BIGSI can search a collection of raw (fastq/bam), contigs or assembly for genes, variant alleles and arbitrary sequence. It can scale to millions of bacterial genomes requiring ~3MB of disk per sample while maintaining millisecond kmer queries in the collection.
This tool was formally named "Coloured Bloom Graph" or "CBG" in reference to the fact that it can be viewed as a coloured probabilistic de Bruijn graph.
Documentation can be found at https://bigsi.readme.io/. An index of the microbial ENA/SRA (Dec 2016) can be queried at http://www.bigsi.io.
You can read more in our preprint here: https://www.biorxiv.org/content/early/2017/12/15/234955.
bigsi has a docker image that bundles mccortex, berkeley DB and BIGSI in one image. See: https://bigsi.readme.io/docs for install instructions.
Requires mccortex.
mccortex/bin/mccortex31 build -k 31 -s test1 -1 example-data/kmers.txt example-data/test1.ctx
mccortex/bin/mccortex31 build -k 31 -s test2 -1 example-data/kmers.txt example-data/test2.ctx
bigsi init test-bigsi --k 31 --m 1000 --h 1
bigsi bloom --db test-bigsi -c example-data/test1.ctx example-data/test1.bloom
bigsi bloom --db test-bigsi -c example-data/test2.ctx example-data/test2.bloom
bigsi build test-bigsi example-data/test1.bloom example-data/test2.bloom -s s1 -s s2
bigsi search -o tsv --db test-bigsi -s CGGCGAGGAAGCGTTAAATCTCTTTCTGACG
bigsi insert test-bigsi example-data/test3.bloom s3
docker pull phelimb/bigsi
docker run phelimb/bigsi bigsi --help
BIGSI using single colour graphs to construct the coloured graph. Use mccortex to build.
PWD=`pwd`
docker run -v $PWD/example-data:/data phelimb/bigsi mccortex/bin/mccortex31 build -k 31 -s test1 -1 /data/kmers.txt /data/test1.ctx
docker run -v $PWD/example-data:/data phelimb/bigsi mccortex/bin/mccortex31 build -k 31 -s test2 -1 /data/kmers.txt /data/test2.ctx
docker run -v $PWD/example-data:/data phelimb/bigsi bigsi init /data/test.bigsi --k 31 --m 1000 --h 1
docker run -v $PWD/example-data:/data phelimb/bigsi bigsi bloom --db /data/test.bigsi -c /data/test1.ctx /data/test1.bloom
docker run -v $PWD/example-data:/data phelimb/bigsi bigsi bloom --db /data/test.bigsi -c /data/test1.ctx /data/test2.bloom
docker run -v $PWD/example-data:/data phelimb/bigsi bigsi build /data/test.bigsi /data/test1.bloom /data/test2.bloom
docker run -v $PWD/example-data:/data phelimb/bigsi bigsi search --db /data/test.bigsi -s CGGCGAGGAAGCGTTAAATCTCTTTCTGACG
Please cite
Phelim Bradley, Henk den Bakker, Eduardo Rocha, Gil McVean, Zamin Iqbal
bioRxiv 234955; doi: https://doi.org/10.1101/234955
if you use BIGSI in your work.