/annotate/bcftools-annotate.diff @@ -16,11 +16,11 @@ Changes in 'bcftools/annotate/main.nf': 'modules/nf-core/bcftools/annotate/meta.yml' is unchanged 'modules/nf-core/bcftools/annotate/environment.yml' is unchanged -'modules/nf-core/bcftools/annotate/tests/main.nf.test.snap' was removed -'modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config' was removed -'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config' was removed -'modules/nf-core/bcftools/annotate/tests/bcf.config' was removed -'modules/nf-core/bcftools/annotate/tests/vcf.config' was removed -'modules/nf-core/bcftools/annotate/tests/main.nf.test' was removed -'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config' was removed +'modules/nf-core/bcftools/annotate/tests/main.nf.test.snap' is unchanged +'modules/nf-core/bcftools/annotate/tests/vcf_gz_index.config' is unchanged +'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_csi.config' is unchanged +'modules/nf-core/bcftools/annotate/tests/bcf.config' is unchanged +'modules/nf-core/bcftools/annotate/tests/vcf.config' is unchanged +'modules/nf-core/bcftools/annotate/tests/main.nf.test' is unchanged +'modules/nf-core/bcftools/annotate/tests/vcf_gz_index_tbi.config' is unchanged ************************************************************ diff --git a/modules/nf-core/bcftools/concat/main.nf b/modules/nf-core/bcftools/concat/main.nf index fc756e11d8..7f6874e553 100644 --- a/modules/nf-core/bcftools/concat/main.nf +++ b/modules/nf-core/bcftools/concat/main.nf @@ -29,6 +29,7 @@ process BCFTOOLS_CONCAT { args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : args.contains("--output-type v") || args.contains("-Ov") ? "vcf" : "vcf" + def input = vcfs.sort{it.toString()}.join(" ") """ ${create_input_index} @@ -36,7 +37,7 @@ process BCFTOOLS_CONCAT { --output ${prefix}.${extension} \\ $args \\ --threads $task.cpus \\ - ${vcfs} + ${input} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/bcftools/norm/main.nf b/modules/nf-core/bcftools/norm/main.nf index 3b226f2748..3ad9b35cc2 100644 --- a/modules/nf-core/bcftools/norm/main.nf +++ b/modules/nf-core/bcftools/norm/main.nf @@ -51,12 +51,16 @@ process BCFTOOLS_NORM { args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : args.contains("--output-type v") || args.contains("-Ov") ? "vcf" : "vcf.gz" - def index = args.contains("--write-index=tbi") || args.contains("-W=tbi") ? "tbi" : - args.contains("--write-index=csi") || args.contains("-W=csi") ? "csi" : - args.contains("--write-index") || args.contains("-W") ? "csi" : - "" + def index = '' + if (extension in ['vcf.gz', 'bcf', 'bcf.gz']) { + if (['--write-index=tbi', '-W=tbi'].any { args.contains(it) } && extension == 'vcf.gz') { + index = 'tbi' + } else if (['--write-index=tbi', '-W=tbi', '--write-index=csi', '-W=csi', '--write-index', '-W'].any { args.contains(it) }) { + index = 'csi' + } + } def create_cmd = extension.endsWith(".gz") ? "echo '' | gzip >" : "touch" - def create_index = extension.endsWith(".gz") && index.matches("csi|tbi") ? "touch ${prefix}.${extension}.${index}" : "" + def create_index = index ? "touch ${prefix}.${extension}.${index}" : "" """ ${create_cmd} ${prefix}.${extension} diff --git a/modules/nf-core/samtools/mpileup/main.nf b/modules/nf-core/samtools/mpileup/main.nf index 925c8244e0..8693aa0477 100644 --- a/modules/nf-core/samtools/mpileup/main.nf +++ b/modules/nf-core/samtools/mpileup/main.nf @@ -9,7 +9,7 @@ process SAMTOOLS_MPILEUP { input: tuple val(meta), path(input), path(intervals) - path fasta + tuple val(meta2), path(fasta) output: tuple val(meta), path("*.mpileup.gz"), emit: mpileup @@ -19,15 +19,16 @@ process SAMTOOLS_MPILEUP { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def intervals_arg = intervals ? "-l ${intervals}" : "" + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def fasta_cmd = fasta ? "--fasta-ref $fasta" : "" + def intervals_cmd = intervals ? "-l ${intervals}" : "" """ samtools mpileup \\ - --fasta-ref $fasta \\ + $fasta_cmd \\ --output ${prefix}.mpileup \\ $args \\ - $intervals_arg \\ + $intervals_cmd \\ $input bgzip ${prefix}.mpileup @@ -38,11 +39,9 @@ process SAMTOOLS_MPILEUP { """ stub: - def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def intervals_arg = intervals ? "-l ${intervals}" : "" """ - touch ${prefix}.mpileup.gz + echo | gzip > ${prefix}.mpileup.gz cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/mpileup/meta.yml b/modules/nf-core/samtools/mpileup/meta.yml index 0655e08727..6195138ef0 100644 --- a/modules/nf-core/samtools/mpileup/meta.yml +++ b/modules/nf-core/samtools/mpileup/meta.yml @@ -21,7 +21,7 @@ input: type: map description: | Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] + e.g. [ id:'test' ] - input: type: file description: BAM/CRAM/SAM file @@ -30,7 +30,12 @@ input: type: file description: Interval FILE pattern: "*.bed" - - - fasta: + - - meta2: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - fasta: type: file description: FASTA reference file pattern: "*.{fasta,fa}" diff --git a/subworkflows/local/bam_variant_calling_mpileup/main.nf b/subworkflows/local/bam_variant_calling_mpileup/main.nf index 9a3929504d..54149e214c 100644 --- a/subworkflows/local/bam_variant_calling_mpileup/main.nf +++ b/subworkflows/local/bam_variant_calling_mpileup/main.nf @@ -4,10 +4,10 @@ // For all modules here: // A when clause condition is defined in the conf/modules.config to determine if the module should be run -include { BCFTOOLS_MPILEUP } from '../../../modules/nf-core/bcftools/mpileup/main' -include { CAT_CAT as CAT_MPILEUP } from '../../../modules/nf-core/cat/cat/main' -include { GATK4_MERGEVCFS as MERGE_BCFTOOLS_MPILEUP } from '../../../modules/nf-core/gatk4/mergevcfs/main' -include { SAMTOOLS_MPILEUP } from '../../../modules/nf-core/samtools/mpileup/main' +include { BCFTOOLS_MPILEUP } from '../../../modules/nf-core/bcftools/mpileup' +include { CAT_CAT as CAT_MPILEUP } from '../../../modules/nf-core/cat/cat' +include { GATK4_MERGEVCFS as MERGE_BCFTOOLS_MPILEUP } from '../../../modules/nf-core/gatk4/mergevcfs' +include { SAMTOOLS_MPILEUP } from '../../../modules/nf-core/samtools/mpileup' workflow BAM_VARIANT_CALLING_MPILEUP { take: @@ -20,46 +20,44 @@ workflow BAM_VARIANT_CALLING_MPILEUP { versions = Channel.empty() // Combine cram and intervals for spread and gather strategy - cram_intervals = cram.combine(intervals) - // Move num_intervals to meta map and reorganize channel for BCFTOOLS_MPILEUP/SAMTOOLS_MPILEUP modules - .map{ meta, cram, crai, intervals, num_intervals -> [ meta + [ num_intervals:num_intervals ], cram, intervals ] } + cram_intervals = cram + .combine(intervals) + .map { meta, cram_, _crai, intervals_, num_intervals -> [meta + [num_intervals: num_intervals], cram_, intervals_] } // Run, if --tools mpileup keep_bcftools_mpileup = false BCFTOOLS_MPILEUP(cram_intervals, fasta, keep_bcftools_mpileup) //Only run, if --tools ControlFreec - SAMTOOLS_MPILEUP(cram_intervals, fasta.map{ meta, fasta -> [ fasta ] }) + SAMTOOLS_MPILEUP(cram_intervals, fasta) // Figuring out if there is one or more vcf(s) from the same sample - vcf_mpileup = BCFTOOLS_MPILEUP.out.vcf.branch{ - // Use meta.num_intervals to asses number of intervals - intervals: it[0].num_intervals > 1 + vcf_mpileup = BCFTOOLS_MPILEUP.out.vcf.branch { + intervals: it[0].num_intervals > 1 no_intervals: it[0].num_intervals <= 1 } // Figuring out if there is one or more mpileup(s) from the same sample - mpileup_samtools = SAMTOOLS_MPILEUP.out.mpileup.branch{ - // Use meta.num_intervals to asses number of intervals - intervals: it[0].num_intervals > 1 + mpileup_samtools = SAMTOOLS_MPILEUP.out.mpileup.branch { + intervals: it[0].num_intervals > 1 no_intervals: it[0].num_intervals <= 1 } // Merge mpileup and natural order sort them - mpileup_to_merge = mpileup_samtools.intervals.map{ meta, pileup -> [ groupKey(meta, meta.num_intervals), pileup ] }.groupTuple(sort:true) + mpileup_to_merge = mpileup_samtools.intervals.map { meta, pileup -> [groupKey(meta, meta.num_intervals), pileup] }.groupTuple(sort: true) CAT_MPILEUP(mpileup_to_merge) // Merge VCF - vcf_to_merge = vcf_mpileup.intervals.map{ meta, vcf -> [ groupKey(meta, meta.num_intervals), vcf ] }.groupTuple() + vcf_to_merge = vcf_mpileup.intervals.map { meta, vcf -> [groupKey(meta, meta.num_intervals), vcf] }.groupTuple() MERGE_BCFTOOLS_MPILEUP(vcf_to_merge, dict) // Mix intervals and no_intervals channels together - mpileup = CAT_MPILEUP.out.file_out.mix(mpileup_samtools.no_intervals) - // add variantcaller to meta map and remove no longer necessary field: num_intervals - .map{ meta, mpileup -> [ meta - meta.subMap('num_intervals') + [ variantcaller:'samtools' ], mpileup ] } - vcf = MERGE_BCFTOOLS_MPILEUP.out.vcf.mix(vcf_mpileup.no_intervals) - // add variantcaller to meta map and remove no longer necessary field: num_intervals - .map{ meta, vcf -> [ meta - meta.subMap('num_intervals') + [ variantcaller:'bcftools' ], vcf ] } + mpileup = CAT_MPILEUP.out.file_out + .mix(mpileup_samtools.no_intervals) + .map { meta, mpileup -> [meta - meta.subMap('num_intervals') + [variantcaller: 'samtools'], mpileup] } + vcf = MERGE_BCFTOOLS_MPILEUP.out.vcf + .mix(vcf_mpileup.no_intervals) + .map { meta, vcf -> [meta - meta.subMap('num_intervals') + [variantcaller: 'bcftools'], vcf] } versions = versions.mix(SAMTOOLS_MPILEUP.out.versions) versions = versions.mix(BCFTOOLS_MPILEUP.out.versions) @@ -69,6 +67,5 @@ workflow BAM_VARIANT_CALLING_MPILEUP { emit: mpileup vcf - versions } diff --git a/tests/postprocess_concatenation_normalization.nf.test.snap b/tests/postprocess_concatenation_normalization.nf.test.snap index c51159f262..9cfb460da9 100644 --- a/tests/postprocess_concatenation_normalization.nf.test.snap +++ b/tests/postprocess_concatenation_normalization.nf.test.snap @@ -266,8 +266,8 @@ "No BAM files", "No CRAM files", [ - "testN.germline.vcf.gz:md5,184743db45c933febc5557d08b19f23c", - "testT.germline.vcf.gz:md5,7bac441a7c84790f43d26a73e10be9b5", + "testN.germline.vcf.gz:md5,141a2cc53b0a9d4a0ab4d779cb1e487", + "testT.germline.vcf.gz:md5,9119ee2c970c37729dcb35d4b88f9d10", "testN.freebayes.vcf.gz:md5,1d98e39fe458af9020283de18c764055", "testT.freebayes.vcf.gz:md5,387b7d48d04ad3b294f07173e6550fc7", "testN.haplotypecaller.filtered.vcf.gz:md5,df2040bf1bee0252581824d11d5d87d1", @@ -284,8 +284,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "25.04.0" + "nextflow": "25.04.1" }, - "timestamp": "2025-05-09T10:37:11.370312794" + "timestamp": "2025-05-13T18:05:02.912735659" } } \ No newline at end of file From 9becb4e71de539590bf3aec28df17631fd7f0590 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Tue, 13 May 2025 21:07:24 -0400 Subject: [PATCH 33/38] update snapshot --- tests/postprocess_concatenation.nf.test.snap | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/tests/postprocess_concatenation.nf.test.snap b/tests/postprocess_concatenation.nf.test.snap index a67d23175d..c388b0fc99 100644 --- a/tests/postprocess_concatenation.nf.test.snap +++ b/tests/postprocess_concatenation.nf.test.snap @@ -212,7 +212,7 @@ "No BAM files", "No CRAM files", [ - "testN.germline.vcf.gz:md5,184743db45c933febc5557d08b19f23c", + "testN.germline.vcf.gz:md5,141a2cc53b0a9d4a0ab4d779cb1e487", "testT.germline.vcf.gz:md5,7bac441a7c84790f43d26a73e10be9b5", "testN.freebayes.vcf.gz:md5,1d98e39fe458af9020283de18c764055", "testT.freebayes.vcf.gz:md5,387b7d48d04ad3b294f07173e6550fc7", @@ -224,8 +224,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "25.04.0" + "nextflow": "25.04.1" }, - "timestamp": "2025-05-09T10:35:20.716677726" + "timestamp": "2025-05-13T21:06:57.972914793" } } \ No newline at end of file From 506cefb5f958a5e150082e365ef743a8c370e33a Mon Sep 17 00:00:00 2001 From: maxulysse Date: Tue, 13 May 2025 21:40:33 -0400 Subject: [PATCH 34/38] fix stderr tests --- tests/samplesheets.nf.test | 4 ++-- tests/samplesheets.nf.test.snap | 14 ++++++++------ 2 files changed, 10 insertions(+), 8 deletions(-) diff --git a/tests/samplesheets.nf.test b/tests/samplesheets.nf.test index da255ae6d1..5b10094767 100644 --- a/tests/samplesheets.nf.test +++ b/tests/samplesheets.nf.test @@ -18,7 +18,7 @@ nextflow_pipeline { assert workflow.failed assertAll( { assert snapshot( - workflow.stderr.toString().split(",")[0..1,3..5] + workflow.stderr.toString().split(",").findAll { !it.contains("is available - Please consider updating your version to") && !it.contains("Validation of file failed") && !it.contains("Check script") } ).match() } ) } @@ -39,7 +39,7 @@ nextflow_pipeline { assert workflow.failed assertAll( { assert snapshot( - workflow.stderr.toString().split(",")[0] + workflow.stderr.toString().split(",").findAll { !it.contains("is available - Please consider updating your version to") } ).match() } ) } diff --git a/tests/samplesheets.nf.test.snap b/tests/samplesheets.nf.test.snap index b8e547d70a..e701e9329a 100644 --- a/tests/samplesheets.nf.test.snap +++ b/tests/samplesheets.nf.test.snap @@ -1,18 +1,20 @@ { "-profile test --step variant_calling --input tests/csv/3.0/recalibrated_somatic_two_normal_one_sample.csv": { "content": [ - "[Patient [test] has more than one sample [2] with normal status [0] and one sample with tumor status [1].]" + [ + " Patient [test] has more than one sample [2] with normal status [0] and one sample with tumor status [1].]" + ] ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.5" + "nextflow": "25.04.1" }, - "timestamp": "2025-04-03T17:48:43.052129562" + "timestamp": "2025-05-13T21:38:02.778427213" }, "-profile test --input tests/csv/3.0/sample_with_space.csv": { "content": [ [ - "[\u001b[0;31mThe following invalid input values have been detected:", + " \u001b[0;31mThe following invalid input values have been detected:", " ", " \t-> Entry 2: Error for field 'sample' (test 2): \"test 2\" does not match regular expression [^\\S+$] (Sample ID must be provided", " cannot contain spaces and must be a string value)", @@ -21,8 +23,8 @@ ], "meta": { "nf-test": "0.9.2", - "nextflow": "24.10.5" + "nextflow": "25.04.1" }, - "timestamp": "2025-04-03T12:12:16.909966356" + "timestamp": "2025-05-13T21:39:18.834066513" } } \ No newline at end of file From 3f5b2c6914765063fdf54788861a6b24f7eb3b10 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Tue, 13 May 2025 22:02:51 -0400 Subject: [PATCH 35/38] same snapshot for same files in all tests --- tests/postprocess_concatenation_normalization.nf.test.snap | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tests/postprocess_concatenation_normalization.nf.test.snap b/tests/postprocess_concatenation_normalization.nf.test.snap index 9cfb460da9..c9b9320efe 100644 --- a/tests/postprocess_concatenation_normalization.nf.test.snap +++ b/tests/postprocess_concatenation_normalization.nf.test.snap @@ -267,7 +267,7 @@ "No CRAM files", [ "testN.germline.vcf.gz:md5,141a2cc53b0a9d4a0ab4d779cb1e487", - "testT.germline.vcf.gz:md5,9119ee2c970c37729dcb35d4b88f9d10", + "testT.germline.vcf.gz:md5,7bac441a7c84790f43d26a73e10be9b5", "testN.freebayes.vcf.gz:md5,1d98e39fe458af9020283de18c764055", "testT.freebayes.vcf.gz:md5,387b7d48d04ad3b294f07173e6550fc7", "testN.haplotypecaller.filtered.vcf.gz:md5,df2040bf1bee0252581824d11d5d87d1", From 493301acf001419b261c40175ffee43ee31960e0 Mon Sep 17 00:00:00 2001 From: Maxime U Garcia Date: Wed, 14 May 2025 15:06:34 +0200 Subject: [PATCH 36/38] Update CHANGELOG.md Co-authored-by: Friederike Hanssen --- CHANGELOG.