python=3.7
PAM Depletion data Analysis pipeline. Including 3 main function:
-
Extract the PAM sequence
-
Filter the PAM sequence
-
Plot the heatmap and weblogo
python PAMDA.py -c /path/to/con -e /path/to/exp -f CCGGCGACGTTGGGTCAACT -t TGTCCTCTTCCTCTTTAGCG -ft 10 -o /path/to/save
-h, --help: show this help message and exit
-c, --control: control filepath
-e, --experiment: '.fastq' filepath
-f, --fFlank: 5'-flanking sequence of PAM
-t, --tFlank: 3'-flanking sequence of PAM
-ft, --foldTH: Fold threshold for plotting WebLogo, default is 10
-o, --output: directory path for storing the output files.