Reads containing small insertions or deletions are excluded #5
Comments
|
Sorry, I have no plans to support gapped alignment in rotate.
From: inari-ldavey ***@***.***>
Date: Thursday, 2 January 2025 at 15:49
To: richarddurbin/rotate ***@***.***>
Cc: Subscribed ***@***.***>
Subject: [richarddurbin/rotate] Reads containing small insertions or deletions are excluded (Issue #5)
Hi, I would like to thank you for creating this amazing tool. The ability to specify the search string is so useful. I am using this tool to rotate Nanopore reads and I noticed that many reads are excluded from the output because they have a small 1 bp insertion or deletion in the search string:
In this example below, a 40bp search string is aligned to a read. These 2 DNA sequences are very similar, but the read has 2 small deletions compared to the search string. Because of the offset that is caused by the first deletion, rotate requires a higher value for -m than you would anticipate: -m 14 instead of -m 2 in this case. Are there any plans to support specifying the number of allowed indels?
search string: TGGCGGGTAAACCTAAGAGAAAAGAGCGTTTATTAGAATA
|||||||||||||||||||||| |||||||||| ||||||
read: ...TGGCGGGTAAACCTAAGAGAAA-GAGCATTTAT-AGAATA...
^ first del
—
Reply to this email directly, view it on GitHub<#5>, or unsubscribe<https://github.com/notifications/unsubscribe-auth/AA2FXZWKPQEIKNSJIGTEJE32IVNXPAVCNFSM6AAAAABUQFZEA6VHI2DSMVQWIX3LMV43ASLTON2WKOZSG43DMMRVGI3DCMA>.
You are receiving this because you are subscribed to this thread.Message ID: ***@***.***>
|
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Hi, I would like to thank you for creating this amazing tool. The ability to specify the search string is so useful. I am using this tool to rotate Nanopore reads and I noticed that many reads are excluded from the output because they have a small 1 bp insertion or deletion in the search string:
In this example below, a 40bp search string is aligned to a read. These 2 DNA sequences are very similar, but the read has 2 small deletions compared to the search string. Because of the offset that is caused by the first deletion,
rotaterequires a higher value for -m than you would anticipate: -m 14 instead of -m 2 in this case. Are there any plans to support specifying the number of allowed indels?The text was updated successfully, but these errors were encountered: