Release PR for 3.4.0 #782

jfy133 · 2025-04-01T13:07:11Z

PR checklist

Post-release version bump

…erver-fixes

megahit update

Fix checkm2 database schema checking

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

Fix languageserver errors

added ext.args ='c 10000 -o 0 --merge_last at 642

…ltiQC display

Co-authored-by: Jim Downie <19718667+prototaxites@users.noreply.github.com>

Added Trimmomatic, support contig for bining, set concoct default parameters

github-actions · 2025-04-01T13:08:34Z

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit a589eff

+| ✅ 334 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗  52 tests had warnings |!

❗ Test warnings:

pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
local_component_structure - rename_predastool.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - busco_save_download.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - quast_bins.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - pool_single_reads.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - centrifuge.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - bowtie2_assembly_build.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - combine_tsv.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - busco.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - bowtie2_assembly_align.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - busco_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - tiara_classify.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - quast.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - split_fasta.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - cat_db_generate.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - gtdbtk_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - pool_paired_reads.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - convert_depths.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - bin_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - bowtie2_removal_build.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - adjust_maxbin2_ext.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - quast_bins_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - busco_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - rename_postdastool.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - cat.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - cat_db.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - gtdbtk_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - mag_depths.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - mag_depths_plot.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - kraken2_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - mag_depths_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - cat_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - nanolyse.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - bowtie2_removal_align.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - krona.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - kraken2.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
local_component_structure - shortread_preprocessing.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - binning_preparation.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - binning_refinement.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - virus_identification.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - domain_classification.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - longread_preprocessing.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - ancient_dna.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - depths.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - binning.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - gtdbtk.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - bin_qc.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
local_component_structure - tiara.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: conf/igenomes_ignored.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File found: ro-crate-metadata.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Found nf-schema plugin
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: validation.help.enabled
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable found: validation.help.beforeText
nextflow_config - Config variable found: validation.help.afterText
nextflow_config - Config variable found: validation.help.command
nextflow_config - Config variable found: validation.summary.beforeText
nextflow_config - Config variable found: validation.summary.afterText
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config variable (correctly) not found: params.max_cpus
nextflow_config - Config variable (correctly) not found: params.max_memory
nextflow_config - Config variable (correctly) not found: params.max_time
nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
nextflow_config - Config variable (correctly) not found: params.validationLenientMode
nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config manifest.version does not contain dev for release: 3.4.0
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
nextflow_config - Config default value correct: params.spades_downstreaminput= scaffolds
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_concoct_chunksize= 10000
nextflow_config - Config default value correct: params.bin_concoct_overlap= 0
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.checkm2_db_version= 14897628
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 24.04.2, Config: 24.04.2
readme - README Zenodo placeholder was replaced with DOI.
plugin_includes - No wrong validation plugin imports have been found
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (0 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: template_version_comment.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
base_config - CAT found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - SPADES found in conf/base.config and Nextflow scripts.
base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - TRIMMOMATIC found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - COMBINE_BINQC_TSV found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
modules_config - CAT found in conf/modules.config and Nextflow scripts.
modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_CUTUPFASTA found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.2.0
version_consistency - Version tags are numeric and consistent between container, release tag and config.
included_configs - Pipeline config includes custom configs.

Run details

nf-core/tools version 3.2.0
Run at 2025-04-04 07:39:56

Update SPAdes to 4.1.0

heuermh

LGTM, left some suggestions for minor doc typos

README.md

docs/output.md

nextflow_schema.json

erikrikarddaniel

👍

CHANGELOG.md

Co-authored-by: Michael L Heuer <heuermh@acm.org>

jfy133 · 2025-04-04T06:16:35Z

Thank you @heuermh @erikrikarddaniel !

dialvarezs and others added 30 commits December 9, 2024 03:03

Solve languageserver errors in subworkflows

36cf916

Merge remote-tracking branch 'upstream/dev' into language-server-fixes

9dbea0f

Merge remote-tracking branch 'upstream/dev' into language-server-fixes

475dc2a

Merge remote-tracking branch 'upstream/dev' into language-server-fixes

fe308df

Post-release version bump

296784f

[automated] Fix code linting

0519e51

Merge pull request #766 from nf-core/post-3.3.1-versionbump

14a0b38

Post-release version bump

Fix date in previous release

4898f25

Merge branch 'dev', remote-tracking branch 'upstream' into language-s…

ffa0d9d

…erver-fixes

More linting fixes

9753645

Update checkm2/databasedownload (removes one error)

48cc572

Remove non existent configs

1f58cbe

Update maxbin2 module

0d4a58d

Update prokka module

10f114a

Update changelog

8942b25

Merge branch 'dev' into language-server-fixes

55636d0

Revert unwanted module checksum change

601d197

megahit update

787a85f

updated CHANGELOG.md and README.md

fbae5ee

Update CHANGELOG.md

31dc61d

Merge pull request #769 from nf-core/megahit-update

a85116c

megahit update

Fix checkm2 database being checked as a directory but is actually file

b72c2d7

Fix URL

657f212

Merge pull request #771 from nf-core/checkm2-db-schema-fix

1470ef1

Fix checkm2 database schema checking

Merge branch 'dev' into language-server-fixes

242c06d

Update CHANGELOG.md

b993cd1

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

Update modules/local/busco.nf

07e3569

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

Remove commented code

e346460

Merge pull request #726 from dialvarezs/language-server-fixes

4fa99d3

Fix languageserver errors

Update CheckM2

e3f2e0b

Pranjal-Bioinfo and others added 18 commits April 1, 2025 20:19

Update shortread_preprocessing.nf

96a69b0

Update mag.nf

99bacae

Update modules.config

d360361

added ext.args ='c 10000 -o 0 --merge_last at 642

Renamed folder from Trimmomatic to trimmomatic

70ce796

Fixed linting issues

9ae4407

Removed test config change

1cddd6c

Added parameter spades_use_contigs_not_scaffolds

8868033

Fixed pre-commit

80b2877

Restored logos from dev

b2ea939

update changelog

8a8dc6d

Add output docs, change parameter name and extend description, fix Mu…

64d1154

…ltiQC display

Convert CONOCT parameters to user set

9582d0a

Update conf/modules.config

f9787f9

Added sateeshperi to CHANGELOG

d68ba9a

Updated changelog and fixed contigs/scaffold selector

bbd49df

Update README.md

1ff67b3

Co-authored-by: Jim Downie <19718667+prototaxites@users.noreply.github.com>

Added parameters to changelog

633dd05

Merge pull request #745 from Pranjal-Bioinfo/Trimmomatic-contig-concoct

f49ce2f

Added Trimmomatic, support contig for bining, set concoct default parameters

jfy133 added 3 commits April 2, 2025 08:07

update SPAdes to 4.1.0

fc89e7a

Merge pull request #783 from nf-core/spades-update

227bf1c

Update SPAdes to 4.1.0

Bump versions for release

94efbab

jfy133 marked this pull request as ready for review April 2, 2025 11:37

heuermh approved these changes Apr 2, 2025

View reviewed changes

README.md Outdated Show resolved Hide resolved

docs/output.md Outdated Show resolved Hide resolved

nextflow_schema.json Outdated Show resolved Hide resolved

nextflow_schema.json Outdated Show resolved Hide resolved

erikrikarddaniel approved these changes Apr 3, 2025

View reviewed changes

jfy133 commented Apr 4, 2025

View reviewed changes

CHANGELOG.md Outdated Show resolved Hide resolved

Apply suggestions from code review

5588f8d

Co-authored-by: Michael L Heuer <heuermh@acm.org>

Add updated diagrams

a589eff

jfy133 merged commit 4717d3d into master Apr 4, 2025
32 of 39 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Uh oh!

Release PR for 3.4.0 #782

Release PR for 3.4.0 #782

Uh oh!

Uh oh!

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Release PR for 3.4.0 #782

Release PR for 3.4.0 #782

Uh oh!

Conversation

PR checklist

Uh oh!

Uh oh!

nf-core pipelines lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

Choose a reason for hiding this comment

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Choose a reason for hiding this comment

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Uh oh!

`nf-core pipelines lint` overall result: Passed ✅ ⚠️