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index afb4d014b5..9fe5a1591e 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -36,7 +36,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | Dependency | Old version | New version | | -------------------------------------- | ----------- | ----------- | -| `bcftools` | 1.2 | 1.21 | +| `bcftools` | 1.20 | 1.21 | | `fastp` | 0.23.4 | 0.24.0 | | `fgbio` | 2.2.1 | 2.4.0 | | `gatk4` | 4.5.0.0 | 4.6.1.0 | From ca6524d805004660e0cf18d38b26554c2b681f01 Mon Sep 17 00:00:00 2001 From: Maxime U Garcia Date: Wed, 14 May 2025 15:21:31 +0200 Subject: [PATCH 37/38] Update CHANGELOG.md Co-authored-by: Friederike Hanssen --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 9fe5a1591e..7a29304ca4 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -37,6 +37,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | Dependency | Old version | New version | | -------------------------------------- | ----------- | ----------- | | `bcftools` | 1.20 | 1.21 | +| `ensemblvep` | 113.0 | 113.4 | | `fastp` | 0.23.4 | 0.24.0 | | `fgbio` | 2.2.1 | 2.4.0 | | `gatk4` | 4.5.0.0 | 4.6.1.0 | From 38fcafdd6a79c0f188dcab5b8d21c1f7a9411df5 Mon Sep 17 00:00:00 2001 From: maxulysse Date: Mon, 19 May 2025 09:47:27 +0200 Subject: [PATCH 38/38] somehow [ is not registering the same on my computer and GHA --- tests/samplesheets.nf.test | 4 ++-- tests/samplesheets.nf.test.snap | 18 ++++++++---------- 2 files changed, 10 insertions(+), 12 deletions(-) diff --git a/tests/samplesheets.nf.test b/tests/samplesheets.nf.test index 5b10094767..ca89416d5b 100644 --- a/tests/samplesheets.nf.test +++ b/tests/samplesheets.nf.test @@ -18,7 +18,7 @@ nextflow_pipeline { assert workflow.failed assertAll( { assert snapshot( - workflow.stderr.toString().split(",").findAll { !it.contains("is available - Please consider updating your version to") && !it.contains("Validation of file failed") && !it.contains("Check script") } + workflow.stderr.toString().replace("[", "").replace("]", "").split(",")[0..1,3..5] ).match() } ) } @@ -39,7 +39,7 @@ nextflow_pipeline { assert workflow.failed assertAll( { assert snapshot( - workflow.stderr.toString().split(",").findAll { !it.contains("is available - Please consider updating your version to") } + workflow.stderr.toString().replace("[", "").replace("]", "").split(",")[0] ).match() } ) } diff --git a/tests/samplesheets.nf.test.snap b/tests/samplesheets.nf.test.snap index e701e9329a..ca95acd65e 100644 --- a/tests/samplesheets.nf.test.snap +++ b/tests/samplesheets.nf.test.snap @@ -1,30 +1,28 @@ { "-profile test --step variant_calling --input tests/csv/3.0/recalibrated_somatic_two_normal_one_sample.csv": { "content": [ - [ - " Patient [test] has more than one sample [2] with normal status [0] and one sample with tumor status [1].]" - ] + "Patient test has more than one sample 2 with normal status 0 and one sample with tumor status 1." ], "meta": { "nf-test": "0.9.2", - "nextflow": "25.04.1" + "nextflow": "25.04.2" }, - "timestamp": "2025-05-13T21:38:02.778427213" + "timestamp": "2025-05-19T09:45:25.306281592" }, "-profile test --input tests/csv/3.0/sample_with_space.csv": { "content": [ [ - " \u001b[0;31mThe following invalid input values have been detected:", + "\u001b0;31mThe following invalid input values have been detected:", " ", - " \t-> Entry 2: Error for field 'sample' (test 2): \"test 2\" does not match regular expression [^\\S+$] (Sample ID must be provided", + " \t-> Entry 2: Error for field 'sample' (test 2): \"test 2\" does not match regular expression ^\\S+$ (Sample ID must be provided", " cannot contain spaces and must be a string value)", - " \u001b[0m" + " \u001b0m" ] ], "meta": { "nf-test": "0.9.2", - "nextflow": "25.04.1" + "nextflow": "25.04.2" }, - "timestamp": "2025-05-13T21:39:18.834066513" + "timestamp": "2025-05-19T09:44:50.436290454" } } \ No newline at end of file